Method for improving activity of 5-enolacetone shikimoyl-3-phosphate synthase and application of 5-enolacetone shikimoyl-3-phosphate synthase

Abstract

The invention relates to a method for improving the activity of 5-enolacetone shikimoyl-3-phosphate synthase and application of the 5-enolacetone shikimoyl-3-phosphate synthase. Specifically, the invention relates to a method for improving the activity of 5-enolacetone shikimic acyl-3-phosphate synthase, a protein with the activity of 5-enolacetone shikimic acyl-3-phosphate synthase, a gene for coding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, and an application of the transformant in preparation of 5-enolacetone shikimic acyl-3-phosphate synthase in preparation of 5-enolacetone shikimic acyl-3-phosphate synthase. The invention relates to a method for preparing 5-enol acetone shikimic acyl-3-phosphate synthase and application of the 5-enol acetone shikimic acyl-3-phosphate synthase in the aspect of glyphosate resistance, in particular to a method for preparing the 5-enol acetone shikimic acyl-3-phosphate synthase. The 5-enol acetone shikimic acyl-3-phosphate synthase disclosed by the invention has relatively strong glyphosate resistance, and the glyphosate resistance is 3 times that of a wild type 5-enol acetone shikimic acyl-3-phosphate synthase. The target plant is endowed with relatively high glyphosate tolerance.

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, specifically to a method for improving the activity of 5-enolpyruvate shikimyl-3-phosphate synthase, a protein having 5-enolpyruvate shikimyl-3-phosphate synthase activity, a gene encoding the protein, a recombinant vector with the gene inserted, a transformant containing the gene, a method for preparing 5-enolpyruvate shikimyl-3-phosphate synthase, and the application of 5-enolpyruvate shikimyl-3-phosphate synthase in glyphosate resistance. Background Technology

[0002] Glyphosate is one of the most widely used herbicides in the world. Studies have found that glyphosate competitively binds to EPSPs (5-enolpyruvate-3-phosphate synthase, EPSP synthase), thereby blocking the shikimic acid metabolic pathway. This prevents plants from synthesizing aromatic amino acids and their derivatives, leading to shikimic acid accumulation and ultimately plant death. Since most plant EPSP synthases in nature are glyphosate-sensitive, glyphosate herbicides have excellent broad-spectrum activity. However, the diversity of microbial communities in nature leads to the diversity of EPSP synthases in microorganisms. Some microorganisms have EPSP synthases that are insensitive to glyphosate. By using genetic engineering to transfer glyphosate-insensitive EPSP synthases into target plants to replace endogenous sensitive EPSP synthases, glyphosate resistance can be acquired in these plants.

[0003] The research and development of glyphosate-resistant transgenic plants can greatly promote agricultural development. Studies have shown that the expression capacity of EPSP synthase-encoding genes (aroA) varies among different plants, resulting in varying glyphosate herbicide tolerance in the recipient plants. Increasing the diversity of glyphosate-resistant genes can improve the success rate of herbicide-resistant biotechnology breeding. However, the resources of excellent glyphosate-resistant genes are limited and cannot meet the current agricultural market demand. Therefore, the development of glyphosate-resistant 5-enolpyruvate-3-phosphate synthase has significant research value and application prospects in agriculture. Summary of the Invention

[0004] To further meet the needs of practical applications, this disclosure provides a method for improving the activity of 5-enolpyruvate shikimyl-3-phosphate synthase, a protein having 5-enolpyruvate shikimyl-3-phosphate synthase activity, a gene encoding the protein, a recombinant vector with the gene inserted, a transformant containing the gene, a method for preparing 5-enolpyruvate shikimyl-3-phosphate synthase, and the application of 5-enolpyruvate shikimyl-3-phosphate synthase in glyphosate resistance.

[0005] To achieve the above objectives, the first aspect of this disclosure provides a method for improving the activity of 5-enolpyruvate shikimic acid-3-phosphate synthase, the method comprising mutating three amino acid residues of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase, the amino acid sequence of which is shown in SEQ ID NO.2, and the amino acid residues to be mutated including tyrosine residue at position 40, phenylalanine residue at position 114, and serine residue at position 358; the mutation is a substitution of amino acid residues.

[0006] Optionally, the mutation modification includes: mutating the 40th tyrosine residue to an isoleucine residue, mutating the 114th phenylalanine residue to a serine residue, and mutating the 358th serine residue to a threonine residue.

[0007] The second aspect of this disclosure provides a protein having 5-enolpyruvate shikimic acid-3-phosphate synthase activity, wherein the protein is formed by mutating three amino acid residues of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase, the amino acid sequence of which is shown in SEQ ID NO.2, and the amino acid residues to be mutated include tyrosine residue at position 40, phenylalanine residue at position 114, and serine residue at position 358; the mutation is a substitution of amino acid residues.

[0008] Optionally, the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0009] This disclosure provides a third aspect of a gene encoding the protein described in the second aspect, said gene being a DNA molecule with the nucleotide sequence shown in SEQ ID NO.3.

[0010] The fourth aspect of this disclosure provides a recombinant vector, which is a recombinant expression vector, wherein the recombinant vector is inserted with the gene described in the third aspect.

[0011] The fifth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the gene described in the third aspect, or the recombinant vector described in the fourth aspect is introduced into the transformant.

[0012] Optionally, the genetically engineered bacteria are selected from one of Escherichia coli, Bacillus subtilis, Rhizobium, Pseudomonas, and Azotobacter spp.

[0013] The sixth aspect of this disclosure provides a method for preparing 5-enolpyroxanone shikimic acid synthase, the method comprising: inoculating the transformant described in the fifth aspect into a culture medium for culturing to obtain the cultured material.

[0014] The seventh aspect of this disclosure provides the use of 5-enolpyruvate shikimyl-3-phosphate synthase in glyphosate resistance, wherein the 5-enolpyruvate shikimyl-3-phosphate synthase contains the protein described in the second aspect.

[0015] Through the above technical solutions, this disclosure provides a method for improving the activity of 5-enolpyruvate-shikimyl-3-phosphate synthase, a protein with 5-enolpyruvate-shikimyl-3-phosphate synthase activity, a gene encoding the protein, a recombinant vector with the gene inserted, transformation of the transformant containing the gene, a method for preparing 5-enolpyruvate-shikimyl-3-phosphate synthase, and the application of 5-enolpyruvate-shikimyl-3-phosphate synthase in glyphosate resistance. The 5-enolpyruvate-shikimyl-3-phosphate synthase of this disclosure exhibits strong glyphosate resistance, three times that of wild-type 5-enolpyruvate-shikimyl-3-phosphate synthase. This confers higher glyphosate tolerance to target plants.

[0016] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:

[0018] Figure 1 This is a graph showing the tolerance of mutant strain G79M3 to glyphosate; where (a) represents a glyphosate concentration of 0 mM, (b) represents a glyphosate concentration of 200 mM, (c) represents a glyphosate concentration of 300 mM, and (d) represents a glyphosate concentration of 400 mM.

[0019] Figure 2 This is an SDS-PAGE electrophoresis image of GR79 protein expression and purification.

[0020] Figure 3 This is an SDS-PAGE electrophoresis image of G79M3 protein expression and purification.

[0021] Figure 4 It is the inorganic phosphorus standard curve. Detailed Implementation

[0022] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0023] The first aspect of this disclosure provides a method for improving the activity of 5-enolpyruvate shikimic acid-3-phosphate synthase, the method comprising mutating three amino acid residues of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase, the amino acid sequence of which is shown in SEQ ID NO.2, and the amino acid residues to be mutated including tyrosine residue at position 40, phenylalanine residue at position 114, and serine residue at position 358; the mutation is a substitution of amino acid residues.

[0024] In one embodiment, the mutation modification includes: mutating the 40th tyrosine residue to an isoleucine residue, mutating the 114th phenylalanine residue to a serine residue, and mutating the 358th serine residue to a threonine residue.

[0025] In this disclosure, the inventors have surprisingly discovered that the mutant strain (G79M3) with the 40th tyrosine residue mutated to an isoleucine residue, the 114th phenylalanine residue mutated to a serine residue, and the 358th serine residue mutated to a threonine residue exhibits better glyphosate resistance than the wild-type EPSP synthase (GR79), and can confer higher glyphosate tolerance to target plants. G79M3 has good application prospects in agriculture.

[0026] The second aspect of this disclosure provides a protein having 5-enolpyruvate shikimic acid-3-phosphate synthase activity, wherein the protein is formed by mutating three amino acid residues of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase, the amino acid sequence of which is shown in SEQ ID NO.2, and the amino acid residues to be mutated include tyrosine residue at position 40, phenylalanine residue at position 114, and serine residue at position 358; the mutation is a substitution of amino acid residues.

[0027] According to this disclosure, the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0028] This disclosure provides a third aspect of a gene encoding the protein described in the second aspect, said gene being a DNA molecule with the nucleotide sequence shown in SEQ ID NO.3.

[0029] The fourth aspect of this disclosure provides a recombinant vector, which is a recombinant expression vector, wherein the recombinant vector is inserted with the gene described in the third aspect.

[0030] The fifth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the gene described in the third aspect, or the recombinant vector described in the fourth aspect is introduced into the transformant.

[0031] According to this disclosure, the genetically engineered bacteria can be wild-type or artificially modified. In one embodiment, the genetically engineered bacteria are selected from one of *Escherichia coli*, *Bacillus subtilis*, *Rhizobium*, *Pseudomonas*, and *Azotobacter*. Preferably, the genetically engineered bacteria can be *Escherichia coli* BL21(DE3) competent cells or *Escherichia coli* ER2799 competent cells. *Escherichia coli* is an ideal strain for heterologous protein expression.

[0032] The sixth aspect of this disclosure provides a method for preparing 5-enolpyroxanone shikimic acid synthase, the method comprising: inoculating the transformant described in the fifth aspect into a culture medium for culturing to obtain the cultured material.

[0033] According to this disclosure, the culture medium for inoculating the transformant can be one commonly used by those skilled in the art, such as M9 medium, LB medium, or YPD medium. Preferably, IPTG can be added to the culture medium to induce protein expression.

[0034] The seventh aspect of this disclosure provides the use of 5-enolpyruvate shikimyl-3-phosphate synthase in glyphosate resistance, wherein the 5-enolpyruvate shikimyl-3-phosphate synthase contains the protein described in the second aspect.

[0035] The present disclosure will be further illustrated by the following examples, but the present disclosure is not limited thereto.

[0036] Unless otherwise specified, all experimental conditions in this disclosure are based on conventional conditions known to those skilled in the art or conditions recommended by the manufacturer.

[0037] Example 1

[0038] This example illustrates the construction of recombinant Escherichia coli ER2799pAGR79.

[0039] This study used adaptive laboratory evolution (ALE) technology to optimize the glyphosate resistance gene (i.e., wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase, named GR79, amino acid sequence as shown in SEQ ID NO.2; gene named GR79-aroA, nucleotide sequence as shown in SEQ ID NO.4, this enzyme is described in patent CN101429499A) from the metagenomics of contaminated soil (pesticide factory area in Jinzhou City, Hebei Province).

[0040] The genetically engineered bacterium was Escherichia coli DH5α; the vector was the constitutive low-copy vector pACYC184.

[0041] The GR79-aroA gene was ligated into the vector pACYC184, which was double-digested with Sal I and BamHI. Primers containing the homologous arm of pACYCY184 were designed to amplify the gene fragment.

[0042] Forward primer pA GR79-aroA -F:

[0043] CCACACCCGTCCTGTGGATCCATGTCACATTCTACCTCTAGGTCCC;

[0044] Reverse primer pA GR79--aroA -R:

[0045] CTCTCAAGGGCATCGGTCGACTTAATTATACTCCACATGTATTCCAA ACTT.

[0046] Then, using homologous recombination, the pACYC184 fragment, double-digested with Sal I and BamHI, was recombined with the amplified gene fragment to construct plasmid pAGR79, which was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing the antibiotic chloramphenicol (Cm). Single colonies grown on the plates were picked and amplified by PCR using single colonies as templates, followed by agarose gel electrophoresis to detect the target band. The GR79-aroA gene fragment size was 1338 bp. The size of the amplified gene fragment of the recombinant vector was consistent with the size of the respective positive controls and met the expected size. The successfully validated recombinant plasmid was sequenced, and the correct recombinant plasmid was selected for subsequent experiments. The correctly constructed recombinant vector was transformed into *E. coli* ER2799 competent cells with the aroA gene deficiency, which were prepared in our laboratory, to construct recombinant *E. coli* ER2799pAGR79, which was then plated on M9 medium containing Cm antibiotic for laboratory adaptation evolution and glyphosate resistance assays.

[0047] Example 2

[0048] This example illustrates the screening of the mutant strain G79M3.

[0049] 1. Draw the growth curve:

[0050] ER2799pAGR79 was plated on M9 solid medium and incubated overnight at 37°C. Three single colonies from each plate were picked and inoculated into M9 liquid medium containing 200, 150, and 0 mM glyphosate (Gly), respectively, and incubated at 37°C and 220 rpm until the growth plateau phase. A turbidimetric method was used to plot the growth curve with the OD600 value of the culture medium at each stage on the ordinate and the incubation time on the abscissa.

[0051] 2. Laboratory evolution and calculation of generation time:

[0052] Take a segment of the logarithmic growth period and calculate the generation time using the formula.

[0053] g = t × ln2 / (lnMt - lnMo); where g is the generation time; t is the culture time; Mo is the initial number of viable cells; and Mt is the number of viable cells after culture time t.

[0054] Select single colonies that have been successfully validated for adaptive laboratory evolution experiments:

[0055] (1) Select the successfully verified ER2799pAGR79 and inoculate it into M9 liquid medium containing 200mM glyphosate. Incubate at 37℃ and 220rpm in the dark for 20-24h (each sample has three replicates).

[0056] (2) After culturing, the strain was transferred at 1% into 50 mL of M9 liquid containing 200 mM glyphosate and cultured for a longer period of time. Repeat the above operation.

[0057] During the transfer process, collect the bacterial culture before and after culture, according to 10 -4 10 -6 After serial dilution, 100 μL of bacterial culture was spread onto M9 solid medium containing Cm and incubated at 37°C. The number of single colonies was then counted to calculate the age time.

[0058] (3) Thereafter, transfer the culture medium every 24 hours to ensure the nutrition in the culture medium.

[0059] (4) Before each transfer, take a 750uL sample and add 25uL of 75% glycerol, mix well, and store at -80℃.

[0060] (5) Selected strains that evolved over approximately 2000 generations were used for sequencing analysis.

[0061] ER2799pAGR79 was subjected to ALE experiments under glyphosate selection pressure. After approximately 2000 generations, samples were plated on M9 solid medium containing 250 mM glyphosate and cultured. Single strains with good growth were selected for sequencing analysis. The results showed that multiple mutants were obtained after 2000 generations of evolution, among which the recombinant *E. coli* containing the three-point mutation gene plasmid exhibited outstanding resistance to glyphosate. The mutant enzyme was named G79M3, and the amino acid sequence of G79M3 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.3.

[0062] Example 3

[0063] This example illustrates the resistance analysis of G79M3 to glyphosate.

[0064] The growth curves of recombinant Escherichia coli ER2799 strains containing pAG79M3 plasmid and pAGR79 plasmid were determined in M9 medium containing different concentrations of glyphosate (0, 200, 300, 400 mM glyphosate) to evaluate the tolerance of mutant enzymes to glyphosate.

[0065] ER2799 and recombinant strains containing plasmids pACYC184 (ER184), pAGR79 (ER79), and pAG79M3 (ER79M3) were plated on M9 solid medium and incubated overnight at 37°C. Three single colonies from each plate were inoculated into M9 liquid medium containing 0, 200, 300, and 400 mM Gly, respectively, and incubated at 37°C and 220 rpm until the plateau phase. A turbidimetric method was used to plot the OD600 values ​​of the culture medium at each incubation stage on the ordinate and the incubation time on the abscissa to generate growth curves. The results are shown below. Figure 1 As shown.

[0066] Because ER2799 cells lack the aroA gene, they cannot synthesize aromatic amino acids autonomously, and therefore cannot grow on M9 medium, which lacks aromatic amino acids. Figure 1 (a), (b), (c), and (d) are growth curves of the mutant strains in M9 medium containing 0, 200, 300, and 400 mM glyphosate, respectively.) It can be seen that ER2799 and the recombinant strain transformed with the empty vector ER184 did not grow in any of the four media. The recombinant strains transformed with the GR79-EPSPS(ER79) and G79M3-EPSPS(ER79M3) plasmids could both grow in M9 medium containing 200 mM glyphosate, with ER79M3 showing significantly better growth than ER79. However, in M9 medium containing 300 mM glyphosate, only ER79M3 could grow. This indicates that G79M3 conferred higher glyphosate tolerance on the host cells.

[0067] Example 4

[0068] This embodiment illustrates the construction of the G79M3 expression vector.

[0069] Primers containing homologous arms were designed to amplify the target fragment using pAGR79 and pAG79M3 plasmids as templates.

[0070] Forward primer:

[0071] CCACACCCGTCCTGTGGATCCATGTCACATTCTACCTCTAGGTCCC;

[0072] Reverse primer:

[0073] CTCTCAAGGGCATCGGTCGACTTAATTATACTCCACATGTATTCCAA ACTT.

[0074] The plasmid vector (pET28a) was then double-digested with EcoRI and XhoI. Following the single-fragment homologous recombination method of Novizan, the target fragment and the digested plasmid were recombined. The recombinant plasmids pETGR79 and pETG79M3 were transformed into BL21 E. coli competent cells, and the cell mixture was evenly spread on Kan-resistant solid LB medium. Single colonies were picked for colony PCR verification and amplification. Successfully transformed recombinant strains were amplified and preserved on slant culture or in low-temperature glycerol tubes.

[0075] Example 5

[0076] This example illustrates the expression and purification of the G79M3 protein.

[0077] The validated transformed strains were streaked onto Kans resistance plates and incubated overnight at 37°C. Single colonies were picked and cultured overnight at 37°C and 220 rpm in 20 mL of liquid medium. The culture was then transferred at 2% volume to 150 mL of LB medium and cultured until the OD600 reached approximately 0.5–0.7. IPTG (final concentration 0.85 mM) was added, and the culture was incubated at 16°C for 16–20 h to induce protein expression.

[0078] The specific steps for protein purification are as follows:

[0079] (1) Transfer 150 mL of bacterial culture induced overnight at 16℃ to a 50 mL centrifuge tube, centrifuge at 4℃, 4000×g for 15 min, and collect the bacterial cells.

[0080] (2) After discarding the supernatant, add 10 mL of Lysis buffer cell lysis buffer and 10 μL of protease inhibitor, resuspend the bacterial cells and take a sample, which is recorded as whole bacterial protein.

[0081] (3) The cells were disrupted using an ultrasonic disruptor at a power of 25W and a frequency of 2-3 seconds per 2-second interval, for a total disruption time of 3 minutes. The disruption time could be extended appropriately to allow the bacterial solution to become clear. After the disruption was completed, the bacterial solution became darker in color, and a sample was taken and recorded as precipitated protein P.

[0082] (4) Add the broken bacterial culture to an EP tube, centrifuge at 14000×g for 15 min at 4℃, take the supernatant and add it to a test tube, place it on ice for purification. Take a sample and record it as supernatant protein S.

[0083] (5) Preparation and equilibration of affinity chromatography column: Add 3 mL of Ni-NTA resin to the chromatography column, let stand for 30 min, then elute with 10 times the resin volume of ddH2O, and then equilibrate with 10 times the resin volume of equilibration buffer (i.e., solution A). When reused, it is still necessary to elute with ddH2O first to remove alcohol.

[0084] (6) Slowly add the supernatant protein after centrifugation to the chromatography column, controlling the flow rate at the bottom of the column so that the liquid permeating the column flows out slowly. After the remaining buffer in the column has flowed out, collect the permeate in an Erlenmeyer flask, take 1 mL of the permeate and store it at 4°C for later analysis, and record it as FT. Then pour the remaining liquid back into the column and pass it through the column again.

[0085] (7) Using solutions A and B as mother solutions, prepare imidazole with a final concentration of 500 mM, and then dilute it to eluents with concentrations of 0 mM, 10 mM, 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, 150 mM and 200 mM respectively.

[0086] (8) Collect proteins by adding different gradients of elution buffer sequentially. During this process, use 500 μL of Coomassie Brilliant Blue staining solution to check the protein concentration at intervals until the elution buffer no longer turns blue, indicating that elution is complete. Sample each gradient using a 50 mL centrifuge tube.

[0087] (9) Take a small amount of sample and add 10× Loading Buffer, mix well, boil in boiling water for 10 min, and centrifuge at 12000×g for 1 min. Take 10 μL for SDS-PAGE electrophoresis, and the results are as follows. Figure 2 and 3 As shown.

[0088] exist Figure 2 and 3 In the diagram, M represents Prestained Protein Ladder 1, 1 represents whole bacterial protein, 2 represents precipitated protein P, 3 represents supernatant protein S, 4 represents flow-through FT, and 5-13 represent imidazole elution buffers at concentrations of 10mM, 20mM, 40mM, 60mM, 80mM, 100mM, 150mM, 200mM, and 500mM, respectively. The red lines indicate the induced target protein bands. Figure 2 and 3 It can be seen that both GR79 and G79M3 proteins are induced to express, with a size of approximately 45 kDa. The optimal elution concentration of imidazole for GR79 is 80 mM. Figure 2 The optimal elution concentration of imidazole for G79M3 is 60 mM. Figure 3 The eluted protein was desalted and purified, then stored at -80°C for later use.

[0089] Example 6

[0090] This example illustrates the enzymatic kinetics analysis of the G79M3 mutant.

[0091] The experimental method in this study was based on the literature (He, M., Yang, ZY, Nie, YF, et al. A new type of class I bacterial 5-enopyruvylshikimate-3-phosphate synthase mutants with enhanced tolerance to glyphosate. Biochim Biophys Acta, 2001, 1568(1):1-6), and the specific procedures are as follows:

[0092] (1) Inorganic phosphorus standard curve: 10 mM inorganic phosphorus standard solution was diluted 1:10. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 μl were respectively placed in 1.5 ml Eppendorf centrifuge tubes. Milli-Q pure water was added to a final volume of 100 μl and mixed well. 0.8 ml of MAT solution was added and mixed well. After three minutes, 100 μl of 34% SC solution was added and mixed rapidly. The mixture was allowed to stand at room temperature for 20 minutes before measuring the OD660 value. This was repeated three times. Figure 4 The inorganic phosphorus standard curve was obtained by plotting the inorganic phosphorus concentration on the x-axis and the OD660 value on the y-axis.

[0093] (2) Enzyme activity assay: Protein quantification of crude enzyme extract was performed using the Coomassie Brilliant Blue G-250 staining method (Bradford, 1976). The following solutions were added to a 1.5 ml Eppendorf centrifuge tube on ice: 2 μl of 10 mM MPEP solution, 2 μl of 10 mM S3P solution, 2 μl of 0.5 M HEPES solution, and 1 mM (NH4)6MO7O. 24 Mix 2 μl of 4H₂O solution and 12 μl of milli-Q pure water. Incubate at 28°C for 5 min. Add 1 μl of crude enzyme solution to each sample tube at 2-second intervals and start timing. After 2 min, add 200 μl of MAT solution sequentially at 2-second intervals. After 3 min of color development, add 20 μl of 34% SC solution sequentially at 2-second intervals and mix rapidly. After 20 min of color development at room temperature, measure the OD660 value. The control tubes are prepared identically except for the absence of enzyme solution. Subtract the OD660 values ​​of the sample tubes from those of the control tubes. The amount of inorganic phosphorus released in the reaction can be determined by comparing the inorganic phosphorus standard curve. Dividing this by the reaction time and the amount of enzyme protein yields the enzyme activity (U / mg).

[0094] Km(PEP) determination: The concentration of S3P solution was kept constant at 1 mM. The enzyme reaction rate was determined according to the above reaction system at different PEP concentrations (0.05, 0.067, 0.1, 0.2, 0.5, 1.0 mM). The measured values ​​were plotted according to the Vv / [S] (Eadic-Hofstee) method.

[0095] Ki (glyphosate) determination: The enzymatic reaction rate of EPSPS was determined at different glyphosate concentrations (0, 10, 50, 100 μM) with PEP concentrations of 66.7, 100, 200, and 500 μM. A double logarithmic plot was used to obtain the 1 / V - 1 / [S] line. The slope of each line was then used as the ordinate, and the glyphosate concentration as the abscissa to obtain a new line. The intersection of this new line with the X-axis is the Ki (glyphosate) value.

[0096] The results are shown in Table 1.

[0097] Table 1 Enzyme kinetic parameters of GR79 and G79M3.

[0098] EPSPS source <![CDATA[IC 50 (mM)]]> Km[PEP](μM) Vmax (U / mg) Ki[glyphosate](μM) Ki / Km GR79 6.8685±1.3785 39.341±3.21 9.285±0.223 75.360±5.029 1.916 G79M3 14.975±2.820 21.212±2.675 22.416±0.811 129.744±12.331 6.117

[0099] IC50 is the half-inhibition concentration, which is the concentration of a drug compound required to inhibit the activity of an enzyme in a specified biological process by half. Km is the Michaelis constant, which measures the affinity between an enzyme and its substrate. The smaller the Km, the lower the substrate concentration required for the enzyme to react; in other words, the greater the affinity between the enzyme and its substrate. Vmax is the maximum reaction rate. Ki is the kinetic inhibition rate constant, which reflects the binding affinity between the inhibitor and the enzyme. The smaller this value, the stronger the inhibitory effect. The Ki / Km ratio reflects the competitive relationship between the enzyme, substrate, and inhibitor. The larger this value, the weaker the inhibitor's ability to compete for the enzyme's active site, and the less the enzyme is affected by the inhibitor.

[0100] As shown in Table 1, the measurement results indicate that the IC50 value of GR79 is 6.8685±1.3785 mM, while the IC50 value of G79M3 is 14.975±2.820 mM. The IC50 of G79M3 is approximately twice that of GR79, indicating that the mutant G79M3 increases the glyphosate resistance of wild-type GR79.

[0101] The Km of GR79 was 39.341 ± 3.21 μM, and the Vmax was 9.285 ± 0.223 U / mg; the Km of G79M3 was 21.212 ± 2.675 μM, and the Vmax was 22.416 ± 0.811 U / mg. This indicates that the Km of the mutant G79M3 is decreased, while its substrate affinity is increased.

[0102] The Ki value of GR79 synthase was 75.360±5.029μM, while the Ki value of G79M3 was 129.744±12.331μM, indicating that the mutant G79M3 has a lower binding capacity to glyphosate than the original enzyme GR79.

[0103] The Ki / Km ratio directly reflects the enzyme's glyphosate resistance. G79M3 has a Ki / Km ratio of 6.117, while GR79 has a Ki / Km ratio of 1.916. The mutant G79M3 has a Ki / Km ratio three times that of the wild-type GR79, indicating a significant increase in glyphosate resistance. Intracellular expression of G79M3 will confer high glyphosate tolerance to the host.

[0104] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0105] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0106] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A method for improving the activity of 5-enolpyruvate shikimic acid-3-phosphate synthase, the method comprising mutating three amino acid residues of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase, characterized in that, The amino acid sequence of the wild-type 5-enolpyruvate shikimic acid synthase is shown in SEQ ID NO.

2. The amino acid residues to be mutated include tyrosine residue at position 40, phenylalanine residue at position 114, and serine residue at position 358. The mutation is a substitution of amino acid residues.

2. The method according to claim 1, wherein, The mutation modification includes: mutating the 40th tyrosine residue to an isoleucine residue, mutating the 114th phenylalanine residue to a serine residue, and mutating the 358th serine residue to a threonine residue.

3. A protein having 5-enolpyruvate shikimic acid-3-phosphate synthase activity, characterized in that, The protein is produced by mutating three amino acid residues of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase. The amino acid sequence of wild-type 5-enolpyruvate shikimic acid-3-phosphate synthase is shown in SEQ ID NO.

2. The amino acid residues to be mutated include tyrosine residue at position 40, phenylalanine residue at position 114, and serine residue at position 358. The mutation is a substitution of amino acid residues.

4. The protein according to claim 3, wherein, The amino acid sequence of the protein is shown in SEQ ID NO.

1.

5. A gene encoding the protein of claim 4, characterized in that, The gene is a DNA molecule with the nucleotide sequence shown in SEQ ID NO.

3.

6. A recombinant vector, characterized in that, The recombinant vector is a recombinant expression vector, and the recombinant vector is inserted with the gene described in claim 5.

7. A transformant, characterized in that, The host of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the gene described in claim 5, or the recombinant vector described in claim 6 is introduced into the transformant.

8. The transformant according to claim 7, wherein, The genetically engineered bacteria are selected from one of Escherichia coli, Bacillus subtilis, Rhizobium, Pseudomonas, and brown azotobacter.

9. A method for preparing 5-enolpyruvate shikimic acid-3-phosphate synthase, characterized in that, The method includes: inoculating the transformant according to claim 7 into a culture medium for cultivation to obtain the cultured material.

10. The application of a 5-enolpyruvate shikimic acid-3-phosphate synthase in glyphosate resistance, characterized in that, The 5-enol acetone shikimic acid-3-phosphate synthase contains the protein described in claim 3 or 4.

Images