Detection device and detection system
By combining the clamping mechanism, sealing mechanism and cutting mechanism, the problems of liquid evaporation and cross-reaction in existing detection devices are solved, achieving highly stable and accurate detection results, and improving ease of operation and high-throughput applications.
Patent Information
- Application Number
- CN202510788143.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-06-12
AI Technical Summary
Existing detection devices struggle to achieve high airtightness in nucleic acid amplification and enzymatic reactions, leading to changes in the concentration of reaction liquid components and a reduction in reaction volume. This affects the stability and accuracy of the detection results. Furthermore, manual operation increases the risk of liquid evaporation and cross-reaction, reducing the degree of automation in the operation.
The design employs a combination of clamping, sealing, cutting, and detection mechanisms. Through the cooperation of the heating chamber, phase change material, and cutting mechanism, liquid sealing and automatic mixing are achieved, reducing evaporation loss and improving the stability and accuracy of detection results.
It reduces the risk of liquid evaporation loss and cross-reaction, improves the stability and accuracy of detection results, and enhances the ease of operation and high-throughput application of detection.
Smart Images

Figure CN120891184A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of analytical detection, and in particular, the present application relates to a detection device and a detection system. BACKGROUND
[0002] With the increasing demand for detection in the fields of modern medicine, biochemistry, environmental science, food safety, etc., various detection methods are increasingly refined, automated, and integrated. In these methods, temperature-controlled reactions of reagent liquids are often involved (especially nucleic acid amplification, enzymatic reactions, or antigen-antibody binding reactions, etc.), and accurate and reliable temperature control and strict sealing are basic requirements. Fluctuations in temperature and sealing conditions during the reaction process can seriously affect the volume stability and component accuracy of the reaction solution, and thus affect the stability and accuracy of the entire detection result.
[0003] Currently, traditional kits or reaction systems for nucleic acid amplification, enzymatic reactions, or immunoassays usually adopt the form of disposable reaction test tubes or microplate plates. These reaction devices are sealed with caps or membranes. Although the caps or sealing membranes can prevent the overflow and evaporation of the reaction solution to some extent, the conventional scheme cannot completely achieve high airtight isolation due to the limitations of the reaction cavity structure or sealing design problems. Especially when the reaction system needs to maintain a high reaction temperature for a long time (such as polymerase chain reaction PCR or constant-temperature nucleic acid amplification reaction), water or volatile components in the reaction system inevitably evaporate, which not only leads to changes in the concentration of reaction solution components and a decrease in reaction volume, but also can increase the difference between repeated detection results, thereby reducing the stability and accuracy of the detection.
[0004] In addition, in some detection technology steps, the reaction solution needs to be mixed with other reagents or detection components after the reaction is completed to further complete subsequent detection analysis. This mixing of liquids often requires opening the reaction cavity or manual operation, which can cause liquid evaporation, reagent volatilization, or exogenous contamination during the opening period, as well as the risk of cross-reactions. Manual operation additionally reduces the degree of automation of the operation, affecting the simplicity of the operation and the high-throughput application of the detection.
[0005] Therefore, there is an urgent need in the industry for a detection device that has excellent sealing performance, can achieve precise temperature control and avoid liquid evaporation loss, and can automatically achieve liquid transmission and mixing after the reaction is completed. SUMMARY
[0006] In a first aspect of the present application, a detection device is provided, comprising:
[0007] a clamping mechanism, a heating cavity being provided in the clamping mechanism, a first mounting port being provided at the top of the heating cavity, and a heating assembly being provided in the heating cavity;
[0008] a sealing mechanism located below the clamping mechanism, the sealing mechanism comprising a through hole penetrating the sealing mechanism along a first direction, the through hole cooperating with the first mounting port for accommodating a liquid containing tube, an inner wall of the liquid containing tube near a tube opening being provided with a phase change material;
[0009] a cutting mechanism located in the through hole, the cutting mechanism being configured to contact and cut the liquid containing tube when the clamping mechanism is pressed downward along the first direction; and
[0010] a detection mechanism located on a side of the cutting mechanism away from the clamping mechanism and sealingly connected with the sealing mechanism.
[0011] The detection device of the present application has at least one of the following technical effects:
[0012] 1. The detection device of the present application can reduce the evaporation loss of the liquid in the liquid containing tube when the liquid containing tube is heated, and improve the stability and accuracy of the detection results;
[0013] 2. The detection device of the present application can reduce the risk of liquid evaporation, reagent volatilization, or exogenous contamination, and cross-reaction caused by transferring the liquid containing tube in the detection process, and improve the stability and accuracy of the detection results;
[0014] 3. The detection device of the present application can improve the simplicity of operation and the high-throughput application of detection.
[0015] In the second aspect of the present application, a detection system is provided, comprising the detection device of the first aspect of the present application.
[0016] As non-limiting examples, the present application provides the following embodiments:
[0017] 1. A detection device, comprising:
[0018] a clamping mechanism, the clamping mechanism being provided with a heating cavity, a first mounting port penetrating the top of the heating cavity, and a heating assembly being arranged in the heating cavity;
[0019] a sealing mechanism located below the clamping mechanism, the sealing mechanism comprising a through hole penetrating the sealing mechanism along a first direction, the through hole cooperating with the first mounting port for accommodating a liquid containing tube, an inner wall of the liquid containing tube near a tube opening being provided with a phase change material;
[0020] a cutting mechanism located in the through hole, the cutting mechanism being configured to contact and cut the liquid containing tube when the clamping mechanism is pressed downward along the first direction; and
[0021] A detection mechanism is located on the side of the cutting mechanism away from the clamping mechanism and is sealed to the sealing mechanism.
[0022] 2. The detection device according to embodiment 1, wherein a second mounting opening is provided on the first side wall of the heating cavity, and the heating assembly is detachably arranged in the second mounting opening.
[0023] 3. The detection device according to embodiment 2, wherein the heating assembly is arranged to heat the phase change material in the liquid containing tube when extending into the second mounting opening.
[0024] 4. The detection device according to any one of embodiments 1-3, wherein the side wall of the heating cavity is further provided with a through slot extending in the first direction, and the sealing mechanism is provided with a guide column extending in the first direction, the through slot and the guide column are correspondingly arranged and adapted to embed the guide column in the through slot when the clamping mechanism is pressed in the first direction.
[0025] 5. The detection device according to embodiment 4, wherein the guide column is arranged on the side of the sealing mechanism away from the second mounting opening.
[0026] 6. The detection device according to any one of embodiments 1-5, wherein the upper end of the through hole is provided with an elastic support assembly.
[0027] 7. The detection device according to any one of embodiments 1-6, wherein the upper end of the through hole is provided with a first elastic sealing ring, and the first elastic sealing ring is provided with a support assembly.
[0028] 8. The detection device according to any one of embodiments 1-7, wherein the heating cavity further comprises a second side wall and a third side wall arranged oppositely, and the second side wall and / or the third side wall is provided with a first groove extending at least partially through the second side wall and / or the third side wall in the first direction from the side of the clamping mechanism close to the sealing mechanism.
[0029] 9. The detection device according to embodiment 8, wherein the sealing mechanism further comprises a limiting block correspondingly arranged with the first groove and adapted to embed the limiting block in the first groove when the clamping mechanism is pressed in the first direction.
[0030] 10. The detection device according to embodiment 8 or 9, wherein the first groove is provided on both the second side wall and the third side wall.
[0031] 11. The detection device according to any one of embodiments 1-10, wherein the side wall of the sealing mechanism further comprises a plurality of snaps spaced along the first direction, and the bottom of the side wall of the clamping mechanism forms a first flange facing the interior of the clamping mechanism, the snaps being configured to cooperate with the first flange to limit upward movement of the clamping mechanism when the clamping mechanism is pressed downward along the first direction.
[0032] 12. The detection device according to embodiment 11, wherein the snaps comprise a first snap and a second snap, the first snap being positioned above the second snap, the first snap being configured to cooperate with the first flange to limit upward movement of the clamping mechanism when the clamping mechanism is pressed downward along the first direction to a point where the bottom of the liquid container contacts the cutting mechanism, and the second snap being configured to cooperate with the first flange to limit upward movement of the clamping mechanism after the bottom of the liquid container is cut by the cutting mechanism.
[0033] 13. The detection device according to embodiment 12, wherein the side wall of the sealing mechanism comprises a plurality of the first snaps and / or a plurality of the second snaps.
[0034] 14. The detection device according to any one of embodiments 9-13, wherein the stopper comprises a first stopper and a second stopper spaced along the first direction, the first stopper being positioned above the second stopper, the first stopper being configured to be embedded in the first groove when the clamping mechanism is not pressed downward, and the second stopper being configured to be embedded in the first groove together with the first stopper when the clamping mechanism is pressed downward along the first direction.
[0035] 15. The detection device according to embodiment 14, wherein the sealing mechanism further comprises a support mechanism, the support mechanism being detachably positioned between the first stopper and the second stopper, the support mechanism being configured to support the lower end of the clamping mechanism when the clamping mechanism is not pressed downward.
[0036] 16. The detection device according to any one of embodiments 1-15, wherein the clamping mechanism further comprises a viewing port.
[0037] 17. The detection device according to any one of embodiments 1-16, wherein the phase change material has a melting point of 40-120 °C.
[0038] 18. The detection device according to any one of embodiments 1-17, wherein the top of the heating cavity comprises one or more first mounting ports.
[0039] 19. The detection device of any one of embodiments 1-18, wherein the sealing mechanism comprises a first sealing portion and a second sealing portion, the through hole is provided on the first sealing portion, the second sealing portion is connected to the first sealing portion at an end away from the second mounting port, and the detection mechanism extends from the first sealing portion to the second sealing portion.
[0040] 20. The detection device of embodiment 19, wherein the second sealing portion is provided with an observation window.
[0041] 21. The detection device of embodiment 19 or 20, wherein the guide column is provided on the first sealing portion at a side close to the second sealing portion.
[0042] 22. The detection device of any one of embodiments 1-21, wherein the detection mechanism is provided with a pressing assembly, the pressing assembly is configured to press the deformed liquid container to extrude liquid after the clamping mechanism is cut by the cutting mechanism.
[0043] 23. The detection device of embodiment 22, wherein the pressing assembly is provided directly below the cutting mechanism.
[0044] 24. The detection device of any one of embodiments 1-23, wherein the detection mechanism comprises a detection module, the detection module comprises one or more of a test paper detection module, an electrochemical detection module, and an optical detection module.
[0045] 25. A detection system comprising the detection device of any one of embodiments 1-24.
[0046] 26. The detection system of embodiment 25, further comprising a sample processing device connected to the detection device.
[0047] 27. The detection system of embodiment 26, wherein the sample processing device comprises:
[0048] a push rod comprising a proximal end operation portion, a distal end sealing portion, and a collection portion located on a side of the distal end sealing portion away from the proximal end operation portion;
[0049] a barrel, an inner wall of the barrel being sealably coupled with the distal end sealing portion and the inner wall of the barrel being relatively movable with the push rod, one end of the barrel being provided with a push rod inlet, the other end of the barrel being provided with a collection portion outlet, the collection portion outlet being provided with a sealing layer, the sealing layer being configured to continue to push the push rod when the push rod contacts the sealing layer, and the collection portion being capable of penetrating the sealing layer; and
[0050] a target substance enrichment layer, which is arranged in the barrel and adjacent to the outlet of the collection part, the collection part being provided with a stripping part at one end away from the proximal operation part, the stripping part being configured to strip and carry out of the barrel the target substance enrichment layer when the collection part penetrates the sealing layer under the pushing of the push rod, and transfer the target substance enrichment layer to the liquid container of the detection device; or the target substance enrichment layer is arranged at one side of the collection part away from the proximal operation part, the target substance enrichment layer being configured to be carried out of the barrel by the collection part when the collection part penetrates the sealing layer, and transfer the target substance enrichment layer to the liquid container of the detection device.
[0051] 28. The detection system according to embodiment 27, wherein the distance between the outer peripheral wall of the collection part and the push rod axis is less than or equal to the distance between the outer peripheral wall of the distal sealing part and the push rod axis; and / or,
[0052] the sealing layer is a waterproof layer or a first waterproof and air-permeable layer; and / or,
[0053] the push rod is further provided with a breakable part, the breakable part being located between the collection part and the distal sealing part.
[0054] 29. The detection system according to embodiment 27 or 28, wherein the push rod is further provided with a breakable part, the distance between the outer peripheral wall of the breakable part and the push rod axis is less than or equal to the distance between the outer peripheral wall of the collection part and the push rod axis; and / or,
[0055] the breakable part comprises a first fracture.
[0056] 30. The detection system according to embodiment 28 or 29, wherein the breakable part comprises one or more first fractures, the first fractures being arranged continuously or at intervals along the circumference of the push rod.
[0057] 31. The detection system according to any one of embodiments 27-30, wherein the target substance enrichment layer is a porous layer; and / or,
[0058] the target substance enrichment layer comprises a filter material and / or an adsorption material; and / or,
[0059] the target substance enrichment layer is configured to allow the capture of a nucleic acid natural biological carrier in the biological sample; and / or,
[0060] the pore size of the target substance enrichment layer is 0.1 pm to 5 pm; and / or,
[0061] The target substance enrichment layer comprises an adsorption material suitable for specific binding with the target substance; and / or,
[0062] The target substance enrichment layer comprises one or more of a nitrocellulose (NC) layer, a cellulose acetate (CA) layer, a polyethersulfone (PES) layer, a polytetrafluoroethylene (PTFE) layer, a polyvinylidene fluoride (PVDF) layer, a nylon layer, a regenerated cellulose layer, a modified cellulose layer, and a glass fiber layer; and / or,
[0063] The distal end sealing portion is an elastic sealing portion; and / or,
[0064] The distal end sealing portion comprises a sealing ring and / or a piston; and / or,
[0065] The proximal end operating portion is provided with a pressing portion on a side distal to the distal end sealing portion.
[0066] 32. The detection system according to any one of embodiments 27-31, wherein the proximal end operating portion is provided with a pressing portion on a side distal to the distal end sealing portion, and a distance from an outer peripheral wall of the pressing portion to the push rod axis is greater than a distance from an outer peripheral wall of the distal end sealing portion to the push rod axis.
[0067] 33. The detection system according to any one of embodiments 27-32, wherein the collection portion is provided with a stripping portion at an end distal to the proximal end operating portion, and the stripping portion is provided with protrusions on a side distal to the proximal end operating portion.
[0068] 34. The detection system according to embodiment 33, wherein the protrusions have pointed tips; and / or,
[0069] The stripping portion comprises a plurality of the protrusions, and adjacent two of the protrusions are arranged in a spaced manner; and / or,
[0070] The plurality of the protrusions enclose a second groove on a side toward the proximal end operating portion, and the second groove is suitable for clamping the target substance enrichment layer.
[0071] 35. The detection system according to any one of embodiments 27-34, wherein the barrel comprises an outer barrel and an inner barrel, the outer barrel is sleeved on the inner barrel, a first waste liquid cavity is formed between the outer barrel and the inner barrel, a side of the inner barrel close to the collection portion outlet is arranged in a communicable manner with the first waste liquid cavity, an inner wall of the inner barrel is sealable matched with the distal end sealing portion, and the inner wall of the inner barrel is relatively movable with the push rod.
[0072] 36. The detection system according to embodiment 35, wherein,
[0073] The inner cylinder is threadedly connected, clamped, riveted, welded or bonded with the outer cylinder; and / or,
[0074] The first waste liquid cavity is provided with a first waste liquid detection device; and / or,
[0075] The first waste liquid cavity is provided with a first gas outlet, and a second waterproof and breathable layer is arranged at the first gas outlet; and / or,
[0076] The target substance enrichment layer is arranged in the inner cylinder and located at the communication position of the inner cylinder and the first waste liquid cavity or located at the side of the communication position of the inner cylinder and the first waste liquid cavity close to the push rod inlet; and / or,
[0077] The inner cylinder is provided with a flow channel at the side close to the outlet of the collection part, the inner cylinder is communicatively arranged with the first waste liquid cavity through the flow channel, the target substance enrichment layer is arranged in the inner cylinder and located at the flow channel or located at the side of the flow channel close to the push rod inlet; and / or,
[0078] The target substance enrichment layer is bonded, welded, connected through a plastic structure or connected through a sealing ring with the inner cylinder.
[0079] 37. The detection system according to any one of embodiments 35 or 36, wherein the inner cylinder is provided with a flow channel at the side close to the outlet of the collection part, the flow channel comprises a first flow channel, the first flow channel is arranged on the side wall of the inner cylinder and in the radial direction of the inner cylinder, and the first flow channel penetrates through the side wall of the inner cylinder; and / or,
[0080] The first waste liquid cavity is provided with a first waste liquid detection device, and the first waste liquid detection device comprises one or more of pH test paper, chromatography test paper and electrochemical detection device; and / or,
[0081] The first waste liquid cavity is provided with a first waste liquid detection device, and a first visual window is arranged on the outer cylinder, the first visual window is arranged to display the detection result of the first waste liquid detection device; and / or,
[0082] The first waste liquid cavity is provided with a waste liquid absorption material.
[0083] 38. The detection system according to any one of embodiments 35-37, wherein the inner cylinder is provided with a first flow channel at the side close to the outlet of the collection part, a first thread is arranged on the outer peripheral wall of the inner cylinder at the side close to the outlet of the collection part, a second thread is arranged on the inner peripheral wall of the outer cylinder close to the outlet of the collection part, the second thread is threadedly connected with the first thread, and a second flow channel is arranged on the first thread and / or the second thread, and the first flow channel is communicated with the first waste liquid cavity through the second flow channel.
[0084] 39. The detection system according to any one of embodiments 35-38, wherein the inner cylinder is provided with a first flow channel and a step portion on the side of the inner cylinder facing the outlet of the collection portion, the step portion is connected with the inner wall of the inner cylinder in the radial direction of the inner cylinder and extends into the inner cylinder, the step portion is provided on the side of the first flow channel close to the inlet of the push rod and is penetrable by the collection portion, and one of the following conditions is satisfied:
[0085] (1) the target substance enrichment layer is bonded to the step surface of the step portion;
[0086] (2) the target substance enrichment layer is fixed to the step surface of the step portion by a sealing ring;
[0087] (3) the target substance enrichment layer is fixed between the step portion and the first flow channel by a sealing ring, one side of the sealing ring along the thickness direction of the sealing ring abuts against the step surface of the step portion, the other side of the sealing ring abuts against the inner wall of the outer cylinder, the sealing ring is provided with a third flow channel penetrating through the radial side wall of the sealing ring, and the third flow channel is in communication with the first flow channel.
[0088] 40. The detection system according to any one of embodiments 35-39, wherein the target substance enrichment layer is fixed to the step surface of the step portion or between the step portion and the first flow channel by a sealing ring, and the sealing ring is a second elastic sealing ring.
[0089] 41. The detection system according to any one of embodiments 27-32, wherein the push rod is provided with a cavity, the cavity comprises a second waste liquid cavity extending along the length direction of the push rod and an open inner cavity, the open inner cavity is provided on the side of the second waste liquid cavity away from the proximal operation portion and is in communication with the second waste liquid cavity, the opening of the open inner cavity is provided on the side of the collection portion away from the proximal operation portion, and the target substance enrichment layer is provided on the push rod and located at the opening of the open inner cavity or is provided in the open inner cavity.
[0090] 42. The detection system according to embodiment 41, wherein a one-way valve is provided between the second waste liquid cavity and the open inner cavity, the one-way valve is adapted to open when the pressure of the open inner cavity is greater than the pressure of the second waste liquid cavity; and / or,
[0091] the push rod is further provided with a breakable portion, the breakable portion is provided on the outer wall of the open inner cavity and is located on the side of the target substance enrichment layer close to the proximal operation portion; the second waste liquid cavity is located on the side of the breakable portion close to the proximal operation portion; and / or,
[0092] the second waste liquid cavity is provided with a second waste liquid detection device; and / or,
[0093] The second waste liquid cavity is provided with a second gas outlet, and the second gas outlet is provided with a third waterproof and breathable layer; and / or,
[0094] The target substance enrichment layer is connected to the push rod by bonding, welding, a plastic structure, or a sealing ring.
[0095] 43. The detection system according to any one of embodiments 41 or 42, wherein the second waste liquid cavity is provided with a second waste liquid detection device, and the second waste liquid detection device comprises one or more of pH test paper, chromatography test paper, and an electrochemical detection device; and / or,
[0096] The second waste liquid cavity is provided with a second waste liquid detection device, and the push rod is provided with a second visual window configured to display the detection result of the second waste liquid detection device; and / or,
[0097] The second waste liquid cavity is provided with a waste liquid absorption material.
[0098] 44. The detection system according to any one of embodiments 27-43, wherein,
[0099] The push rod further comprises a deformable portion extending between the proximal end operation portion and the distal end sealing portion, and the outer peripheral wall of the deformable portion is provided with a third buckle protruding radially along the push rod;
[0100] The push rod inlet of the barrel is provided with a sliding groove, and the sliding groove comprises a circumferential rotation groove and an inclined groove, the circumferential rotation groove is recessed from the inner wall of the barrel in a direction away from the axis of the barrel, the inclined groove is connected to the circumferential rotation groove and is inclined inwardly toward the barrel and extends in the outlet direction of the collection portion, the circumferential rotation groove is provided with an inlet end in communication with the push rod inlet, and the circumferential rotation groove is configured to rotate with the circumferential rotation groove when the third buckle is inserted into the circumferential rotation groove by pushing the push rod; the inclined groove is configured to press the third buckle to push the third buckle and the push rod downward when the third buckle passes through the inclined groove.
[0101] 45. The detection system according to embodiment 44, wherein the deformable portion comprises a deformable beam extending along the length direction of the push rod, and the third buckle is arranged on the outer peripheral wall of the deformable beam; and / or,
[0102] The distance between the outer peripheral wall of the inlet end and the axis of the barrel is greater than or equal to the distance between the outer peripheral wall of the circumferential rotation groove and the axis of the barrel; and / or,
[0103] a distance from the axis of the barrel to a side of the bevel groove close to the entrance of the push rod gradually decreases in a direction away from the circumferential rotation groove; and / or,
[0104] a distance from the axis of the barrel to a side of the bevel groove close to the entrance of the push rod gradually decreases in a direction away from the circumferential rotation groove; and / or,
[0105] a distance from the axis of the barrel to a side of the bevel groove close to the entrance of the push rod gradually decreases in a direction away from the circumferential rotation groove; and / or,
[0106] the bevel groove is arranged on a side of the circumferential rotation groove extending along the inner wall of the barrel in a circumferential direction, or on a side of the circumferential rotation groove facing the inside of the barrel, or on a side of the circumferential rotation groove facing the inside of the barrel and close to the exit of the collection part and away from the circumferential rotation groove in a circumferential direction of the barrel; and / or,
[0107] the deformable part comprises one or more third clamps, and a plurality of the third clamps are arranged at intervals in a circumferential direction and / or a length direction of the push rod; and / or,
[0108] the third clamp is a deformable clamp.
[0109] 46. The detection system according to any one of embodiments 44 or 45, wherein the deformable part comprises a deformable beam and the third clamp:
[0110] a distance between an outer circumferential wall of the deformable beam and the axis of the push rod is less than or equal to a distance between an outer circumferential wall of the distal sealing part and the axis of the push rod, and a distance between an outer circumferential wall of the third clamp and the axis of the push rod is greater than the distance between the outer circumferential wall of the distal sealing part and the axis of the push rod; and / or,
[0111] the deformable beam comprises a cantilever beam, and the third clamp arranged on the cantilever beam is arranged at a free end of the cantilever beam; and / or,
[0112] the deformable beam comprises a double-end fixed beam, and the third clamp arranged on the double-end fixed beam is arranged between two ends of the double-end fixed beam; and / or,
[0113] the deformable beam comprises a double-end fixed beam, and a second fracture is arranged on a side of the double-end fixed beam close to the distal sealing part.
[0114] 47. The detection system according to any one of embodiments 44-46, wherein the deformable part comprises a plurality of deformable beams arranged at intervals in a circumferential direction of the push rod, and each of the deformable beams is independently provided with at least one third clamp.
[0115] 48. The detection system according to any one of embodiments 44-47, wherein the push rod comprises one or more layers of the third snap, and the third snaps in each layer are spaced apart along the length of the push rod, and the number of the third snaps in each layer is one or more, and the third snaps in the same layer are spaced apart along the circumference of the push rod, and the distance between the third snaps in the same layer and the distal sealing portion is equal along the length of the push rod.
[0116] 49. The detection system according to any one of embodiments 44-48, wherein the push rod comprises multiple layers of the third snap, and the number of the third snaps in each layer is multiple, and the number of the third snaps in different layers is the same, and the corresponding arc of the adjacent two third snaps in one layer is the same as the corresponding arc of the adjacent two third snaps in another layer.
[0117] 50. The detection system according to any one of embodiments 44-49, wherein the number of the third snaps in each layer is two; and / or,
[0118] the corresponding arc of the adjacent two third snaps in the same layer is 100-180°. BRIEF DESCRIPTION OF DRAWINGS
[0119] Figure 1 FIG. 1 is a schematic diagram of the structure of the detection device in the embodiment of the present application in the state of not being inserted into the heating assembly.
[0120] Figure 2 FIG. 2 is a schematic diagram of the structure of the detection device in the embodiment of the present application in the state of being inserted into the heating assembly.
[0121] Figure 3 FIG. 3 is a schematic diagram of the structure of the clamping mechanism in the detection device in the embodiment of the present application.
[0122] Figure 4 FIG. 4 is a schematic diagram of the structure of the detection device in the embodiment of the present application in the state of not being assembled.
[0123] Figure 5 FIG. 5 is a schematic diagram of the structure of the detection device in the embodiment of the present application in the state of being assembled.
[0124] Figure 6 FIG. 6 is a schematic diagram of the position structure of the heating assembly and the liquid containing tube in the detection device in the embodiment of the present application.
[0125] Figure 7 FIG. 7 is a left view of FIG. 6. Figure 6
[0126] Figure 8 Figure 2 is a cross-sectional view of the detection device of Figure 1 along the line A-A. Figure 7
[0127] Figure 9 Figure 4 is a schematic view of the liquid container and phase change material of the detection device of Figure 1.
[0128] Figure 10 Figure 5 is a schematic view of the detection device of Figure 1.
[0129] Figure 11 Figure 6 is a schematic view of the detection device of Figure 1. Figure 10
[0130] Figure 12 Figure 7 is a schematic view of the detection device of Figure 1.
[0131] Figure 13 Figure 8 is a cross-sectional view of the detection device of Figure 7 along the line B-B. Figure 12
[0132] Figure 9 is a schematic view of the sealing mechanism of the detection device of Figure 7. Figure 14
[0133] Figure 10 is a schematic view of the sealing mechanism of the detection device of Figure 7. Figure 15
[0134] Figure 11 is a schematic view of the detection device of Figure 7. Figure 16
[0135] Figure 12 is a schematic view of the detection device of Figure 7. Figure 17
[0136] Figure 13 is a cross-sectional view of the detection device of Figure 12 along the line C-C. Figure 18 Figure 17 Figure 14 is a schematic view of the detection device of Figure 12.
[0137] Figure 19 Figure 15 is a cross-sectional view of the detection device of Figure 14 along the line D-D.
[0138] Figure 20 Figure 19 Figure 16 is a schematic view of the detection mechanism of the detection device of Figure 14.
[0139] Figure 21 Figure 17 is a schematic view of the detection mechanism of the detection device of Figure 14.
[0140] Figure 22 Figure 18 is a schematic view of the detection mechanism of the detection device of Figure 14.
[0141] Figure 23 Structure diagram of a test paper detection module in a detection device according to an embodiment of the present application.
[0142] Figure 24 Structure diagram of an electrochemical detection module in a detection device according to an embodiment of the present application.
[0143] Figure 25 Structure diagram of an optical detection module in a detection device according to an embodiment of the present application.
[0144] Figure 26 Structure diagram of an optical detection assembly in a detection device according to an embodiment of the present application.
[0145] Figure 27 Structure diagram of a detection mechanism in a detection device according to an embodiment of the present application.
[0146] Figure 28 Structure diagram of a detection mechanism in a detection device according to another embodiment of the present application.
[0147] Figure 29 Structure diagram of a sample processing device according to an embodiment of the present application, wherein Figure 29 a is an assembly view of the sample processing device, and b is an exploded view of the sample processing device.
[0148] Figure 30 Structure diagram of a barrel according to an embodiment of the present application.
[0149] Figure 31 Structure diagram of an internal structure of a barrel according to an embodiment of the present application.
[0150] Figure 32 Structure diagram of an internal structure of a barrel according to another embodiment of the present application.
[0151] Figure 33 Structure diagram of a push rod according to an embodiment of the present application, wherein Figure 33 b is an enlarged view of a local area B in a.
[0152] Figure 34 Structure diagram of a barrel according to another embodiment of the present application, wherein Figure 34 a is an isometric view of the barrel, and b is an exploded view of a.
[0153] Figure 35 Structure diagram of an assembly of an inner barrel and an outer barrel or a local structure inside a barrel according to an embodiment of the present application.
[0154] Figure 36 Structure diagram of an assembly of an inner barrel and an outer barrel or a local structure inside a barrel according to another embodiment of the present application.
[0155] Figure 37 Figure 9 is a schematic view of the assembly of the inner cylinder and the outer cylinder or the partial structure in the cylinder according to another embodiment of the present application.
[0156] Figure 38 Figure 10 is a schematic view of the structure after rotating the inner cylinder and the outer cylinder according to another embodiment of the present application. Figure 37 Figure 11 is a schematic view of the structure after rotating the inner cylinder and the outer cylinder according to another embodiment of the present application.
[0157] Figure 39 Figure 12 is a schematic view of the movement and disassembly of the sample processing device according to another embodiment of the present application. Figure 39 Figure 13 is a schematic view of the movement and disassembly of the sample processing device according to another embodiment of the present application, wherein ① is a schematic view of adding a sample; ② is a schematic view of pushing down the push rod; ③ is a schematic view of pushing out the push rod from the cylinder; and ④ is a schematic view of breaking the push rod to obtain the collection part.
[0158] Figure 40 Figure 14 is a schematic view of the structure of the sample processing device according to another embodiment of the present application, wherein Figure 40 Figure 15 is a schematic view of the structure of the sample processing device according to another embodiment of the present application, wherein a is an assembly view of the sample processing device, and b is an exploded view of the sample processing device.
[0159] Figure 41 Figure 16 is a schematic view of the structure of the push rod according to another embodiment of the present application, wherein Figure 41 Figure 17 is a schematic view of the structure of the push rod according to another embodiment of the present application, wherein b is a sectional view of the direction D-D in a, c1 is an enlarged view of the local area E in b after the one-way valve is opened, and c2 is an enlarged view of the local area E in b when the one-way valve is not opened.
[0160] Figure 42 Figure 18 is a schematic view of the assembly structure of the push rod according to another embodiment of the present application, wherein Figure 42 Figure 19 is a schematic view of the assembly structure of the push rod according to another embodiment of the present application, wherein a is an isometric view of the push rod, and b is an exploded view of a.
[0161] Figure 43 Figure 20 is a schematic view of the movement and disassembly of the sample processing device according to another embodiment of the present application. Figure 43 Figure 21 is a schematic view of the movement and disassembly of the sample processing device according to another embodiment of the present application, wherein ① is a schematic view of adding a sample; ② is a schematic view of pushing down the push rod; ③ is a schematic view of pushing out the push rod from the cylinder; and ④ is a schematic view of breaking the push rod to obtain the collection part.
[0162] Figure 44 Figure 22 is a schematic view of the structure of the sample processing device according to another embodiment of the present application, wherein Figure 44 Figure 23 is a schematic view of the structure of the sample processing device according to another embodiment of the present application, wherein a is a schematic view of inserting the push rod into the cylinder, and b is a schematic view of the structure of the push rod not inserted into the cylinder.
[0163] Figure 45 Figure 24 is a schematic view of the structure of the cylinder and the chute according to another embodiment of the present application, wherein Figure 45 Figure 25 is a schematic view of the structure of the cylinder and the chute according to another embodiment of the present application, wherein a is a schematic view of the structure of the cylinder, and b is an enlarged view of the structure of the chute in the local area of the cylinder shown in a.
[0164] Figure 46 Structure diagram of the matching relationship between the push rod with buckle and the sliding groove in the liquid dispensing device in an embodiment of the present application. Figure 46 Structure diagram of the push rod inserted into the cylinder in b, and the enlarged view of the local area G in b.
[0165] Figure 47 Structure diagram of the push rod in an embodiment of the present application.
[0166] Figure 48 Structure diagram of the push rod in an embodiment of the present application. Figure 32 Structure diagram of the push rod rotated 90° clockwise along the push rod axis.
[0167] Figure 49 Structure diagram of the push rod in another embodiment of the present application.
[0168] Figure 50 Structure diagram of the push rod in another embodiment of the present application, Figure 50 Structure diagrams of the push rod in three different perspectives in a, b and c, respectively, in which b is a diagram of a rotated 90° clockwise along the black arrow direction in a, and c is a side view of a.
[0169] Figure 51 Structure diagram of the push rod in another embodiment of the present application, Figure 51 Structure diagrams of the push rod in three different perspectives in a, b and c, respectively, in which b is a diagram of a rotated 90° clockwise along the black arrow direction in a, and c is a side view of a.
[0170] Figure 52 Structure diagram of the push rod provided with a second fracture in an embodiment of the present application.
[0171] Figure 53 Structure diagram of the push rod in an embodiment of the present application, in which the deformable beam at the second fracture is irreversibly deformed after use.
[0172] Figure 54 Step-by-step motion disassembly diagram of the push rod with two layers of buckles and the cylinder in cooperation in an embodiment of the present application, in which the black arrow represents the movement mode of the push rod.
[0173] Figure 55 Detection results of the nucleic acid chromatography test paper in the experimental example.
[0174] Explanation of reference signs:
[0175] 10 - clamping mechanism; 11 - heating chamber; 111 - top; 112 - first side wall; 101 - first mounting port; 102 - second mounting port; 12 - heating assembly; 113 - second side wall; 114 - third side wall; 13 - first groove; 103 - through slot; 14 - observation port; 15 - first flange; 20 - sealing mechanism; 21 - liquid containing tube; 201 - through hole; 211 - phase change material; 22 - limiting block; 221 - first limiting block; 222 - second limiting block; 223 - supporting mechanism; 23 - guide column; 24 - elastic supporting assembly; 25 - first elastic sealing ring; 26 - buckle; 261 - first buckle; 262 - second buckle; 27 - supporting assembly; 28 - first sealing part; 29 - second sealing part; 291 - observation window; 30 - cutting mechanism; 40 - detection mechanism; 401 - sample inlet; 41 - extrusion assembly; 43 - test paper detection module; 431 - paper strip fixing device; 432 - test paper strip; 433 - sample pad; 44 - electrochemical detection module; 441 - electrochemical detection device housing; 442 - electrochemical detection circuit; 45 - optical detection module; 451 - optical detection module fixing device; 452 - optical detection assembly; 453 - liquid sampling groove; 454 - optical detection device inlet; 50 - push rod; 511 - collection part; 511a - peeling part; 511a1 - protrusion; 511a2 - second groove; 512 - distal end sealing part; 513 - proximal end operating part; 513a - pressing part; 514 - breakable part; 514a - first breakage; 515 - cavity; 515a - open inner cavity; 515b - second waste liquid cavity; 515c - one-way valve; 515d - second waste liquid detection device; 516 - second visual window; 517 - second gas outlet; 518 - deformable part; 518a - third buckle; 518b - deformable beam; 518c - second breakage; 60 - barrel; 60a - outer barrel; 60b - inner barrel; 60c - first waste liquid cavity; 60d - first waste liquid detection device; 60e - first visual window; 620f - sliding groove; 620f1 - circumferential rotation groove; 620f2 - inclined groove; 620f3 - inlet end; 621 - push rod inlet; 622 - collection part outlet; 623 - sealing layer; 624 - flow channel; 624a - first flow channel; 624b - second flow channel; 624c - third flow channel; 625a - second thread; 625b - first thread; 626 - step part; 627 - sealing ring; 627a - first sealing ring; 627b - second sealing ring; 627b1 - second flange; 627c - third sealing ring; 628 - second step part; 629 - third step part; 70 - target substance enrichment layer. DETAILED DESCRIPTION
[0176] The application will be further described below in conjunction with specific embodiments. It should be understood that these specific embodiments are only used to illustrate the application and not to limit the scope of the application.
[0177] In this application, the following definitions and methods are provided to better define the application and to guide those of ordinary skill in the art in the practice of the application. Unless otherwise defined, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
[0178] As used herein, the term "comprising" is to be interpreted as inclusive or open-ended, and not exclusive. Specifically, when used in the specification and in the claims, the term "comprising" and variations thereof mean "including but not limited to", and are not intended to exclude other features, steps or components.
[0179] In this application, the terms "first", "second", "third", "fourth" are used only for descriptive purposes and are not to be construed as indicating or implying relative importance or a specific order of importance of the indicated features. Thus, features defined with "first", "second", "third", "fourth" can include at least one of the features explicitly or implicitly. In the description of the application, the meaning of "a plurality" is at least two, for example two, three, etc., unless otherwise explicitly and specifically limited.
[0180] In a first aspect of the application, a detection device is provided, referring to Figure 1-28 It is understood that the detection device comprises a clamping mechanism 10, a sealing mechanism 20, a cutting mechanism 30 and a detection mechanism 40.
[0181] Referring to Figure 1-3 , the clamping mechanism 10 is provided with a heating cavity 11, the top 111 of the heating cavity 11 is provided with a first mounting port 101, and the heating cavity 11 is provided with a heating assembly 12.
[0182] It should be noted that the "heating assembly 12" of the present application can be fixed in the heating cavity 11 or detachably arranged in the heating cavity 11. When the heating assembly 12 is fixed in the heating cavity 11, as long as the structure of the heating assembly 12 does not affect the pressing process of the clamping mechanism 10, for example, the heating assembly 12 can be a heating wire or a heating sheet. When the heating assembly 12 is detachably arranged in the heating cavity 11, in an embodiment of the present application, referring to Figure 1-2 , the first side wall 112 of the heating cavity 11 is provided with a second mounting port 102, for example, the second mounting port 102 can cover part or all of the first side wall 112. The heating assembly 12 is detachably arranged in the second mounting port 102, for example, the heating assembly 12 can be a U-shaped heating assembly, etc.
[0183] Referring to Figure 1-2, 4-5 and 8, the sealing mechanism 20 is located below the clamping mechanism 10, the sealing mechanism 20 comprises a through hole 201, the through hole 201 penetrates the sealing mechanism 20 along the first direction, the through hole 201 cooperates with the first mounting port 101 to accommodate the liquid containing tube 21, and the inner wall of the liquid containing tube 21 close to the tube port is provided with phase change material 211.
[0184] In some embodiments of the present application, the heating assembly 12 is arranged to heat the phase change material 211 in the liquid containing tube 21 when extending into the second mounting port 102. As an example, reference is made to Figure 6-7 , the heating assembly 12 is in a U-shaped structure, the liquid containing tube 21 is arranged between the U-shaped heating arms of the heating assembly 12, and the heating arms are arranged in the upper half of the height of the liquid containing tube 21 and are attached to the tube wall, and the lower half of the height of the liquid containing tube 21 can not be contacted or surrounded by the heating arms. When the heating assembly 12 is not turned on (reference is made to Figure 8 a), the phase change material 211 in the liquid containing tube 21 is located on the inner wall close to the tube port of the liquid containing tube 21, and when the heating assembly 12 is turned on (reference is made to Figure 8 b), the heating assembly 12 preferentially heats the phase change material 211 on the side wall of the tube port of the liquid containing tube 21, so that it changes from solid to liquid and gradually covers the liquid surface in the liquid containing tube 21, and when the cover is not completely formed, the liquid temperature in the liquid containing tube 21 is lower than the set reaction temperature, and the liquid surface is extremely slightly evaporated; when the phase change material 211 completely melts and covers the liquid surface in the liquid containing tube 21 (reference is made to Figure 8 c), the liquid in the liquid containing tube 21 is isolated from the outside world, at this time, there is no evaporation phenomenon of the liquid in the liquid containing tube 21, thereby effectively ensuring that the liquid amount and composition in the liquid containing tube 21 are not affected by the outside world. Subsequently, the heat required in the reaction process in the liquid containing tube 21 is transmitted to the liquid in the liquid containing tube 21 by the completely melted phase change material 211, so as to promote the occurrence of the reaction, such as nucleic acid amplification or related biochemical reaction. After the reaction is completed, the heating assembly 12 is removed, the melted phase change material 211 gradually solidifies to restore the solid state as the temperature of the liquid containing tube 21 decreases, but still adheres to the liquid surface in the liquid containing tube 21 to form a tight sealing layer, thereby continuously preventing the liquid in the liquid containing tube 21 from evaporating or external gas from entering.
[0185] In some embodiments of the present application, the shapes of the liquid containing tube 21 and the phase change material 211 are not particularly limited, as an example, reference is made to Figure 9 , the liquid containing tube 21 can be a sharp bottom (reference is made to Figure 9 a, b, c and d) or a round bottom (reference is made to Figure 9 e, f, g and h), and the structure of the phase change material 211 in the inner wall of the liquid containing tube 21 can be annular (reference is made to Figure 9 a, b, e and f) or droplet-shaped (reference is made to Figure 9 c, d, g and h).
[0186] In some embodiments of the present application, the phase change material 211 has a melting point of 40-120°C, such as 40°C, 50°C, 60°C, 70°C, 80°C, 90°C, 100°C, 110°C, 120°C, or a range defined by any two of the above values. As an example, the phase change material 211 includes paraffin, beeswax, microcrystalline wax, or polyethylene glycol.
[0187] In some embodiments of the present application, with reference to Figure 3-5 , the clamping mechanism 10 can further include a viewing port 14, i.e., to observe whether the liquid in the liquid container 21 is at the bottom of the liquid container 21 and whether there are air bubbles in the liquid container 21 before the heating assembly 12 heats the liquid container 21.
[0188] In some embodiments of the present application, the top 111 of the heating cavity 11 can be provided with a first mounting port 101 (with reference to Figure 10-11 ) or a plurality of first mounting ports 101, which can be selected by those skilled in the art according to actual needs. For example, with reference to Figure 3 , the top 111 of the heating cavity 11 is provided with two first mounting ports 101, such as one of which can be placed in the liquid container 21 containing the reaction liquid, the other of which can be placed in the liquid container 21 containing the dilution liquid, or both of which can be placed in the liquid container 21 containing the reaction liquid.
[0189] In some embodiments of the present application, with reference to Figure 1-5 and 10-11, the side wall of the heating cavity 11 is further provided with a through slot 103 extending in the first direction, the sealing mechanism 20 is provided with a guide column 23 extending in the first direction, and the through slot 103 and the guide column 23 are correspondingly arranged and adapted to be embedded in the through slot 103 when the clamping mechanism 10 is pressed in the first direction. Thus, the stability of the clamping mechanism 10 during the pressing process in the first direction can be improved.
[0190] In some embodiments of the present application, with reference to Figure 1 and 4 , the guide column 23 is arranged on the sealing mechanism 20 away from the second mounting port 102.
[0191] With reference to Figure 12-13 , the cutting mechanism 30 is located in the through hole 201, and the cutting mechanism 30 is arranged to be in contact with and cut the liquid container 21 when the clamping mechanism 10 is pressed in the first direction. In some embodiments of the present application, when the heating assembly 12 is detachably arranged at the second mounting port 102, the cutting mechanism 30 is arranged to be in contact with and cut the liquid container 21 when the clamping mechanism 10 is pressed in the first direction after the heating assembly 12 is removed.
[0192] In some embodiments of this application, the material forming the through hole 201 can be a deformable material. After the heating component 12 is used to heat the liquid-containing tube 21 and then the heating component 12 is removed, the clamping mechanism 10 is pressed down in the first direction. The lower end of the liquid-containing tube 21 abuts against the through hole 201 until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, since the liquid-containing tube 21 abuts against the through hole 201, the lower end area of the liquid-containing tube 21 can be sealed to prevent the liquid in the liquid-containing tube 21 from evaporating or being contaminated.
[0193] It should be noted that when the material forming the through hole 201 is a deformable material, those skilled in the art can select the deformable material according to actual needs, such as rubber.
[0194] In some other embodiments of this application, reference is made to Figure 14 The upper end of the through hole 201 of the sealing mechanism 20 is provided with an elastic support component 24. The elastic support component 24 is configured to support and seal the lower end of the liquid-containing tube 21 when the first mounting port 101 cooperates with the through hole 201 to accommodate the liquid-containing tube 21. As an example, after heating the liquid-containing tube 21 with the heating component 12 and then removing the heating component 12, when the clamping mechanism 10 is pressed down in the first direction, the lower end of the liquid-containing tube 21 abuts against the elastic support component 24 until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, since the liquid-containing tube 21 abuts against the elastic support component 24, it can support and seal the lower end area of the liquid-containing tube 21, preventing the liquid in the liquid-containing tube 21 from evaporating or being contaminated.
[0195] It should be noted that those skilled in the art can select the material and shape of the elastic support component 24 according to actual needs. For example, the material can be rubber, and the shape can be ring-shaped.
[0196] In some embodiments of this application, reference is made to Figure 15 A first elastic sealing ring 25 can be provided at the upper end of the through hole 201. A support component 27 is provided on the first elastic sealing ring 25. The orthographic projection of the opening on the first elastic sealing ring 25 in the plane perpendicular to the height of the liquid-holding tube 21 is located inside the orthographic projection of the opening on the support component 27 in the plane perpendicular to the height of the liquid-holding tube 21. The orthographic projection area of the opening on the first elastic sealing ring 25 in the plane perpendicular to the height of the liquid-holding tube 21 is smaller than the orthographic projection area of the opening on the support component 27 in the plane perpendicular to the height of the liquid-holding tube 21. That is, after the heating component 12 is used to heat the liquid-holding tube 21 and then the heating component 12 is removed, and the clamping mechanism 10 is pressed down in the first direction, the lower end of the liquid-holding tube 21 abuts against the first elastic sealing ring 25 until the lower end of the liquid-holding tube 21 contacts the cutting mechanism 30. At this time, due to the action of the first elastic sealing ring 25, the lower end area of the liquid-holding tube 21 can be sealed to prevent the liquid in the liquid-holding tube 21 from evaporating or being contaminated.
[0197] It should be noted that the material of the first elastic sealing ring 25 can be selected by those skilled in the art according to actual needs, for example, rubber, etc., and the shape of the first elastic sealing ring 25 can also be selected according to actual needs. Meanwhile, the structure of the cutting mechanism 30 in the present application is not particularly limited, as long as it can cut the liquid containing tube 21 when the clamping mechanism 10 is pressed in the first direction. Those skilled in the art can select the specific structure of the cutting mechanism 30 according to actual needs, for example, a blade, a plastic sheet, a glass sheet, etc.
[0198] In some embodiments of the present application, with reference to Figure 1-5 The heating cavity 11 further comprises a second side wall 113 and a third side wall 114 arranged oppositely, and the second side wall 113 and / or the third side wall 114 is / are provided with a first groove 13 penetrating at least part of the second side wall 113 and / or the third side wall 114 in the first direction from the side of the clamping mechanism 10 close to the sealing mechanism 20. As an example, the second side wall 113 and the third side wall 114 of the heating cavity 11 are both provided with the first groove 13.
[0199] In some embodiments of the present application, with reference to Figure 1-2 As an example, the second side wall 113 and the third side wall 114 of the heating cavity 11 are both provided with the first groove 13, and the sealing mechanism 20 is further provided with a limiting block 22 arranged at a position corresponding to the first groove 13 on the second side wall 113 and / or the third side wall 114. When the clamping mechanism 10 is pressed in the first direction, the limiting block 22 is embedded in the first groove 13, that is, the clamping mechanism 10 is pressed in the first direction under the cooperation of the first groove 13 on it and the limiting block 22 on the sealing mechanism 20.
[0200] As an example, the second side wall 113 and the third side wall 114 of the heating cavity 11 are both provided with the first groove 13, and the sealing mechanism 20 is further provided with a limiting block 22 arranged at a position corresponding to the first groove 13 on the second side wall 113 and / or the third side wall 114. When the clamping mechanism 10 is pressed in the first direction, the limiting block 22 is embedded in the first groove 13, that is, the clamping mechanism 10 is pressed in the first direction under the cooperation of the first groove 13 on it and the limiting block 22 on the sealing mechanism 20.
[0201] It should be noted that the first recess 13 can be arranged on the second side wall 113 and / or the third side wall 114 of the heating cavity 11, and the limiting block 22 is arranged on the sealing mechanism 20, that is, when the clamping mechanism 10 is pressed downward in the first direction, the clamping mechanism 10 is pressed downward in the first direction under the cooperation of the first recess 13 thereon and the limiting block 22 on the sealing mechanism 20; or a through groove 103 penetrating in the first direction is arranged on the side wall of the heating cavity 11, and the guide column 23 is arranged on the sealing mechanism 20, that is, when the clamping mechanism 10 is pressed downward in the first direction, the clamping mechanism 10 is pressed downward in the first direction under the cooperation of the through groove 103 thereon and the guide column 23 on the sealing mechanism 20; or the first recess 13 is arranged on the second side wall 113 and / or the third side wall 114 of the heating cavity 11, and the limiting block 22 is arranged on the sealing mechanism 20, and at the same time, the through groove 103 penetrating in the first direction is arranged on the side wall of the heating cavity 11, and the guide column 23 is arranged on the sealing mechanism 20, that is, when the clamping mechanism 10 is pressed downward in the first direction, the clamping mechanism 10 is pressed downward in the first direction under the cooperation of the first recess 13 thereon and the limiting block 22 on the sealing mechanism 20 and the cooperation of the through groove 103 thereon and the guide column 23 on the sealing mechanism 20. It should be noted that the number, combination form and position of the limiting block 22 and the guide column 23 can be increased or reduced according to actual needs by those skilled in the art.
[0202] In some embodiments of the present application, with reference to Figure 4-5 and 10-13, the side wall of the sealing mechanism 20 is further provided with buckles 26 spaced in the first direction, and the bottom of the side wall of the clamping mechanism 10 forms a first flange 15 towards the inside of the clamping mechanism 10, and the buckles 26 are arranged to cooperate with the first flange 15 to limit the upward movement of the clamping mechanism 10 when the clamping mechanism 10 is pressed downward in the first direction. As an example, with reference to Figure 12-13 and 17-18, the buckles 26 include first buckles 261 and second buckles 262, and the first buckles 261 are located above the second buckles 262, with reference to Figure 18 , the first buckles 261 are arranged to cooperate with the first flange 15 to limit the upward movement of the clamping mechanism 10 when the clamping mechanism 10 is pressed downward in the first direction to the bottom of the liquid container 21 being in contact with the cutting mechanism 30; with reference to Figure 19-20 , the second buckles 262 are arranged to cooperate with the first flange 15 to limit the upward movement of the clamping mechanism 10 after the clamping mechanism 10 is pressed downward in the first direction to the bottom of the liquid container 21 being cut by the cutting mechanism 30.
[0203] In some embodiments of the present application, the side wall of the sealing mechanism 20 is provided with a plurality of first buckles 261 and / or a plurality of second buckles 262. For example, the side wall of the sealing mechanism 20 provided with the limiting block 22 is provided with two first buckles 261 and two second buckles 262. The two first buckles 261 on the same side wall of the sealing mechanism 20 are arranged on both sides of the limiting block 22, and the two second buckles 262 on the same side wall of the sealing mechanism 20 are arranged on both sides of the limiting block 22. Preferably, the two opposite side walls of the sealing mechanism 20 are provided with a plurality of first buckles 261 and a plurality of second buckles 262. Thus, the plurality of first buckles 261 and / or the plurality of second buckles 262 are arranged to limit the upward movement of the clamping mechanism 10, to seal the bottom end of the liquid containing tube 21, and to reduce the possibility of pollution caused by the failure of the sealing mechanism 21 due to the misuse of the user. It should be noted that the first buckle 261 is arranged to prevent misuse by the user. Under the premise of correct operation of the user, the arrangement of the first buckle 261 does not affect the detection result and the sealing effect.
[0204] In some embodiments of the present application, with reference to Figure 1 、 2 and 16, the limiting block 22 comprises a first limiting block 221 and a second limiting block 222 arranged at intervals along the first direction. The first limiting block 221 is arranged above the second limiting block 222. The first limiting block 221 is arranged to be embedded in the first groove 13 when the clamping mechanism 10 is not pressed downward. With reference to Figure 16 , the second limiting block 222 is arranged to be embedded in the first groove 13 together with the first limiting block 221 when the clamping mechanism 10 is pressed downward along the first direction.
[0205] In some embodiments of the present application, with reference to Figure 1-2 , the sealing mechanism 20 further comprises a supporting mechanism 223. The supporting mechanism 223 is detachably arranged between the first limiting block 221 and the second limiting block 222. The supporting mechanism 223 is arranged to support the lower end of the clamping mechanism 10 when the clamping mechanism 10 is not pressed downward. Specifically, the supporting mechanism 223 can be detached when the clamping mechanism 10 needs to be pressed downward along the first direction.
[0206] With reference to Figure 4 、 13, 18 and 20, the detection mechanism 40 is located on the side of the cutting mechanism 30 away from the clamping mechanism 10 and is sealingly connected to the sealing mechanism 20, that is, the cutting mechanism 30 contacts and cuts the liquid containing tube 21 at the lower end of the liquid containing tube 21 in the through hole 201 of the sealing mechanism 20, the reaction solution automatically flows into the detection mechanism 40 located below the sealing mechanism 20, and subsequent analysis and detection are completed. As an example, the sealing connection between the detection mechanism 40 and the sealing mechanism 20 can be achieved by filling glue, a sealing ring or using ultrasonic welding between the two, thereby achieving sealing of the detection mechanism 40, avoiding sample evaporation or contamination during detection in the detection mechanism 40, and improving the stability and accuracy of the detection results.
[0207] In some embodiments of the present application, with reference to Figure 21 , the detection mechanism 40 is provided with a pressing assembly 41, which is arranged to press down the clamping mechanism 10 to the bottom of the liquid containing tube 21 after the cutting mechanism 30 cuts the liquid containing tube 21, and to press the deformed liquid containing tube 21 to discharge the liquid.
[0208] In some embodiments of the present application, the pressing assembly 41 is arranged directly below the cutting mechanism 30. As an example, with reference to Figure 21 , the pressing assembly 41 is a protrusion, which continues to press down the clamping mechanism 10 after the cutting mechanism 30 completes the cutting of the bottom of the liquid containing tube 21, so that the cut part of the bottom of the liquid containing tube 21 presses the liquid containing tube 21 under the action of the protrusion, thereby deforming the liquid containing tube 21 to discharge the liquid.
[0209] In some embodiments of the present application, with reference to Figure 22 , the sealing mechanism 20 includes a first sealing portion 28 and a second sealing portion 29, the through hole 201 is arranged on the first sealing portion 28, and the second sealing portion 29 is connected to the end of the first sealing portion 28 away from the second mounting port 102, and the detection mechanism 40 extends from the first sealing portion 28 to the second sealing portion 29.
[0210] In some embodiments of the present application, with reference to Figure 22 , the second sealing portion 29 is further provided with an observation window 291, which is arranged to observe the detection results on the detection mechanism 40 after the liquid containing tube 21 is pressed to deform and discharge the liquid.
[0211] In some embodiments of the present application, with reference to Figure 22 , the guide column 23 is arranged on the first sealing portion 28 near the second sealing portion 29.
[0212] In some embodiments of the present application, with reference to Figure 23-26 , the detection mechanism 40 can include one or more of a test paper detection module 43, an electrochemical detection module 44 and an optical detection module 45.
[0213] Referring to Figure 23 , the test paper detection module 43 includes a test paper strip fixing device 431 and a test paper strip 432, the test paper strip 432 is arranged in the test paper strip fixing device 431, and the squeezing assembly 41 is arranged in the test paper strip fixing device 431. For example, when the test paper strip 432 adopts a chromatographic test paper strip, two first installation openings 101 can be arranged on the clamping mechanism 10, one of which is used to place the liquid containing tube 21 containing the reaction liquid, and the other is used to place the liquid containing tube 21 containing the diluent. The sample pad 433 on the chromatographic test paper strip is located directly below the cutting mechanism 30. The side of the test paper strip fixing device 431 close to the sample pad 433 is provided with the squeezing assembly 41. After the liquid containing tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is continuously pressed down, and the squeezing assembly 41 squeezes the liquid out of the liquid containing tube 21. When the reaction liquid and the diluent in the liquid containing tube 21 flow through the sample pad 433, the reaction liquid and the diluent will flow along the test paper strip 432, and the result will be displayed on the display area of the test paper strip 432.
[0214] Referring to Figure 24 , the electrochemical detection module 44 includes an electrochemical detection device housing 441 and an electrochemical detection circuit 442, wherein the electrochemical detection circuit 442 is sealed in the electrochemical detection device housing 441, and the electrochemical detection device housing 441 is provided with a sample inlet 401, which is arranged directly below the cutting mechanism 30. The sample inlet 401 of the electrochemical detection device housing 441 is provided with the squeezing assembly 41. After the liquid containing tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is continuously pressed down, and the squeezing assembly 41 squeezes the liquid out of the liquid containing tube 21. After the reaction liquid in the liquid containing tube 21 flows out and enters the sample inlet 401, it directly contacts the electrode on the electrochemical detection circuit 442 for detection.
[0215] Referring to Figure 25-26 , the optical detection module 45 includes an optical detection module fixing device 451 and an optical detection assembly 452, the optical detection assembly 452 is sealed in the optical detection module fixing device 451, and the optical detection module fixing device 451 is provided with a sample inlet 401, which is arranged directly below the cutting mechanism 30. The sample inlet 401 of the optical detection module fixing device 451 is provided with the squeezing assembly 41. After the liquid containing tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is continuously pressed down, and the squeezing assembly 41 squeezes the liquid out of the liquid containing tube 21. After the reaction liquid flows out and enters the liquid sampling groove 453 of the optical detection assembly 452 through the sample inlet 401, it is used for optical sampling. The liquid sampling groove 453 is provided with optical detection device inlets 454 on both sides to provide detection space for optical detection equipment.
[0216] In some embodiments of the present application, two or three of the paper detection module 43, the electrochemical detection module 44 and the optical detection module 45 can be included in the detection mechanism 40, and the two or three detection modules are arranged in a stack.
[0217] For example, referring to Figure 27 The test paper strip 432 in the paper detection module 43 can be stacked above the electrochemical detection module 44. Taking a chromatographic test paper strip as an example, the test paper strip 432 is placed above the electrochemical detection device housing 441, and the electrochemical detection circuit 442 is sealed in the electrochemical detection device housing 441. After the liquid container 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is continuously pressed down, and the squeezing assembly 41 squeezes the liquid out of the liquid container 21. When the reaction liquid in the liquid container 21 flows through the sample pad 433, part of the reaction liquid will flow along the test paper strip 432, and the result will be displayed on the display area of the test paper strip 432. At the same time, another part of the reaction liquid in the sample pad 433 will seep into the sample inlet 401 of the electrochemical detection module 44 below and contact the electrode on the electrochemical detection circuit 442 for detection, that is, the test paper detection and electrochemical detection of the reaction liquid are realized at the same time.
[0218] For example, referring to Figure 28 The test paper strip 432 in the paper detection module 43 can be stacked above the optical detection module 45. Taking a chromatographic test paper strip as an example, the test paper strip 432 is placed above the optical detection module fixing device 451, and the optical detection assembly 452 is sealed in the optical detection module fixing device 451. The optical detection module fixing device 451 is provided with a sample inlet 401. After the liquid container 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is continuously pressed down, and the squeezing assembly 41 squeezes the liquid out of the liquid container 21. When the reaction liquid in the liquid container 21 flows through the sample pad 433, part of the reaction liquid will flow along the test paper strip 432, and the result will be displayed on the display area of the test paper strip 432. At the same time, another part of the reaction liquid in the sample pad 433 will seep into the sample inlet 401 of the optical detection module 45 below and enter the liquid sampling groove 453 of the optical detection assembly 452 for optical sampling, that is, the test paper detection and optical detection of the reaction liquid are realized at the same time.
[0219] The detection device of this application has at least the following technical effects: The liquid-containing tube 21 is accommodated by the first mounting port 101 on the clamping mechanism 10 cooperating with the through hole 201 on the sealing mechanism 20. A phase change material 211 is provided on the inner wall of the liquid-containing tube 21 near the port. When the heating assembly 12 is inserted into the second mounting port 102 to heat the liquid-containing tube 21 in the heating chamber 11, the phase change material 211 at the port of the liquid-containing tube 21 melts and covers the liquid surface inside the liquid-containing tube 21, isolating the liquid surface from the outside environment, minimizing the evaporation of the liquid inside the liquid-containing tube 21, and ensuring that the reaction components are not disturbed. After the reaction in the liquid-containing tube 21 is completed, the heating assembly 12 is removed. After the phase change material 211 on the surface of the reaction liquid in the liquid-containing tube 21 re-solidifies, a sealing layer is formed on the liquid surface inside the liquid-containing tube 21. This sealing layer can support the wall of the liquid-containing tube 21, thereby effectively reducing the sealing failure caused by the deformation of the liquid-containing tube 21 wall. Furthermore, during the pressing down of the clamping mechanism 10, the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30 located in the through hole 201 of the sealing mechanism 20, cutting the liquid-containing tube 21. As the clamping mechanism 10 continues to be pressed down in the first direction, the liquid in the liquid-containing tube 21 automatically flows into the detection mechanism 40 located below the sealing mechanism 20 under the action of the squeezing component 41 on the detection mechanism 40. Subsequent analysis and detection are completed in a completely sealed environment. On the one hand, this can reduce the risk of liquid evaporation, reagent volatilization, or external contamination and cross-reaction that may be caused by transferring the liquid-containing tube 21 during the detection process, thereby improving the stability and accuracy of the detection results. On the other hand, the detection device of this application can eliminate the step of transferring the reaction liquid, improving the ease of operation and the high-throughput application of detection.
[0220] For ease of understanding, the operation process of the detection device of this application is described below:
[0221] In one embodiment of this application, the detection mechanism 40 employs a test strip detection module 43. The test strip in this module 43 is a chromatography test strip card. A phase change material 211 is provided on the wall of the liquid-containing tube 21 near the opening, and an isothermal nucleic acid amplification reaction occurs within the liquid-containing tube 21. First, a clamping mechanism 10 with two first mounting ports 101 is used. One first mounting port 101 is used to place the liquid-containing tube 21 containing the reaction solution, and the other first mounting port 101 is used to place the liquid-containing tube 21 containing the diluent. The reaction solution and diluent are added to the different liquid-containing tubes 21 respectively. Then, the heating assembly 12 is... Figure 1-2The heating assembly 12 is inserted into the second mounting port 102 of the clamping mechanism 10, with its heating arm only surrounding the upper half of the liquid-filled tube 21, i.e., the area corresponding to the phase change material 211 on the liquid-filled tube 21. When the heating assembly 12 is turned on, the phase change material 211 will melt before the reaction liquid reaches the target reaction temperature, completely covering the surface of the reaction liquid. Heat will then be transferred to the reaction liquid through the molten phase change material 211, causing the reaction liquid to reach the required temperature and react. After the reaction is complete, the heating assembly 12 is removed from the second mounting port 102. Once the phase change material 211 solidifies again, the clamping mechanism 10 is pressed down along the first direction until it contacts the lower end of the liquid collection tube 21 and the cutting mechanism 30. At this time, the liquid collection tube 21 will be cut by the cutting mechanism 30. The clamping mechanism 10 is pressed down further, and the bottom of the liquid collection tube 21 is squeezed by the squeezing component 41 to deform, forcing the reaction liquid and diluent to flow out from the liquid collection tube 21 to the sample pad 433 surface of the chromatography test strip. The reaction liquid and diluent will flow along the test strip 432, and the result will be displayed on the display area of the test strip 432. The result can be read from the observation window 291 of the detection mechanism 40.
[0222] In another embodiment of this application, a nucleic acid amplification reaction occurs within the liquid collection tube 21, and the detection mechanism 40 employs an optical detection module 45 to read the detection results using fluorescence. First, the reaction system containing fluorescently labeled probes is added to the liquid collection tube 21. Then, the liquid collection tube 21 is placed into the first mounting port 101 on the top 111 of the clamping mechanism 10, and subsequently... Figure 1-2 As shown, the heating component 12 is inserted into the second mounting port 102 of the clamping mechanism 10, with the heating arm of the heating component 12 only surrounding the upper half of the liquid-containing tube 21, i.e., the area corresponding to the phase change material 211 on the liquid-containing tube 21. The heating component 12 is turned on. Before the reaction liquid reaches the target reaction temperature, the phase change material 211 will be heated and melted first, completely covering the surface of the reaction liquid, thereby maintaining the sealed state of the liquid in the liquid-containing tube 21 and inhibiting the evaporation of the reaction liquid, so that the nucleic acid amplification reaction can proceed stably and efficiently. After the reaction is completed, the heating component 12 is removed from the second mounting port 102. After the phase change material 211 solidifies again, the clamping mechanism 10 is pressed down along the first direction until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, the liquid-containing tube 21 will be cut by the cutting mechanism 30. The clamping mechanism 10 is pressed down further, and the bottom of the liquid-containing tube 21 is squeezed by the squeezing component 41 to deform, so that the reaction liquid enters the liquid sampling tank 453 in the optical detection module 45 for optical detection. After the reaction solution enters the liquid sampling tank 453, it is irradiated by light through the inlet 454 of the optical detection device. The optical detection component 452 excites, collects, and analyzes the fluorescence signal, and the final fluorescence detection result is read by an external device.
[0223] In another embodiment of this application, an ELISA reaction occurs within the liquid collection tube 21, and the detection mechanism 40 employs an electrochemical detection module 44. First, a system containing enzyme-labeled antibodies and substrates, and other reaction reagents, is added to the liquid collection tube 21. Then, the liquid collection tube 21 is placed into the first mounting port 101 on the top 111 of the clamping mechanism 10, and the heating assembly 12 is then positioned accordingly. Figure 1-2 The heating component 12 is inserted into the second mounting port 102 of the clamping mechanism 10, and surrounds only the upper half of the liquid-containing tube 21, i.e., the area corresponding to the phase change material 211 on the liquid-containing tube 21. When the heating component 12 is turned on, the phase change material 211 will melt first and completely cover the surface of the reaction liquid before the reaction liquid reaches the target reaction temperature. At this time, the phase change material 211 will efficiently and evenly transfer heat to the reaction liquid, ensuring that the ELISA enzymatic reaction proceeds stably under precise and constant temperature control. After the reaction is completed, the heating component 12 is removed from the second mounting port 102. After the phase change material 211 solidifies again, the clamping mechanism 10 is pressed down completely along the first direction until the lower end of the liquid-containing tube 21 contacts the cutting mechanism 30. At this time, the liquid-containing tube 21 will be cut by the cutting mechanism 30. The clamping mechanism 10 is pressed down further, and the bottom of the liquid-containing tube 21 is squeezed by the squeezing component 41 to deform, causing the reaction liquid to flow out and enter the electrochemical detection module 44, directly contacting the electrode on the electrochemical detection circuit 442. The product generated by the enzyme labeling reaction undergoes a corresponding electrochemical response on the electrode surface. The detection signal is received and processed in real time by the electrochemical detection circuit 442. The detection mechanism 40 records the response electrical signal and performs quantitative analysis on the target substance. The final detection result is obtained directly through the observation window 291 or an externally connected display module.
[0224] In a second aspect of this application, a detection system is proposed, which includes the detection device of the first aspect of this application.
[0225] In some embodiments of this application, the detection system further includes a sample processing device connected to the detection device.
[0226] To make it easier to understand, the following will be combined with... Figure 29-54 The sample processing device is described in detail.
[0227] refer to Figure 29-34 or Figure 40-41 The sample processing device includes: a pusher 50, a cylinder 60, and a target material enrichment layer 70. Specifically:
[0228] refer to Figure 29 or Figure 40 Understandably, the push rod 50 includes a proximal operating part 513, a distal sealing part 512, and a collection part 511 located on the side of the distal sealing part 512 away from the proximal operating part 513.
[0229] Reference Figure 29-30 Or Figure 30 And Figure 40 It is understood that the inner wall of the barrel 60 can be sealingly matched with the distal end sealing part 512, and the inner wall of the barrel 60 can be relatively moved with the push rod 50. One end of the barrel 60 is provided with a push rod inlet 621, and the other end of the barrel 60 is provided with a collection part outlet 622. A sealing layer 623 is arranged at the collection part outlet 622. When the push rod 50 is pushed to contact the sealing layer 623, the collection part 511 can penetrate the sealing layer 623 by continuing to push the push rod 50.
[0230] For different setting positions of the target substance enrichment layer 70, the sample processing device can have two different schemes for use in cooperation:
[0231] For scheme 1: the target substance enrichment layer 70 is arranged on the barrel 60.
[0232] Reference Figure 29-33 It is understood that the target substance enrichment layer 70 is arranged in the barrel 60 and is arranged adjacent to the collection part outlet 622 (reference Figure 31 Or Figure 32 It is understood that one end of the collection part 511 away from the proximal operation part 513 is provided with a stripping part 511a (reference Figure 29 Or Figure 33 It is understood that when the push rod 50 is pushed to make the collection part 511 penetrate the sealing layer 623, the stripping part 511a can strip and take out the target substance enrichment layer 70. Therefore, the cooperation of the push rod 50, the barrel 60 and the target substance enrichment layer 70 can realize the enrichment and transfer of the target substance.
[0233] For scheme 1, in actual operation, the liquid sample can be transferred into the barrel 60, so that the liquid sample contacts the target substance enrichment layer 70 and the target substance in the liquid sample is enriched by the target substance enrichment layer 70. The collection part 511 of the push rod 50 is inserted into the barrel 60 through the push rod inlet 621. In the process of enriching the target substance, the stripping part 511a at one end of the collection part 511 away from the proximal operation part 513 can be selectively controlled to contact or not contact (such as can be not contacted) the target substance enrichment layer 70. When the operation of enriching the target substance ends, the push rod 50 is continuously pushed to realize the contact of the stripping part 511a with the target substance enrichment layer 70 and stripping and taking out, until the collection part 511 penetrates the sealing layer 623 and extends out of the barrel 60 and takes out the target substance enrichment layer 70, realizing the enrichment and transfer of the target substance, and transferring the taken-out target substance enrichment layer 70 to the liquid holding tube 21 of the detection device for subsequent detection.
[0234] For scheme 2, the target substance enrichment layer 70 is arranged on the push rod 50.
[0235] Reference Figure 30 and Figure 40-41 It is understood that the target substance enrichment layer 70 is arranged on the side of the collection part 511 away from the proximal operation part 513 (see Figure 41 It is understood that the target substance enrichment layer 70 is arranged to be taken out of the barrel 60 by the collection part 511 when the collection part 511 penetrates the sealing layer 623 by pushing the push rod 50. Thus, the enrichment and transfer of the target substance can be achieved by the cooperation of the push rod 50, the barrel 60 and the target substance enrichment layer 70, and the taken-out target substance enrichment layer 70 is transferred to the liquid container 21 of the detection device for subsequent detection.
[0236] For scheme 2, in actual operation, the liquid sample can be transferred into the barrel 60, the collection part 511 of the push rod 50 is inserted into the barrel 60 through the push rod inlet 621, the liquid sample is contacted with the target substance enrichment layer 70 and the target substance in the liquid sample is enriched by the target substance enrichment layer 70, when the enrichment of the target substance is completed, the push rod 50 is continuously pushed until the collection part 511 penetrates the sealing layer 623 and extends out of the barrel 60 and takes out the target substance enrichment layer 70, realizing the enrichment and transfer of the target substance, and the taken-out target substance enrichment layer 70 is transferred to the liquid container 21 of the detection device for subsequent detection.
[0237] It can be understood that the liquid sample can be a sample without pretreatment or a sample with pretreatment, and the pretreatment operation can be flexibly selected according to actual needs, for example, for a biological sample, the pretreatment operation can include but is not limited to one or more of dilution, reaction, lysis and other conventional processing methods.
[0238] It can be understood that the target substance can be an original component in the liquid sample, or a target substance obtained from the original component in the liquid sample by reaction, lysis and other processing methods. The process of processing the liquid sample can be flexibly selected whether to be carried out in the barrel 60 according to actual needs.
[0239] The sample processing device of the present application scheme 1 and scheme 2 can independently have one or more of the following technical effects: it can be used for sample processing or pretreatment step to facilitate subsequent operation or detection requirement; it can be used for enriching the detected substance in the large volume sample liquid, or it can be used for enriching the component that can obtain the detected substance in the large volume sample liquid to improve the sensitivity of subsequent operation or detection; it can simultaneously carry out sample (pre) processing and enrichment of the target substance.
[0240] It should be noted that in the present application, "the outer peripheral wall of the collection part 511", "the outer peripheral wall of the distal sealing part 512", "the outer peripheral wall of the pressing part 513a", "the outer peripheral wall of the push rod 50", "the outer peripheral wall of the deformable part 518", "the outer peripheral wall of the deformable beam 518b", "the outer peripheral wall of the third buckle 518a", "the outer" refers to the direction away from the axis of the push rod 50. In addition, "the inner wall of the barrel 60", "the outer barrel 60a", "the inner barrel 60b", "the outer wall of the barrel 60 is concave outward", "the inner of the barrel 60", "the outer peripheral wall of the inlet end 620f3", "the outer peripheral wall of the circumferential rotation groove 620f1", "the inner" refers to the direction close to the axis of the barrel 60, and "the outer" refers to the direction away from the axis of the barrel 60.
[0241] Further, scheme 1 and scheme 2 can respectively independently satisfy one or more of the following additional technical features:
[0242] In some embodiments of the present application, with reference to Figure 29 or Figure 40 It should be understood that the distance between the outer peripheral wall of the collection part 511 and the axis of the push rod 50 can be less than or equal to the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50. Alternatively, the distance between the outer peripheral wall of the collection part 511 and the axis of the push rod 50 can be less than the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50. This further facilitates the collection part 511 penetrating the sealing layer 623 to bring out the target substance enrichment layer 70 from the barrel 60.
[0243] In some embodiments of the present application, the sealing layer 623 can be a waterproof layer or a first waterproof and breathable layer, and the specific type or material can be selected flexibly according to actual needs, for example, the waterproof layer can include but is not limited to aluminum film, and the first waterproof and breathable layer can include but is not limited to permeable film.
[0244] In some embodiments of the present application, with reference to Figure 29 or Figure 33It is understood that the push rod 50 can also be provided with a breakable part 514, which can be located between the collection part 511 and the distal sealing part 512. When the collection part 511 penetrates the sealing layer 623 to extend out of the barrel 60 and take out the target substance enrichment layer 70, the push rod can be broken at the breakable part 514, and then the target substance enrichment layer 70 is transferred with the collection part 511 to the liquid container 21 of the detection device. The operation steps of the existing sample (pre-) processing method are usually cumbersome, such as may involve multiple sample or device transfers, and these transfer processes often rely on manual operation, such as sampling and transferring by using tools such as pipettes, tweezers, etc. During the operation process, misoperation and loss of target substances are easy to occur, which leads to reduced detection accuracy, and the process is cumbersome, time-consuming and laborious. In addition, cross contamination is also easy to occur during manual transfer operation, which leads to low reliability of detection results. By providing the breakable part, contactless transfer of the target substance can be realized, the contact of the enriched target substance with materials such as tweezers is reduced, and the risk of loss of the target substance and / or cross contamination of the target substance during the transfer process, leading to reduced detection accuracy, etc. is reduced.
[0245] In some embodiments of the present application, reference is made to Figure 29 or Figure 40 It is understood that the distance between the outer peripheral wall of the breakable part 514 and the axis of the push rod 50 can be less than or equal to the distance between the outer peripheral wall of the collection part 511 and the axis of the push rod 50. It should be noted that the breakable part 514 can achieve the effect of breakability through material selection, or through structural design (such as forming a fracture on the surface of the push rod), or through both material selection and structural design, as long as the push rod 50 can be broken to separate the collection part 511 and the push rod 50. Alternatively, the distance between the outer peripheral wall of the breakable part 514 and the axis of the push rod 50 can be less than the distance between the outer peripheral wall of the collection part 511 and the axis of the push rod 50, thereby further facilitating the breaking of the push rod 50 and the separation of the collection part 511 and the push rod 50.
[0246] In some embodiments of the present application, reference is made to Figure 29 and Figure 40 It is understood that the distance between the outer peripheral wall of the push rod 50 and the axis of the push rod 50 on the side of the distal sealing part 512 away from the proximal operating part 513 can be less than the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50. In this structural design, when the push rod 50 is pushed to move in the barrel 60, the push rod 50 and the barrel 60 can also accommodate the liquid sample in the space formed by the distal sealing part 512, the inner wall of the barrel 60 and the sealing layer 623.
[0247] In some embodiments of the present application, reference is made to Figure 33It is understood that the breakable part 514 can include a first fracture 514a. This facilitates the breakage of the push rod 50 to achieve the separation of the collection part 511 and the push rod 50. It should be noted that the specific structure of the first fracture 514a and the depth of the first fracture 514a are not particularly limited, and those skilled in the art can choose flexibly according to actual needs. For example, the first fracture 514a can include one or more of a notch, a notch, a groove, etc. Optionally, the notch can include one or more of a V-shaped notch, a U-shaped notch, etc. Optionally, the notch can extend in the circumferential direction of the push rod 50. Optionally, the groove can extend in the circumferential direction of the push rod 50, for example, in the circumferential direction of the push rod 50, the groove can extend along the entire outer peripheral wall of the push rod 50 (which can be a ring-shaped groove) or be arranged along part of the outer peripheral wall of the push rod 50. Alternatively, the groove can be a ring-shaped groove.
[0248] In some embodiments of the present application, the breakable part 514 can include one or more first fractures 514a, which can be arranged continuously or intermittently in the circumferential direction of the push rod 50. For example, the breakable part 514 can include only one first fracture 514a, which can be arranged continuously in the circumferential direction of the push rod 50, such as a ring-shaped groove (see Figure 33 It is understood that, for another example, the breakable part 514 can include a plurality of first fractures 514a, which can be arranged intermittently in the circumferential direction of the push rod 50. For example, the breakable part 514 can include two first fractures 514a, which can be arranged symmetrically and intermittently on the circumferential surface of the push rod 50. Arranging multiple first fractures 514a or a ring-shaped first fracture 514a facilitates the breakage of the push rod 50 from multiple directions, and / or reduces the radial distance of the breakable part 514, thereby further facilitating the breakage of the push rod 50 to achieve the separation of the collection part 511 and the push rod 50.
[0249] It can be understood that, based on the purpose of breaking the push rod 50 to separate the collection part 511 and the push rod 50, the length of the collection part 511 can be set as follows: when the push rod 50 is pushed to the distal end of the sealing part 512 abutting against the inner wall of the barrel 60 away from the push rod inlet 621, the breakable part 514 extends out of the barrel 60, or the breakable part 514 is located at the collection part outlet 622.
[0250] It can be understood that in some embodiments of the present application, the composition, type or structure of the target substance enrichment layer 70 can be flexibly selected according to the actual needs of the target substance to be enriched.
[0251] Optionally, the target substance enrichment layer 70 can be a porous layer, which facilitates the full contact of the liquid sample with the target substance enrichment layer, and achieves the enrichment and separation of the target substance.
[0252] It can be understood that when the target substance enrichment layer 70 is a porous layer, the specific type of the porous layer can be flexibly selected according to actual needs, for example, the porous layer can include but is not limited to one or more of a sponge, a porous adsorption film layer, a porous microsphere, etc.
[0253] It can be understood that when the target substance enrichment layer 70 is a porous layer, the pore size of the porous layer is not particularly limited, and a person skilled in the art can flexibly select according to actual needs. For example, the pore size of the target substance enrichment layer can be 0.1 μm to 5 μm, such as 0.1 μm, 0.5 μm, 1 μm, 1.5 μm, 2 μm, 2.5 μm, 3 μm, 3.5 μm, 4 μm, 4.5 μm, or 5 μm, etc., or can be a range consisting of any of the above values.
[0254] Optionally, the target substance enrichment layer 70 can include a filter material and / or an adsorption material. It can be understood that the material of the filter material and the adsorption material is not particularly limited, and a person skilled in the art can flexibly select according to actual needs. For example, when the target substance needs to be enriched by a filtering operation, the target substance enrichment layer 70 can include a filter material, and the specific material of the filter material can be flexibly selected according to the specific type, size, etc. of the target substance; when the target substance needs to be enriched by an adsorption operation (such as physical adsorption and / or chemical adsorption, etc.), the target substance enrichment layer 70 can include an adsorption material, and the specific material of the adsorption material can be flexibly selected according to the specific type, etc. of the target substance; for another example, the target substance enrichment layer 70 can also have the functions of filtering and adsorption, which can be realized by conventional technical means such as material selection and structure design of the target substance enrichment layer.
[0255] Optionally, the target substance enrichment layer 70 can be configured to allow the nucleic acid natural biological carrier (such as a cell or a virus) in the biological sample to be intercepted, for example, a porous layer with a suitable pore size can be selected as the target substance enrichment layer according to the molecular size or size of the nucleic acid natural biological carrier in the biological sample to be intercepted, for example, the pore size of the porous layer can be 0.1 μm to 5 μm.
[0256] Optionally, the target substance enrichment layer 70 can include but is not limited to one or more of a nitrocellulose (NC) layer, a cellulose acetate (CA) layer, a polyether sulfone (PES) layer, a polytetrafluoroethylene (PTFE) layer, a polyvinylidene fluoride (PVDF) layer, a nylon layer, a regenerated cellulose layer, a modified cellulose layer, and a glass fiber layer.
[0257] Optionally, the target substance enrichment layer 70 can comprise an adsorption material suitable for specific binding with the target substance. In this way, specific enrichment of the desired target substance (such as nucleic acid or protein, etc.) can be achieved. Exemplary adsorption materials include, but are not limited to, silica-based materials, magnetic beads, and immunoglobulin affinity membranes.
[0258] In some embodiments, the adsorption material of the target substance enrichment layer 70 can be a hydrophobic silica-based material for specific capture and adsorption of hydrophobic molecules in the sample, such as various fat-soluble drugs and their metabolites, etc.
[0259] In other embodiments, the adsorption material of the target substance enrichment layer 70 can be an immunoglobulin affinity membrane modified with specific antibodies for specific capture of specific antigens or pathogenic microorganisms in the sample, such as surface protein antigens of Streptococcus pneumoniae and Staphylococcus aureus, etc.
[0260] In yet other embodiments, the adsorption material of the target substance enrichment layer 70 can use a combination of silica-based membranes and magnetic nanobeads as high-efficiency nucleic acid enrichment materials for capturing RNA or DNA in the sample to be detected.
[0261] In some embodiments of the present application, reference is made to Figure 29 or Figure 40 It is understood that the specific type of the distal sealing portion 512 is not particularly limited, and those skilled in the art can flexibly select according to actual needs. For example, the distal sealing portion 512 can be an elastic sealing portion. For another example, the distal sealing portion 512 can include, but is not limited to, a sealing ring and / or a piston. It should be noted that the specific material of the elastic sealing portion, the sealing ring, and the piston is not particularly limited, and those skilled in the art can flexibly select according to actual needs, for example, a common elastic sealing material in the art can be selected as long as it can realize the sealing cooperation and relative movement between the inner wall of the barrel 60 and the distal sealing portion 512.
[0262] In some embodiments of the present application, reference is made to Figure 29 It is understood that the side of the proximal operating portion 513 away from the distal sealing portion 512 can be provided with a pressing portion 513a. In this way, it is further beneficial to press the push rod 50.
[0263] In some embodiments of the present application, reference is made to Figure 29 It is understood that the distance from the outer peripheral wall of the pressing portion 513a to the axis of the push rod 50 can be greater than the distance from the outer peripheral wall of the distal sealing portion 512 to the axis of the push rod 50. In this way, it is further beneficial to realize the push-pull operation of the push rod 50 in the barrel 60.
[0264] Further, for scheme 1, one or more of the following additional technical features can also be met:
[0265] In some embodiments of the present application, reference is made to Figure 33It is understood that the stripping portion 511a is provided at the end of the collection portion 511 away from the proximal operation portion 513, and the stripping portion 511a can be provided with a protrusion 511a1 away from the side of the proximal operation portion 513. The protrusion 511a1 is beneficial for the stripping portion 511a to pierce the target substance enrichment layer 70 when the push rod 50 is pushed to make the collection portion 511 penetrate the sealing layer 623, and further beneficial for the stripping portion 511a to strip and take out the target substance enrichment layer 70.
[0266] Optionally, referring to Figure 33 It is understood that the protrusion 511a1 can have a pointed end, which is further beneficial for the stripping portion 511a to strip and take out the target substance enrichment layer 70 when the push rod 50 is pushed to make the collection portion 511 penetrate the sealing layer 623.
[0267] Optionally, referring to Figure 33 It is understood that the stripping portion 511a can include a plurality of protrusions 511a1, and adjacent two protrusions 511a1 can be arranged at intervals. Thus, when the push rod 50 is pushed to make the collection portion 511 penetrate the sealing layer 623, the push rod 50 can be rotated when the stripping portion 511a pierces the target substance enrichment layer 70, so as to further facilitate the stripping portion 511a to strip and smoothly take out the target substance enrichment layer 70 from the barrel 60.
[0268] Optionally, referring to Figure 33 It is understood that the stripping portion 511a can include a plurality of protrusions 511a1, and the plurality of protrusions 511a1 can enclose a second groove 511a2 on the side facing the proximal operation portion 513, and the second groove 511a2 is suitable for clamping the target substance enrichment layer 70. Thus, when the push rod 50 is pushed to make the collection portion 511 penetrate the sealing layer 623, the push rod 50 can be rotated when the stripping portion 511a pierces the target substance enrichment layer 70, so that the target substance enrichment layer 70 is attached in the second groove 511a2 after being stripped, thereby not only further facilitating the collection portion 511 to smoothly take out the target substance enrichment layer 70 from the barrel 60, but also facilitating the discharge of the liquid between the target substance enrichment layer 70 and the stripping portion 511a.
[0269] In some embodiments of the present application, referring to Figure 29 and Figure 31It is understood that the barrel 60 can include an outer barrel 60a and an inner barrel 60b, the outer barrel 60a is sleeved on the inner barrel 60b, a first waste liquid cavity 60c is formed between the outer barrel 60a and the inner barrel 60b, the inner barrel 60b is arranged in communication with the first waste liquid cavity 60c on the side close to the outlet 622 of the collection part, the inner wall of the inner barrel 60b is sealingly matched with the distal sealing part 512, and the inner wall of the inner barrel 60b is relatively movable with the push rod 50. Thus, when the push rod 50 is pushed to make the collection part 511 penetrate the sealing layer 623, the liquid in the inner barrel 60b can enter the first waste liquid cavity 60c through the target substance enrichment layer 70 under the action of pressure. The current sample enrichment device generally does not have an effective integrated waste liquid treatment or real-time monitoring function, and the waste liquid is usually directly discarded, which not only wastes the sample resources that have not been completely utilized, but also may cause unnecessary pollution and risk to the environment. The above-mentioned arrangement of the present application can integrate the sample pretreatment, target substance enrichment and waste liquid collection, which not only has a compact device structure and simple operation, but also can realize the contactless transfer of the enriched target substance when the breakable part 514 is arranged on the push rod 50, thereby reducing the risk of target substance loss and / or cross contamination of the target substance in the transfer process, causing the detection precision to be reduced and the like. Thus, it is beneficial to the efficient, safe and pollution-free performance of the entire processing process, and overcomes the defects of the traditional technology, such as complex processing process, easy cross contamination and low sample utilization efficiency.
[0270] In some embodiments, reference is made to Figure 29 or Figure 30 It is understood that the outer barrel 60a and the inner barrel 60b can be integrally formed or fixedly connected by welding or the like, or can be detachably connected. For example, the inner barrel 60b and the outer barrel 60a can be connected by threading, clamping, riveting, welding or bonding. Among them, the welding method can be flexibly selected according to actual needs, for example, threads matched with each other can be arranged on the outer surface of the inner barrel 60b and the inner surface of the outer barrel 60a, and an ultrasonic wire is arranged at the threads, and the inner barrel 60b and the outer barrel 60a are connected by ultrasonic welding. For example, reference is made to Figure 31 It is understood that the inner barrel 60b is connected to the outer barrel 60a on the side close to the push rod inlet 621, and / or the inner barrel 60b is connected to the outer barrel 60a on the side close to the outlet 622 of the collection part.
[0271] In some embodiments, reference is made to Figure 32 and Figure 34It is understood that the first waste liquid detection device 60d can be arranged in the first waste liquid cavity 60c. For example, when the liquid enters the waste liquid cavity, the liquid will contact the sample pad of the chromatographic test strip to trigger detection. By arranging the first waste liquid detection device 60d in the first waste liquid cavity 60c, the necessary detection of the waste liquid can be performed before the waste liquid is discarded, so as to evaluate and analyze the waste liquid in real time, and / or detect the sample condition. In this way, not only the acquisition rate of the overall sample information can be improved, but also it can be determined whether the waste liquid needs to be treated before it is discarded, so as to reduce the unnecessary pollution and risk of the waste liquid to the environment. It should be noted that the specific type of the first waste liquid detection device 60d is not particularly limited, and a person skilled in the art can flexibly select according to actual needs. For example, the first waste liquid detection device 60d can include but is not limited to one or more of pH test paper, chromatographic test strip, and electrochemical detection device. Optionally, the electrochemical detection device can include but is not limited to an electrochemical electrode.
[0272] In some embodiments, the first waste liquid cavity 60c can be arranged with a first waste liquid detection device 60d. Figure 34 It is understood that the outer cylinder 60a can be provided with a first visual window 60e, and the first visual window 60e is arranged to display the detection result of the first waste liquid detection device 60d. In this way, the detection result of the waste liquid can be obtained more intuitively.
[0273] In some embodiments, the first waste liquid cavity 60c can be provided with a first gas outlet (not shown), and the first gas outlet can be provided with a second waterproof and breathable layer (not shown). In this way, the air pressure balance in the first waste liquid cavity 60c can be achieved, which is beneficial to the transfer of the waste liquid into the first waste liquid cavity 60c during the process of pushing the push rod 50 to make the collection part 511 penetrate the sealing layer 623.
[0274] In some embodiments, the first waste liquid cavity 60c can be arranged with a first waste liquid detection device 60d. Figure 31 It is understood that the target substance enrichment layer 70 can be arranged in the inner cylinder 60b and located at the communication position of the inner cylinder 60b and the first waste liquid cavity 60c; or, with reference to Figure 32 It is understood that the target substance enrichment layer 70 can be arranged in the inner cylinder 60b and located at the communication position of the inner cylinder 60b and the first waste liquid cavity 60c close to one side of the push rod inlet 621. In this way, it is further beneficial to transfer the liquid sample to the waste liquid cavity after the liquid sample is enriched by the target substance enrichment layer. Optionally, the target substance enrichment layer 70 can be arranged at the communication position of the inner cylinder 60b and the first waste liquid cavity 60c close to one side of the push rod inlet 621.
[0275] In some embodiments, the target substance enrichment layer 70 can be fixed in the barrel 60 before the liquid sample is processed. For example, the target substance enrichment layer 70 can be bonded, welded, connected by a plastic structure, or connected by a sealing ring to the barrel 60. Alternatively, the welding can be achieved by ultrasonic welding, for example, the edges of the target substance enrichment layer 70 can be connected to the inner barrel 60b by ultrasonic welding. Alternatively, the target substance enrichment layer 70 can be clamped in the inner barrel 60b by a sealing ring, for example, two sealing rings can be arranged in the inner barrel 60b, the inner diameter of the sealing ring is greater than the outer diameter of the collection part 511, the outer surfaces of the two sealing rings are in abutment with the inner surface of the inner barrel 60b, and the target substance enrichment layer 70 is clamped between the two sealing rings 627; for another example, referring to Figure 35 It is understood that the step part 626 and the sealing ring 627 can be arranged in the inner barrel 60b, the step part 626 is connected to the inner wall of the inner barrel 60b in the radial direction and extends into the inner barrel 60b, the step part 626 is penetrable by the collection part 511, and the inner diameter of the sealing ring 627 is greater than or equal to the outer diameter of the collection part 511, so that the sealing ring 627 is in abutment with the inner surface of the inner barrel 60b and the step surface of the step part 626 respectively, and the target substance enrichment layer 70 is clamped between the sealing ring 627 and the step surface of the step part 626.
[0276] In some embodiments, the first waste liquid chamber 60c can be provided with a waste liquid absorbing material. In this way, not only can excess waste liquid be absorbed, but the transmission power of the liquid to the waste liquid chamber can also be improved, especially when the liquid sample passes through the target substance enrichment layer 70 and then enters the waste liquid chamber, which is beneficial to improving the enrichment efficiency of the target substance and reducing the risk of backflow of the waste liquid.
[0277] In some embodiments, referring to Figure 35 or Figure 36 It is understood that the inner barrel 60b can be provided with a flow channel 624 near the collection part outlet 622, the inner barrel 60b can be in communication with the first waste liquid chamber 60c through the flow channel 624, the target substance enrichment layer 70 is arranged in the inner barrel 60b and located at the flow channel 624 or located at the side of the flow channel 624 near the push rod inlet 621. In this way, it is further beneficial to transfer the liquid sample enriched by the target substance enrichment layer to the waste liquid chamber. Alternatively, the target substance enrichment layer 70 can be located at the side of the flow channel 624 near the push rod inlet 621. Alternatively, the flow channel 624 can be arranged at the end of the inner barrel 60b near the collection part outlet 622.
[0278] Optionally, the flow channel 624 can include a first flow channel 624a, which can be arranged on the side wall of the inner cylinder 60b and penetrates the side wall of the inner cylinder 60b in the radial direction of the inner cylinder 60b. Thus, it is beneficial to realize the communication between the inner cylinder 60b and the first waste liquid cavity 60c.
[0279] Further, referring to Figure 38 It is understood that the outer periphery wall of the inner cylinder 60b towards the side of the collection part outlet 622 can be provided with a first thread 625b, the inner periphery wall of the outer cylinder 60a close to the side of the collection part outlet 622 can be provided with a second thread 625a, the second thread 625a is screwed with the first thread 625b, the first thread 625b and / or the second thread 625a can be provided with a second flow channel 624b, and the first flow channel 624a communicates with the first waste liquid cavity 60c through the second flow channel 624b. Thus, it is beneficial to realize the connection between the inner cylinder 60b and the outer cylinder 60a, and the communication between the inner cylinder 60b and the first waste liquid cavity 60c.
[0280] Optionally, referring to Figure 35-38 It is understood that the inner cylinder 60b towards the side of the collection part outlet 622 can be provided with the first flow channel 624a and a stepped portion 626, the stepped portion 626 is connected with the inner wall of the inner cylinder 60b in the radial direction of the inner cylinder 60b and extends into the inner cylinder 60b, and the stepped portion 626 can be located on the side of the first flow channel 624a close to the push rod inlet 621 and is provided with a penetration of the collection part 511, and the target substance enrichment layer 70 can be fixed in the inner cylinder 60b by the following way:
[0281] In some specific examples, the target substance enrichment layer 70 can be bonded to the stepped surface of the stepped portion 626, and optionally, the target substance enrichment layer 70 can be bonded to the stepped surface of the stepped portion 626 towards the side of the push rod inlet 621 or the stepped surface of the stepped portion 626 towards the side of the collection part outlet 622.
[0282] In another specific example, referring to Figure 35 Or Figure 36 It is understood that the target substance enrichment layer 70 can be fixed on the stepped surface of the stepped portion 626 by a sealing ring 627, and optionally, the target substance enrichment layer 70 can be clamped between the sealing ring 627 and the stepped surface of the stepped portion 626 towards the side of the push rod inlet 621 or the stepped surface of the stepped portion 626 towards the side of the collection part outlet 622. It can be understood that the inner diameter of the sealing ring 627 is greater than or equal to the outer diameter of the collection part 511, and the sealing ring 627 can abut the inner surface of the inner cylinder 60b and the stepped surface of the stepped portion 626, respectively. Optionally, the sealing ring 627 can be a second elastic sealing ring.
[0283] In yet some specific examples, reference is made to Figure 35 It is appreciated that the target substance enrichment layer 70 can be fixed between the stepped portion 626 and the first flow channel 624a by the sealing ring 627, and one side of the sealing ring 627 along the thickness direction thereof can abut against the stepped surface of the stepped portion 626 (which can be understood as the stepped surface of the stepped portion 626 facing the outlet 622 of the collection portion), and the other side can abut against the inner wall of the outer cylinder 60a (facing the inlet of the push rod), after the inner cylinder 60b is assembled with the outer cylinder 60a. Reference is made to Figure 38 It is appreciated that the sealing ring 627 can be provided with a third flow channel 624c penetrating through the radial side wall thereof, and the third flow channel 624c can be in communication with the first flow channel 624a. In this way, it is not only conducive to realizing the communication between the inner cylinder 60b and the first waste liquid cavity 60c, but also conducive to making the waste liquid flow to the first waste liquid cavity as much as possible. It is appreciated that the inner diameter of the sealing ring 627 is greater than or equal to the outer diameter of the collection portion 511, and the sealing ring 627 can abut against the inner surface of the inner cylinder 60b and the stepped surface of the stepped portion 626, respectively. Alternatively, the sealing ring 627 can be a second elastic sealing ring. Further alternatively, the number of the sealing ring 627 can be one or multiple, and the target substance enrichment layer 70 can be sandwiched between the stepped surface of the stepped portion 626 and the sealing ring, or between two adjacent sealing rings. Yet further alternatively, the target substance enrichment layer 70 can be arranged at the side of the third flow channel 624c close to the inlet 621 of the push rod.
[0284] As some specific examples, reference is made to Figure 36 or Figure 37 It is appreciated that the sealing layer 623 can be arranged between the sealing ring 627 and the outer cylinder 60a. Further alternatively, the number of the sealing ring 627 can be multiple, for example, Figure 35 as shown, the number of the sealing ring 627 can be one; Figure 36 as shown, the number of the sealing ring 627 can be two; Figure 37 or Figure 38 as shown, the number of the sealing ring 627 can be three. When multiple sealing rings 627 are arranged, the sealing layer 623 can be arranged between two adjacent sealing rings and at the side of the third flow channel 624c and / or the first flow channel 624a close to the outlet 622 of the collection portion.
[0285] As some specific examples, reference is made to Figure 37 and Figure 38It is understood that the inner cylinder 60b is further provided with a second step portion 628 and a third step portion 629 connected in sequence on the side of the step portion 626 facing the collection portion outlet 622, the second step portion 628 is connected with the step portion 626 and located between the step portion 626 and the third step portion 629, the second step portion 628 and the third step portion 629 are respectively and independently connected with the inner wall of the inner cylinder 60b in the radial direction of the inner cylinder 60b and extend into the inner cylinder 60b, and both are provided with the collection portion 511 which can be penetrated, the outer diameter of the second step portion 628 is greater than that of the step portion 626, the outer diameter of the third step portion 629 is greater than that of the second step portion 628, and the first flow channel 624a is arranged at one end of the second step portion 628 facing the collection portion outlet 622. The sealing ring 627 can include a first sealing ring 627a, a second sealing ring 627b and a third sealing ring 627c, the inner diameters of the first sealing ring 627a, the second sealing ring 627b and the third sealing ring 627c are respectively and independently greater than or equal to the outer diameter of the collection portion 511, and:
[0286] The first sealing ring 627a is arranged to be embedded in the outlet enclosed by the second step portion 628 and abut against the side wall of the second step portion 628 and the step surface of the step portion 626 on the side facing the collection portion outlet 622; optionally, the thickness of the first sealing ring 627a can be less than the difference between the extension distance of the second step portion 628 and the first flow channel 624a in the axial direction of the cylinder 60;
[0287] The second sealing ring 627b can be provided with a third flow channel 624c penetrating through the radial side wall of the second sealing ring 627b and a second flange 627b1 protruding radially from the second sealing ring 627b along the thickness direction of the second sealing ring 627b. The side of the second sealing ring 627b away from the second flange 627b1 in the thickness direction is arranged to be embedded in the outlet enclosed by the second step portion 628, and the outer peripheral wall of the embedded part abuts against the inner wall of the second step portion 628. The second step portion 628 can also be provided with a limiting support port (not shown) arranged at one end of the second step portion 628 close to the outlet 622 of the collection portion and recessed along the radial direction of the inner cylinder body 60b to the side wall of the second step portion 628, and the limiting support port is arranged in cooperation with the second flange 627b1. The third flow channel 624c is arranged to be in communication with the first flow channel 624a when the second flange 627b1 cooperates with the limiting support port. The thickness of the second flange 627b1 is greater than or equal to the recess depth of the limiting support port. The difference between the total thickness of the first sealing ring 627a and the second sealing ring 627b and the thickness of the second flange 627b1 is less than the axial extension distance of the second step portion 628 along the cylinder body 60, and the total thickness of the first sealing ring 627a and the second sealing ring 627b is greater than or equal to the axial extension distance of the second step portion 628 along the cylinder body 60, and can be less than the total axial extension distance of the second step portion 628 and the third step portion 629 along the cylinder body 60.
[0288] The third sealing ring 627c is arranged to be embedded in the outlet enclosed by the third step portion 629 along at least part of the thickness direction, and the outer peripheral wall of the embedded part abuts against the inner wall of the third step portion 629. Optionally, the thickness of the third sealing ring 627c can be arranged to abut against the inner wall of the outer cylinder body 60a along one side in the thickness direction after the outer cylinder body 60a and the inner cylinder body 60b are connected in cooperation and the first sealing ring 627a, the second sealing ring 627b, and the target substance enrichment layer 70 are assembled. The other side directly or indirectly abuts against the second sealing ring 627b. Further optionally, the first thread 625b can extend along the peripheral wall of the cylinder where the third step portion 629 is located to the peripheral wall of the cylinder where the second step portion 628 or the step portion 626 is located.
[0289] Based on the above scheme, the target substance enrichment layer 70 can be clamped between the first sealing ring 627a and the second sealing ring 627b. Optionally, the sealing layer 623 can be arranged on one side of the third sealing ring 627c in the thickness direction, such as being connected by bonding or the like, so that the sealing layer 623 is located on the side of the third sealing ring 627c facing or away from the push rod inlet 621 after the outer cylinder body 60a and the inner cylinder body 60b are connected in cooperation.
[0290] It should be noted that the specific structure of the step portion 626, the second step portion 628 and the third step portion 629 is not particularly limited, and those skilled in the art can flexibly select according to actual needs, as long as the step portion 626, the second step portion 628 and the third step portion 629 can be penetrated by the collection portion 511 and can cooperate to fix the target substance enrichment layer 70. For example, the step portion 626, the second step portion 628 and the third step portion 629 can be annular step portions, respectively, or can include a plurality of sub-step portions spaced along the circumference of the inner cylinder 60b. The following is an example of the step portion 626: optionally, the step portion 626 can be an annular step portion, further, the annular step portion can be coaxially arranged with the inner cylinder 60b; further optionally, the step portion 626 can include a plurality of sub-step portions, the plurality of sub-step portions are arranged along the circumference of the inner cylinder 60b, and each sub-step portion can be independently connected to the inner wall of the inner cylinder 60b and extend into the inner cylinder 60b in the radial direction of the inner cylinder 60b.
[0291] For the convenience of understanding the sample processing device of scheme 1, the following refers to Figure 39 The method of sample processing using the sample processing device of an embodiment of scheme 1 is exemplarily described. Referring to Figure 39 It is understood that the method of sample processing includes the following steps:
[0292] (1) transferring the liquid sample to be processed into the cylinder 60;
[0293] (2) pressing the push rod 50 into the cylinder 60, at this time, due to the downward pressing of the push rod 50, the liquid sample in the cylinder 60 will move downward, pass through the target substance enrichment layer 70, and then flow into the first waste liquid chamber 60c, the liquid flow direction is as shown by the arrow of Figure 39 ②. In this process, the target substance enrichment layer 70 enriches the target substance in the liquid sample;
[0294] (3) completely pressing the push rod 50 into the cylinder 60, at this time, the stripping portion 511a of the push rod 50 will strip and take out the cylinder 60 the target substance enrichment layer 70 enriched with the target product;
[0295] (4) breaking the breakable portion 514 of the push rod 50, so that the collection portion 511 with the target substance enrichment layer 70 is transferred to the liquid containing tube 21 of the detection device.
[0296] Further, for scheme 2, one or more of the following additional technical features can also be met:
[0297] In some embodiments of the present application, referring to Figure 41It is understood that the push rod 50 can be provided with an open inner cavity 515a, and the opening of the open inner cavity 515a can be arranged on the side of the collection part 511 away from the proximal operation part 513. The target substance enrichment layer 70 can be arranged on the push rod 50 and located at the opening of the open inner cavity 515a or arranged in the open inner cavity 515a. Thus, after the target substance enrichment layer 70 is in contact with the liquid sample and enriched with the target substance, the push rod 50 is pushed to penetrate the sealing layer 623 to take out the target substance enrichment layer 70 from the barrel 60.
[0298] In some embodiments of the present application, reference is made to Figure 41 It is understood that the push rod 50 can be provided with a cavity 515, which can include a second waste liquid cavity 515b extending along the length direction of the push rod 50 and an open inner cavity 515a arranged on the side of the second waste liquid cavity 515b away from the proximal operation part 513 and in communication with the second waste liquid cavity 515b. The opening of the open inner cavity 515a is arranged on the side of the collection part 511 away from the proximal operation part 513. The target substance enrichment layer 70 can be arranged on the push rod 50 and located at the opening of the open inner cavity 515a or arranged in the open inner cavity 515a. The cavity 515 is arranged such that when the push rod 50 is pushed to make the collection part 511 penetrate the sealing layer 623, the liquid in the barrel 60 can enter the cavity 515 through the open inner cavity 515a under the action of pressure. The current sample enrichment device generally does not have an effective waste liquid treatment or real-time monitoring function. The waste liquid is usually directly discarded, which not only wastes the sample resources that have not been fully utilized, but also may cause unnecessary pollution and risk to the environment. The above arrangement can integrate the sample pretreatment, target substance enrichment and waste liquid collection, which not only has a compact structure and simple operation, but also can realize the contactless transfer of the enriched target substance when the breakable part 514 is arranged on the push rod 50, thereby reducing the risk of target substance loss and / or cross contamination of the target substance in the transfer process, which leads to the decrease of detection accuracy. Thus, it is beneficial to the efficient, safe and pollution-free performance of the whole process, and overcomes the defects of the traditional technology, such as complex process, easy cross contamination and low sample utilization efficiency.
[0299] In some embodiments, reference is made to Figure 41 It is understood that the push rod 50 can also be provided with a breakable part 514, which can be arranged on the outer wall of the open inner cavity 515a and located on the side of the target substance enrichment layer 70 close to the proximal operation part 513. The second waste liquid cavity 515b can be located on the side of the breakable part 514 close to the proximal operation part 513. Thus, it is beneficial to realize the effective separation of the waste liquid and the target substance.
[0300] In some embodiments, reference is made to Figure 41It is understood that a one-way valve 515c can be provided between the second waste liquid chamber 515b and the open inner chamber 515a, and the one-way valve 515c is adapted to open when the pressure of the open inner chamber 515a is greater than that of the second waste liquid chamber 515b. Thus, when the pressure of the open inner chamber 515a is greater than that of the second waste liquid chamber 515b, the one-way valve 515c can open, and the liquid will flow from the open inner chamber 515a into the second waste liquid chamber 515b; when the pressure of the open inner chamber 515a is less than or equal to that of the second waste liquid chamber 515b, the one-way valve 515c will be closed, and the liquid will not flow from the second waste liquid chamber 515b into the open inner chamber 515a.
[0301] In some embodiments, with reference to Figure 42 It is understood that the second waste liquid chamber 515b can be provided with a second waste liquid detection device 515d. For example, when the liquid enters the waste liquid chamber, the liquid will contact the sample pad of the chromatographic test strip to trigger detection. By providing the second waste liquid detection device 515d in the second waste liquid chamber 515b, necessary detection of the waste liquid can be performed before the waste liquid is discarded, so as to evaluate and analyze the waste liquid in real time, and / or detect the sample condition. Thus, not only can the acquisition rate of the overall sample information be improved, but it can also be determined whether the waste liquid needs to be treated before it is discarded, so as to reduce the unnecessary pollution and risk to the environment caused by the waste liquid. It should be noted that the specific type of the second waste liquid detection device 515d is not particularly limited, and a person skilled in the art can flexibly select according to actual needs. For example, the second waste liquid detection device 515d can include, but is not limited to, one or more of a pH test paper, a chromatographic test strip, and an electrochemical detection device. Optionally, the electrochemical detection device can include, but is not limited to, an electrochemical electrode.
[0302] In some embodiments, with reference to Figure 42 It is understood that the push rod 50 can be provided with a second visible window 516, and the second visible window 516 is configured to display the detection result of the second waste liquid detection device 515d. Thus, the detection result of the waste liquid can be obtained more intuitively.
[0303] In some embodiments, with reference to Figure 41 It is understood that the second waste liquid chamber 515b can be provided with a second gas outlet 517, and the second gas outlet 517 can be provided with a third waterproof and breathable layer (not shown). Thus, the air pressure balance in the second waste liquid chamber 515b can be achieved, and the transfer of the waste liquid into the second waste liquid chamber 515b is further facilitated during the process of pushing the push rod 50 to penetrate the sealing layer 623.
[0304] In some embodiments, the target substance enrichment layer 70 can be fixed on the push rod 50 before the liquid sample is processed. For example, the target substance enrichment layer 70 can be bonded, fused, connected by a plastic structure, or connected by a sealing ring to the push rod 50. Alternatively, the fusion connection can be achieved by ultrasonic welding, for example, the edges of the target substance enrichment layer 70 can be connected to the push rod 50 by ultrasonic welding.
[0305] In some embodiments, the second waste liquid chamber 515b can be provided with a waste liquid absorption material, so that the excess waste liquid can be absorbed and the risk of backflow of the waste liquid can be reduced.
[0306] For the convenience of understanding the sample processing device of Scheme 2, the following refers to Figure 43 The method of processing a sample using the sample processing device of an embodiment of Scheme 2 is exemplarily described. Referring to Figure 43 It is understood that the method of processing a sample includes the following steps:
[0307] (1) transferring the liquid sample to be processed into the barrel 60;
[0308] (2) pressing the push rod 50 into the barrel 60, so that the target substance enrichment layer 70 in the push rod 50 is in contact with the liquid sample, so as to enrich the target substance in the liquid sample; at this time, due to the pressing of the push rod 50, the liquid sample in the barrel 60 moves to the open inner cavity 515a of the push rod, passes through the target substance enrichment layer 70, and then flows into the second waste liquid chamber 515b, and the liquid flow direction is as shown by the arrow of Figure 43 (2) in FIG. 2;
[0309] (3) completely pressing the push rod 50 into the barrel 60, at this time, the collection part 511 of the push rod 50 will take out the target substance enrichment layer 70 enriched with the target substance from the barrel 60;
[0310] (4) breaking the breakable part 514 of the push rod 50, so that the collection part 511 with the target substance enrichment layer 70 is transferred to the liquid holding tube 21 of the detection device.
[0311] Further, Scheme 1 and Scheme 2 can also independently satisfy one or more of the following additional technical features:
[0312] In some embodiments of the present application, referring to Figure 44It is understood that the push rod 50 can also include a deformable portion 518 extending between the proximal end operation portion 513 and the distal end sealing portion 512, the outer peripheral wall of the deformable portion 518 having a third snap 518a protruding in the radial direction of the push rod 50; the push rod inlet 621 of the barrel 60 is provided with a sliding groove 620f, the sliding groove 620f including a circumferential rotation groove 620f1 recessed from the inner wall of the barrel 60 in a direction away from the axis of the barrel 60, and a bevel groove 620f2 connected with the circumferential rotation groove 620f1 and inclined towards the inside of the barrel and extending in the direction of the collection portion outlet 622, the circumferential rotation groove 620f1 being provided with an inlet end 620f3 in communication with the push rod inlet 621, the circumferential rotation groove 620f1 being arranged to rotate with the circumferential rotation groove 620f1 when the push rod 50 is pushed to make the third snap 518a extend into the circumferential rotation groove 620f1 from the inlet end 620f3; the bevel groove 620f2 is arranged to be in extrusion fit with the third snap 518a to push the third snap 518a and the push rod 50 downward when the third snap 518a passes through the bevel groove 620f2.
[0313] In actual operation, the target substance enrichment layer 70 is mostly a porous material, and when the liquid directly contacts the target substance enrichment layer 70 for enrichment of the target substance, there can be a case where a large amount of the target substance is enriched on the side of the target substance enrichment layer 70 facing the push rod inlet 621, and only a small amount of the target substance passes through the surface of the target substance enrichment layer 70 into the inside thereof due to the gravity of the liquid, which poses a risk of low target substance enrichment efficiency and / or incomplete enrichment of the target substance in the liquid, and pushing down the push rod 50 can provide pressure to the liquid to pass through the target substance enrichment layer 70, so that more target substance is enriched in the target substance enrichment layer 70. The liquid passing through the target substance enrichment layer 70 under the push of the push rod 50 takes time, and the amount of pushing down of the push rod can be controlled by controlling the single advancing distance of the push rod 50 in the barrel 60, so that the liquid passes through the target substance enrichment layer 70 without the collection portion 511 prematurely contacting the target substance enrichment layer 70 and puncturing the sealing layer 623 to cause the enrichment operation of the target substance to fail. By using the above structure of the push rod 50 and the barrel 60, the third snap 518a and the sliding groove 620f are matched with each other, which can pass the liquid (i.e., make the liquid penetrate the target substance enrichment layer 70) out of the liquid by pushing the push rod one or more times when enriching the target substance in the liquid, and control the single liquid out amount (which can be understood as the liquid out amount penetrating the target substance enrichment layer) of the liquid, thereby reducing the risk of problems such as low target substance enrichment efficiency, incomplete enrichment of the target substance, or failure of the target substance enrichment operation.
[0314] Therefore, the sample processing device can further achieve one or more of the following technical effects: (1) during the enrichment of the target substance, the third buckle 518a on the deformable portion 518 can be used to cooperate with the sliding groove 620f to promote the liquid to pass through the target substance enrichment layer and control the quantitative liquid discharge. For example, the third buckle 518a can be used to regulate the depth of the push rod 50 pushed into the barrel 60, and the circumferential rotating groove 620f1 can be used to prevent the third buckle 518a from being popped up under the action of air pressure, thereby facilitating accurate control of the travel distance and stop position of the push rod 50, and thereby facilitating control of the liquid discharge rate of the target substance enrichment layer and quantitative liquid discharge, and improving the accuracy of quantitative liquid discharge. Compared with the existing manual direct liquid discharge, not only is the operation simple, but also facilitates rapid and accurate quantitative liquid discharge, improving the stability of repeated operations (such as using multiple sample processing devices of the same specification to perform the same operation) or different personnel operations; (2) simple structure and low cost; (3) rapid and accurate quantitative liquid discharge without the need for additional measuring tools, which is conducive to the performance of parallel tests or control tests; (4) good liquid pushing stability and uniformity; (5) easy to mass-produce and promote; (6) suitable for widespread promotion and use in medical, laboratory, biopharmaceutical, chemical food and other industries.
[0315] In actual operation, it is understood that Figure 45 that the third buckle 518a is adapted to be inserted or withdrawn from the circumferential rotating groove 620f1 from the inlet end 620f3 by manual or automatic means. Further, it is understood that Figure 31 that the sliding groove 620f includes a beveled groove 620f2 (see Figure 45 for details), since the beveled groove 620f2 can exert a horizontal rightward force on the third buckle 518a and the deformable portion 518, the deformable portion 518 can deform, allowing the third buckle 518a to move along the beveled groove 620f2 in a direction perpendicular to the sliding groove 620f, so that the movement of the push rod 50 along the axis of the barrel 60 is not limited.
[0316] It can be understood that the deformable portion 518 can undergo recoverable or non-recoverable deformation under the action of an external force. For example, the deformable portion 518 can undergo recoverable or non-recoverable deformation under the action of an external force perpendicular thereto.
[0317] It can be understood that the circumferential rotating groove 620f1 is a groove with an opening facing the inside of the barrel 60 and extending circumferentially along the barrel 60 (see Figure 45 and Figure 46It can be understood that the extension distance of the third buckle 518a on the inner wall of the barrel 60 can be flexibly selected according to actual needs. For example, the corresponding arc of the circumferential rotating groove 620f1 can be 1°-359°, such as 1°, 5°, 10°, 20°, 30°, 40°, 50°, 60°, 70°, 80°, 90°, 100°, 110°, 120°, 130°, 140°, 150°, 180°, 210°, 240°, 270°, 300°, 330° or 359°, or a range formed by any of the above values. Alternatively, the corresponding arc of the circumferential rotating groove 620f1 can be 10°-150°.
[0318] It can be understood that the groove depth of the circumferential rotating groove 620f1 (i.e. the depth of the circumferential rotating groove 620f1 recessed outward from the inner wall of the barrel 60, referring to FIG. 6B) can be flexibly selected according to the wall thickness of the barrel 60, the inner diameter of the barrel 60, the distance from the outer peripheral wall of the third buckle 518a to the axis of the push rod 50, etc., as long as the third buckle 518a can rotate in the circumferential rotating groove 620f1. Figure 45 It can be understood that the groove depth of the circumferential rotating groove 620f1 (i.e. the depth of the circumferential rotating groove 620f1 recessed outward from the inner wall of the barrel 60, referring to FIG. 6B) can be flexibly selected according to the wall thickness of the barrel 60, the inner diameter of the barrel 60, the distance from the outer peripheral wall of the third buckle 518a to the axis of the push rod 50, etc., as long as the third buckle 518a can rotate in the circumferential rotating groove 620f1. Figure 46 It can be understood that the groove depth of the circumferential rotating groove 620f1 (i.e. the depth of the circumferential rotating groove 620f1 recessed outward from the inner wall of the barrel 60, referring to FIG. 6B) can be flexibly selected according to the wall thickness of the barrel 60, the inner diameter of the barrel 60, the distance from the outer peripheral wall of the third buckle 518a to the axis of the push rod 50, etc., as long as the third buckle 518a can rotate in the circumferential rotating groove 620f1.
[0319] It can be understood that the groove height of the circumferential rotating groove 620f1 (i.e. the distance between the groove wall on the side of the push rod inlet 621 and the groove wall on the side of the collection part outlet 622) can be flexibly selected according to the extension distance of the third buckle 518a along the length direction of the push rod 50 and the required accuracy of the single liquid outflow amount controlled, as long as it can cooperate with the third buckle 518a to rotate in the circumferential rotating groove 620f1 and inhibit the third buckle 518a from bouncing to the side of the push rod inlet 621 under the action of air pressure, and the liquid error caused by the cooperation distance between the third buckle 518a and the circumferential rotating groove 620f1 is within an acceptable range. For example, the groove height of the circumferential rotating groove 620f1 can be slightly larger than the extension distance of the third buckle 518a along the length direction of the push rod 50, such as 0.02mm-1mm. Alternatively, under general accuracy requirements, the groove height of the circumferential rotating groove 620f1 can be 0.5mm-1mm larger than the extension distance of the third buckle 518a along the length direction of the push rod 50 (such as 0.5mm, 0.6mm, 0.7mm, 0.8mm, 0.9mm or 1mm, etc.), and under high accuracy requirements, the value can be set to be smaller according to the accuracy calculation result, but considering the flexible rotation of the push rod 50 in the circumferential rotating groove 620f1, generally the distance should be greater than 0.02mm, such as 0.02mm-0.05mm, for example, greater than 0.02mm, 0.05mm, 0.1mm, 0.2mm, 0.3mm, 0.4mm or 0.45mm, etc.
[0320] It is understandable that the extension distance of the inclined groove 620f2 in the length direction of the cylinder 60 is not particularly limited. Those skilled in the art can choose flexibly according to actual needs, as long as it can achieve the pressing cooperation with the third buckle 518a to push the third buckle 518a and the push rod 50 downward.
[0321] It is understandable that the number and location of the slide grooves 620f are matched with the overall distribution and number of the third buckle 518a along the length and circumferential direction of the push rod 50.
[0322] In some embodiments of this application, the specific structure of the deformable part 518 is not particularly limited, and those skilled in the art can flexibly choose according to actual needs. For example, the deformable part 518 can achieve deformation under external force by setting a deformable column and a buckle, or it can achieve deformation under external force by setting a deformable beam and a buckle. For example, the deformable part may include a deformable column and a buckle provided on the outer peripheral wall of the deformable column. The deformable column can be an elastic column, which can be formed of an elastic material (such as rubber). This facilitates the deformation of the deformable part 518 under compression deformation under external force. For example, refer to... Figure 47 , Figure 48 or Figure 49 It is understood that the deformable part 518 may include a deformable beam 518b and a third latch 518a. The deformable beam 518b may extend along the length direction of the push rod 50, and the third latch 518a may be provided on the outer peripheral wall of the deformable beam 518b. This facilitates the deformable part 518 to undergo compression deformation under the action of external force, allowing the third latch 518a to move along the inclined plane or perpendicular to the inclined plane.
[0323] In some embodiments of this application, reference is made to Figure 47 , Figure 48 or Figure 49 It is understood that the distance between the outer peripheral wall of the deformable beam 518b and the axis of the push rod 50 can be less than or equal to the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50; the distance between the outer peripheral wall of the third latch 518a and the axis of the push rod 50 can be greater than the distance between the outer peripheral wall of the distal sealing part 512 and the axis of the push rod 50. Therefore, this facilitates the push rod 50's advancement into the cylinder 60, and also prevents the push rod 50 from springing up due to air pressure through the cooperation of the third latch 518a and the slide groove 620f.
[0324] In some embodiments of this application, the deformable portion 518 may include a third latch 518a (see reference). Figure 50 (Understanding) or multiple third clips 518a (reference) Figure 44 or Figure 51(Understanding). When the deformable part 518 includes multiple third latches 518a, the multiple third latches 518a can be spaced apart along the circumferential and / or length direction of the push rod 50. The number of times liquid is dispensed at a single metering rate and the metering volume can be controlled by adjusting the number and spacing of the third latches 518a along the length direction of the push rod 50. Furthermore, in the length direction of the push rod 50, after the distance of the third latches 518a near the far end sealing part 512 of the push rod 50 is fixed, the number and spacing angle of the third latches 518a along the circumferential direction of the push rod 50 can be adjusted to improve the fixing effect of the slide groove 620f on the third latches 518a and the push rod 50, and improve the stability of the push rod 50 maintaining a constant height after the third latches 518a enter the circumferential rotation groove 620f1.
[0325] In some embodiments of this application, the push rod 50 may include a third latch 518a (see reference). Figure 50 or Figure 51 (Understanding) or multi-layer third buckle 518a (reference) Figure 44 (Understanding). When the push rod 50 includes multiple layers of third latches 518a, the multiple layers of third latches 518a can be spaced apart along the length direction of the push rod 50. The number of third latches 518a in each layer can be one or more. Multiple third latches 518a located in the same layer can be spaced apart along the circumference of the push rod 50. In the length direction of the push rod 50, the distance between the third latches 518a located in the same layer and the distal sealing part 512 is equal.
[0326] For example, refer to Figure 50 Understood, push rod 50 may include only one layer of third latch 518a, and this layer of third latch 518a may include only one third latch 518a.
[0327] For example, refer to Figure 51 It is understood that the push rod 50 may consist of only one layer of third latches 518a, which may include multiple third latches 518a spaced apart circumferentially along the push rod 50. This improves the fixing effect of the slide groove 620f on the third latches 518a and the push rod 50, and enhances the stability of the push rod 50 at a constant height after the third latches 518a enter the circumferential rotation groove 620f1.
[0328] Exemplarily, the push rod 50 can include multiple layers of third buckles 518a, and each layer of third buckles 518a can independently include only one third buckle 518a. Thus, the descending distance of the push rod 50 in the barrel 60 can be controlled by regulating the setting positions of different layers of buckles in the length direction of the push rod and / or the distance between adjacent layers of third buckles 518a, so as to realize multiple times of quantitative liquid discharge. It can be understood that the number of layers of third buckles 518a on the push rod 50 and the distance between adjacent two layers of third buckles 518a in the length direction of the push rod 50 can be flexibly selected according to actual needs, for example, the number of layers of third buckles 518a can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20, etc.
[0329] Exemplarily, referring to Figure 44 It can be understood that the push rod 50 can include multiple layers of third buckles 518a, and at least one layer of third buckles 518a includes multiple third buckles 518a arranged at intervals in the circumferential direction of the push rod 50; or, each layer of third buckles 518a can independently include multiple third buckles 518a arranged at intervals in the circumferential direction of the push rod 50. It can be understood that the number of multiple third buckles 518a in the same layer can be flexibly selected according to actual needs, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9 or 10, etc.
[0330] In some embodiments of the present application, referring to Figure 44 It can be understood that the push rod 50 can include multiple layers of third buckles 518a, and the number of third buckles 518a in each layer can be multiple, the number of third buckles 518a in different layers is the same, and in adjacent two layers of third buckles 518a, the corresponding arc of the adjacent two third buckles 518a in one layer is the same as the corresponding arc of the adjacent two third buckles 518a in the other layer. Thus, multiple times of quantitative liquid discharge can be realized, and it is also beneficial to the smooth entry of each layer of third buckles 518a into the chute 620f, and improve the fixing effect of the chute 620f on the third buckle 518a and the push rod 50, and improve the stability of each layer of third buckles 518a keeping the height of the push rod 50 unchanged after entering the circumferential rotating groove 620f1.
[0331] Further, referring to Figure 44 It can be understood that the number of third buckles 518a in each layer can be two. Thus, it is beneficial to improve the fixing effect of the chute 620f on the third buckle 518a and the push rod 50, improve the stability of each layer of third buckles 518a keeping the height of the push rod 50 unchanged after entering the circumferential rotating groove 620f1, and also simplify the structure of the device.
[0332] Further, referring to Figure 44It is understood that in the third buckles 518a on the same layer, the arc corresponding to the two adjacent third buckles 518a can be 100°-180°, for example, can be 100°, 120°, 135°, 150°, 165° or 180°, etc., or can be a range composed of any of the above values. Alternatively, the arc corresponding to the two adjacent third buckles 518a can be 180°.
[0333] In some embodiments of the present application, with reference to Figure 44 It is understood that the push rod 50 can include two layers of third buckles 518a, and each layer of third buckles 518a includes two third buckles 518a, and the arc corresponding to the two adjacent third buckles 518a on one layer is the same as the arc corresponding to the two adjacent third buckles 518a on the other layer.
[0334] It can be understood that in the sample processing device, the number and arrangement position of the sliding grooves 620f are matched with the distribution layer number, the number of third buckles 518a per layer, and the distribution position of the third buckles 518a.
[0335] In some embodiments of the present application, with reference to Figure 47 、 Figure 48 or Figure 49 It is understood that the deformable part 518 can include a plurality of deformable beams 518b arranged circumferentially along the push rod 50, and each deformable beam 518b can be independently provided with at least one third buckle 518a. Thus, the overall distribution of the third buckles 518a on the push rod 50 can be adjusted by adjusting the number of deformable beams 518b and the distribution of the third buckles 518a on the deformable beams 518b. Alternatively, the third buckles 518a can be arranged one by one with the deformable beams 518b, and each deformable beam 518b is provided with one third buckle 518a.
[0336] In some embodiments of the present application, with reference to Figure 46 It is understood that the distance between the outer peripheral wall of the inlet end 620f3 of the sliding groove 620f and the axis of the cylinder body 60 can be greater than or equal to the distance between the outer peripheral wall of the circumferential rotating groove 620f1 and the axis of the cylinder body 60. Alternatively, the distance between the outer peripheral wall of the inlet end 620f3 of the sliding groove 620f and the axis of the cylinder body 60 can be greater than the distance between the outer peripheral wall of the circumferential rotating groove 620f1 and the axis of the cylinder body 60, thereby more facilitating the third buckle 518a to extend into the circumferential rotating groove 620f1 through the inlet end 620f3.
[0337] In some embodiments of the present application, with reference to Figure 46It is understood that the distance from the connection between the side of the inclined groove 620f2 of the chute 620f close to the push rod inlet 621 to the axis of the barrel 60 gradually decreases in the direction away from the circumferential rotating groove 620f1. Thus, it is beneficial to gradually increase the extrusion force on the third buckle 518a and the deformable part 518, so that the third buckle 518a can move along the inclined surface or perpendicular to the inclined surface, and the downward pressing requirement of the push rod 50 is realized.
[0338] In some embodiments of the present application, reference is made to Figure 46 It is understood that the distance from the connection between the side of the inclined groove 620f2 of the chute 620f close to the collection part outlet 622 to the axis of the barrel 60 and the distance from the inner wall of the barrel 60 to the axis of the barrel 60 can be the same. Thus, the overall inner diameter of the barrel 60 can be kept unchanged, thereby further facilitating the movement of the push rod 50 along the length direction of the barrel 60.
[0339] In some embodiments of the present application, the inclined groove 620f2 of the chute 620f can be arranged on the side of the circumferential rotating groove 620f1 extending along the inner wall of the barrel 60 in the circumferential direction, or on the side of the circumferential rotating groove 620f1 facing the inside of the barrel 60, or on the side of the circumferential rotating groove 620f1 facing the inside of the barrel and extending away from the circumferential rotating groove 620f1 in the circumferential direction of the barrel 60.
[0340] In some embodiments of the present application, the third buckle 518a can be a deformable buckle. Thus, the deformable part 518 can be further deformed under the extrusion of the inclined groove 620f2, thereby realizing the downward pressing requirement of the push rod 50.
[0341] In some embodiments of the present application, the deformable part 518 can be an elastically deformable part. For example, the deformable part 518 can include an elastically deformable beam and / or an elastic buckle. It should be noted that the specific material of the elastically deformable part is not particularly limited, and those skilled in the art can choose flexibly according to actual needs, for example, a commonly used elastically deformable material in the art can be selected.
[0342] In some embodiments of the present application, reference is made to Figure 49 It is understood that the deformable beam 518b can include a cantilever beam, and the third buckle 518a located on the cantilever beam can be arranged at the free end of the cantilever beam.
[0343] In some embodiments of the present application, reference is made to Figure 47 or Figure 48 It is understood that the deformable beam 518b can include a double-end fixed beam, and the third buckle 518a located on the double-end fixed beam can be arranged between the two ends of the double-end fixed beam.
[0344] In some embodiments of the present application, reference is made toFigure 52 It is understood that a second break 518c may be provided on the side of the double-ended fixed beam near the distal sealing part 512. This facilitates the deformation of the deformable part 518 after use, allowing it to undergo irreversible deformation. Figure 53 The diagram shows the deformable beam 518b undergoing irreversible deformation at the second fracture 518c after use, thus preventing the push rod 50 from being reused multiple times.
[0345] In some embodiments of this application, when the cylinder 60 includes an outer cylinder 60a and an inner cylinder 60b, and the outer cylinder 60a is sleeved on the inner cylinder 60b, the sliding groove 620f can be provided on the inner cylinder 60b.
[0346] To facilitate understanding of the specific method of controlling quantitative liquid output when the sample processing device of this application enriches the target substance in the liquid, Scheme 1 is used as an example for illustrative explanation below.
[0347] Specifically, refer to Figure 29 , Figure 31 and Figure 38 To illustrate, consider a cylinder structure as follows: "The cylinder 60 includes an outer cylinder 60a and an inner cylinder 60b, with the outer cylinder 60a fitted onto the inner cylinder 60b, forming a first waste liquid chamber 60c between them. The side of the inner cylinder 60b near the collection section outlet 622 is communicatively connected to the first waste liquid chamber 60c." An aluminum membrane is provided as a sealing layer 623 at the collection section outlet 622, and a permeable membrane is provided as a target substance enrichment layer 70 near the push rod inlet at the connection between the inner cylinder 60b and the first waste liquid chamber 60c. (Refer to...) Figure 44 , Figure 45 and Figure 54 For example:
[0348] Step S1: Add the liquid sample to be processed into the cylinder 60 through the push rod inlet 621;
[0349] Step S2: Position the push rod 50 according to... Figure 54 Insert it into the cylinder 60 in the direction shown until the first layer third buckle 518a enters the inlet end 620f3 of the slide groove 620f and cannot be pressed down further;
[0350] Step S3: Keep the height of push rod 50 unchanged and rotate clockwise so that the first layer third buckle 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to air pressure for the first time, flows through the permeation membrane and enters the first waste liquid chamber 60c. However, the first layer third buckle 518a is restricted by the circumferential rotation groove 620f1 and cannot bounce up in accordance with the air pressure.
[0351] Step S4: further pressing, at this time the first layer of third buckles 518a is located at the inclined groove 620f2, the push rod 50 can be pressed until the second layer of third buckles 518a enters the entrance end 620f3 of the sliding groove 620f and cannot be pressed further;
[0352] Step S5: keep the height of the push rod 50 unchanged, rotate clockwise, so that the second layer of third buckles 518a is located in the circumferential rotating groove 620f1, at this time the liquid is subjected to the action of air pressure for the second time, flows out through the permeable membrane into the first waste liquid cavity 60c, and the second layer of third buckles 518a is limited by the circumferential rotating groove 620f1 and cannot pop up in response to the action of air pressure;
[0353] Step S6: further pressing, at this time the second layer of third buckles 518a is located at the inclined groove 620f2, the push rod 50 can be pressed until it is completely inserted, at this time the liquid is subjected to the action of air pressure for the third time, flows out through the permeable membrane into the first waste liquid cavity 60c. During this process, the push rod 50 can be continuously and slowly pushed until the collection part 511 penetrates the sealing layer 623 and extends out of the barrel 60 and carries out the target substance enrichment layer 70, realizing the enrichment of the target substance, and then the breakable part 514 of the push rod 50 is broken, so that the collection part 511 with the target substance enrichment layer 70 is transferred to the liquid containing tube 21 of the detection device for subsequent detection.
[0354] It can be understood that when the sample processing device structure of scheme 2 is adopted and the push rod with a waste gas cavity is adopted, the same operation can be adopted to realize the enrichment and transfer of the target substance.
[0355] Therefore, by using the detection system of the present application, the sample pretreatment, target substance enrichment and waste liquid collection can be integrated, not only the device structure is compact and the operation is simple, but also the contactless transfer and sealed detection of the enriched target substance can be realized, reducing the risk of target substance loss and / or cross contamination of the target substance in the transfer process, leading to the problem of reduced detection accuracy, thereby facilitating the efficient, safe and pollution-free performance of the entire processing process, overcoming the defects of complex processing process, easy cross contamination and low sample utilization efficiency of the traditional technology.
[0356] It should be noted that the features and advantages described above for the detection device also apply to the detection system, which will not be described here.
[0357] The experimental examples described below are exemplary and are only used to explain the present application and cannot be understood as limiting the present application. If the specific technology or condition is not specified in the experimental examples, it is carried out according to the technology or condition described in the literature in the art or according to the product instruction. If the reagent or instrument is not specified by the manufacturer, it is a conventional product that can be obtained by market purchase.
[0358] Experimental Example. Detection of novel coronavirus in upper respiratory tract saliva samples by the detection system of the present application
[0359]
Instruments and materials
[0360] 1. Sample processing device: including a matched push rod 50 and barrel 60, and target substance enrichment layer 70 and sealing layer 623, wherein the assembly structure of the push rod 50 and the barrel 60 is as shown in Figure 44 , the barrel 60 includes an inner barrel 60b and an outer barrel 60a, and the connection assembly structure of the inner barrel 60b and the outer barrel 60a is as shown in Figure 29 , the target substance enrichment layer 70 adopts a polyether sulfone PES membrane (microporous pore size 0.45 μm, Cole-Parmer), and the sealing layer 623 adopts an aluminum film. The cross-sectional view of the sample processing device after assembly near the outlet side of the collection part is as shown in Figure 38 .
[0361] 2. Saliva collection tube (Sarstedt, Germany);
[0362] 3. Microcentrifuge tube (1.5 mL, 0.1 mL);
[0363] 4. Centrifuge (Thermofisher);
[0364] 5. Pipette and filter tip;
[0365] 6. Vortex mixer (Thermofisher);
[0366] 7. Detection device: including clamping mechanism 10, sealing mechanism 20, cutting mechanism 30 and detection mechanism 40, and the assembly diagram is as shown in Figure 2 , wherein the detection module in the detection mechanism 40 adopts a nucleic acid chromatography test paper.
[0367] 8. Constant potential instrument (Shanghai Chenhua);
[0368] 9. Screen-printed carbon electrode.
[0369]
Reagents
[0370] 1. Novel coronavirus pseudovirus (Fubao), Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), Bordetella pertussis (ATCC 9340)
[0371] 2. Healthy volunteer saliva
[0372] 3. Probe-containing LAMP reaction system:
[0373] LAMP reaction master mix (NEB)
[0374] Novel coronavirus test gene primer LAMP Primer Mix (Sangon Biotech (Shanghai) Co., Ltd.)
[0375] Primer probe sequence:
[0376] E1-F3 TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 1)
[0377] E1-B3 TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 2)
[0378] E1-FIP
[0379] ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG (SEQ ID NO: 3)
[0380] E1-BIP
[0381] TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO: 4)
[0382] E1-LF FAM-CGCTATTAACTATTAACG (SEQ ID NO: 5)
[0383] E1-LB Biotin-GCGCTTCGATTGTGTGCGT (SEQ ID NO: 6)
[0384]
Sample preparation and pretreatment
[0385] 1. 10 6 copies of novel coronavirus pseudovirus (Fubao), Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), Bordetella pertussis (ATCC9340) were added to 1 mL of saliva of healthy volunteers.
[0386] 2. The saliva sample mixed with the new coronavirus pseudo-virus is added to the saliva collection tube, and the ratio of the sample to the preservative in the collection tube is about 4:1.
[0387] 3. Vortex for 5-10 seconds and centrifuge for a moment
[0388] 4. Incubate at room temperature for 10 minutes.
[0389]
Target enrichment
[0390] Reference Figure 54 :
[0391] S1: Load 1 mL of the sample obtained after pretreatment of the sample into the barrel 60 of the sample processing device;
[0392] S2: Press the push rod 50 into the barrel 60 until the first layer of third buckles 518a enters the entrance end 620f3 of the sliding groove 620f (see Figure 44 、 Figure 45 for reference) and cannot be pressed further.
[0393] S3: Keep the height of the push rod 50 unchanged, and rotate the push rod 50 in the direction from the entrance end 620f3 of the sliding groove 620f to the circumferential rotation groove 620f1 (as shown by the black arrow in S3 in the figure), so that the first layer of third buckles 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to the action of air pressure for the first time, passes through the target substance enrichment layer 70 into the first waste liquid chamber 60c, and the first layer of third buckles 518a is limited by the circumferential rotation groove 620f1 and cannot be popped up in response to the action of air pressure; Figure 54 S4: Further press, at this time the first layer of third buckles 518a is located at the inclined groove 620f2, the push rod 50 can be pressed, until the second layer of third buckles 518a enters the entrance end 620f3 of the sliding groove 620f and cannot be pressed further;
[0394] S5: Keep the height of the push rod 50 unchanged, and rotate the push rod 50 in the direction from the entrance end 620f3 of the sliding groove 620f to the circumferential rotation groove 620f1, so that the second layer of third buckles 518a is located in the circumferential rotation groove 620f1. At this time, the liquid is subjected to the action of air pressure for the second time, passes through the target substance enrichment layer 70 into the first waste liquid chamber 60c, and the second layer of third buckles 518a is limited by the circumferential rotation groove 620f1 and cannot be popped up in response to the action of air pressure;
[0395]
[0396] S6: Press down further. At this time, the second layer third buckle 518a is located at the inclined groove 620f2. The push rod 50 can be pressed down until it is fully inserted. At this time, the liquid is subjected to air pressure for the third time, passing through the target material enrichment layer 70 and entering the first waste liquid chamber 60c. During this process, the push rod 50 can be pushed slowly until the peeling part 511a of the push rod 50 peels off the target material enrichment layer 70 and pierces the aluminum film to bring the target material enrichment layer 70 out of the cylinder 60. At this time, the break of the breakable part 514 is also located outside the cylinder 60.
[0397] S7: Break the push rod 50 along the fracture point of the breakable part 514, so that the target material enrichment layer 70 is transferred with the collection part 511 for inspection.
[0398] [Detection of analytes]
[0399] S8: Transfer the target substance enrichment layer 70, which was broken off in S7, along with the collection unit 511 to the liquid collection tube 21 (the liquid collection tube 21 contains LAMP reactants, the composition of which is shown in Table 1, and the tube wall of the liquid collection tube 21 is provided with phase change material 211 paraffin near the tube opening, and the broken target substance enrichment layer 70 is placed in the liquid collection tube 21 along with the collection unit 511 to ensure that the target substance enrichment layer 70 is fully immersed). Then, place the liquid collection tube 21 into the first mounting port 101 on the clamping mechanism 10 and turn on the heating component 12 (refer to...). Figure 8 (In step b, set the temperature to 37℃ for 5 minutes, then increase the temperature to 67℃ for 30 minutes). After the reaction is complete, remove the heating element 12.
[0400] S9: Remove the support mechanism 223 and press down the clamping mechanism 10 in the first direction. The clamping mechanism 10 is pressed down in the first direction with the cooperation of the first groove 13 on it and the upper limit block 22 of the sealing mechanism 20, and with the cooperation of the through groove 103 on the clamping mechanism 10 and the guide post 23 on the sealing mechanism 20. After the liquid collection tube 21 is cut by the cutting mechanism 30, the clamping mechanism 10 is pressed down again. The squeezing component 41 squeezes the liquid collection tube 21 to release liquid. When the reaction liquid in the liquid collection tube 21 flows through the sample pad 433, the reaction liquid will flow along the test strip 432. The result will be displayed on the display area of the test strip 432.
[0401] Table 1 LAMP reactants in the liquid collection tube
[0402] Concentration Volume (μL) LAMP reaction master mix (NEB) 2X 10 LAMP Primer and probe Mix 10x 2.5 [dH2O] - 17.5 Total amount - 20
[0403]
result
[0404] refer to Figure 55Since the probes of FAM and biotin are inserted into the double-stranded product during amplification, the antibodies on the detection zone of the nucleic acid chromatography test paper can trap the product, showing a red colloidal gold aggregation zone, so the result of the positive amplification product should present two bands on the test strip, while the negative is one band. As can be seen from the figure, after the enrichment of the new coronavirus pseudovirus by the device, after LAMP amplification, two obvious bands appear on the test strip, while other test strips (Staphylococcus aureus (ATCC6538), Streptococcus pneumoniae (ATCC49619), Streptococcus hemolyticus (CMCC32210), Bordetella pertussis (ATCC 9340) and negative control) have only one band, proving that the detection system of the present application can realize the enrichment of the target substance new coronavirus pseudovirus and detection.
[0405] The present application has been described in detail above with general description and specific embodiments, but some modifications or improvements can be made on the basis of the present application, and any combination can be made according to the needs, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.
Claims
1. A detection device, characterized in that, include: A clamping mechanism, wherein a heating chamber is provided inside the clamping mechanism, a first through mounting port is provided at the top of the heating chamber, and a heating component is provided in the heating chamber; A sealing mechanism is located below the clamping mechanism. The sealing mechanism includes a through hole that extends through the sealing mechanism in a first direction. The through hole cooperates with the first mounting port to accommodate a liquid-containing tube. The inner wall of the liquid-containing tube near the port is provided with a phase change material. A cutting mechanism is located within the through hole and is configured to contact and cut the liquid-holding tube when the clamping mechanism is pressed down in the first direction. as well as The detection mechanism is located on the side of the cutting mechanism away from the clamping mechanism and is sealed to the sealing mechanism.
2. The detection device according to claim 1, characterized in that, The side wall of the heating chamber is also provided with a through groove extending along the first direction, and the sealing mechanism is provided with a guide post extending along the first direction. The through groove and the guide post are correspondingly arranged and adapted to be embedded in the through groove when the clamping mechanism is pressed down along the first direction.
3. The detection device according to claim 1 or 2, characterized in that, An elastic support component is provided at the upper end of the through hole.
4. The detection device according to any one of claims 1-3, characterized in that, The upper end of the through hole is provided with a first elastic sealing ring, and a support component is provided on the first elastic sealing ring.
5. The detection device according to any one of claims 1-4, characterized in that, The heating chamber further includes a second sidewall and a third sidewall disposed opposite to each other. The second sidewall and / or the third sidewall are provided with a first groove. The first groove extends from the side of the clamping mechanism near the sealing mechanism along the first direction through at least a portion of the second sidewall and / or the third sidewall.
6. The detection device according to claim 5, characterized in that, The sealing mechanism further includes a limiting block, which is disposed corresponding to the first groove and is adapted to be embedded in the first groove when the clamping mechanism is pressed down along the first direction.
7. The detection device according to any one of claims 1-6, characterized in that, The sidewall of the sealing mechanism is also provided with buckles spaced apart along the first direction. The bottom of the sidewall of the clamping mechanism forms a first flange facing the inside of the clamping mechanism. The buckles are configured to cooperate with the first flange to restrict the clamping mechanism from moving upward when the clamping mechanism is pressed down along the first direction.
8. A detection system, characterized in that, The detection device includes any one of claims 1-7.
9. The detection system according to claim 8, characterized in that, It also includes a sample processing device, which is connected to the detection device.
10. The detection system according to claim 9, characterized in that, The sample processing device includes: A push rod, the push rod including a proximal operating part, a distal sealing part, and a collection part located on the side of the distal sealing part away from the proximal operating part; A cylindrical body, wherein the inner wall of the cylindrical body is sealably fitted with the distal sealing part, and the inner wall of the cylindrical body and the push rod are movable relative to each other; one end of the cylindrical body is provided with a push rod inlet, and the other end of the cylindrical body is provided with a collection part outlet; a sealing layer is provided at the collection part outlet; the sealing layer is configured such that when the push rod is pushed until the collection part contacts the sealing layer, the push rod is further pushed, and the collection part can penetrate the sealing layer; and A target substance enrichment layer is disposed within the cylinder and adjacent to the outlet of the collection section. The collection section has a peeling section at its end away from the proximal operating section. The peeling section is configured to peel off the target substance enrichment layer and carry it out of the cylinder when the collection section penetrates the sealing layer by pushing the push rod, transferring the target substance enrichment layer to the liquid collection tube of the detection device. Alternatively, the target substance enrichment layer is disposed on the side of the collection section away from the proximal operating section, and is configured to be carried out of the cylinder by the collection section when the collection section penetrates the sealing layer by pushing the push rod, transferring the target substance enrichment layer to the liquid collection tube of the detection device.
Citation Information
Patent Citations
Apparatus and methods for integrated sample preparation, reaction and detection
CN103221529A
Inspection device
CN111492049A
Nucleic acid chromatography detection kit
CN117535133A
Thermocycler seal composition, method, and application
US20120045799A1
Polymerase chain reaction container and methods of using the same
US5576197A