Fluorescence report system for evaluating repair efficiency of homologous mediated DNA (deoxyribonucleic acid) in rice cells

Abstract

The invention discloses a fluorescence report system for evaluating homologous mediated DNA (deoxyribonucleic acid) repair efficiency in rice cells. According to the reporting system, plasmids for coding CRISPR / Cas and repairing template DNA are delivered into rice cells, so that a nucleotide sequence for coding a fluorescent protein gene is inserted into the tail end of a coding region of a rice histone gene OsH2B (LOCOs01g62230) with high expression quantity at a fixed point through a homologous mediated DNA repairing mechanism, and frame-combined protein coding sequence fusion is formed; according to the method, the cells subjected to precise editing have the property of emitting fluorescence, the proportion of the cells emitting the fluorescence is detected by utilizing flow cytometry (FACS), and the homologous mediated DNA repair efficiency in the rice cells is calculated. The method effectively solves the technical bottlenecks of high cost, long period and complex analysis in evaluation of editing efficiency depending on deep sequencing, can be used for developing a precise gene editing technology based on homologous mediation DNA repair and the like, and has the characteristics of low cost, short period, simplicity and convenience in analysis and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology. More specifically, it relates to a fluorescent reporter system for evaluating the efficiency of homology-directed DNA repair in rice cells. BACKGROUND

[0002] Gene editing is a disruptive technology that precisely modifies specific sites in the genome of an organism, and has a wide range of applications in crop breeding, biomedicine, food engineering, etc. In order to achieve gene editing at a target site with a specific nucleotide sequence in the genome of an organism, a sequence-specific nuclease (SSN) tool is usually used to cause a double-stranded DNA break at the selected genomic target site, and to change the nucleotide sequence near the break during DNA repair. Non-homologous end joining (NHEJ) and homology-directed repair (HDR) are two common DNA repair mechanisms in eukaryotic cells. Compared with NHEJ, the HDR pathway relies on a DNA repair template, and the repair result is predictable and more accurate, but the repair efficiency of HDR is lower than that of NHEJ.

[0003] In the case of providing a specific donor DNA molecule that carries the target nucleotide sequence and can serve as a repair template, the HDR pathway can be manipulated to achieve precise and targeted gene editing, including precise deletion, insertion, substitution of single or multiple nucleotides, and site-directed insertion or substitution of large fragments of DNA, etc. Therefore, the precise editing method based on HDR can create various types of genetic variations, and has a wide range of applications. However, the low efficiency of HDR in eukaryotic cells limits the widespread application of precise editing strategies based on HDR in gene editing. In order to better utilize the HDR pathway to achieve efficient precise editing in target organisms, developing techniques and methods to improve the efficiency of HDR is currently a hot topic in the field of gene editing research.

[0004] Rapid and accurate evaluation of the HDR efficiency in rice cells is the basis for improving the HDR efficiency in rice and establishing efficient and precise gene editing technology in rice. Although deep sequencing-based methods can evaluate the precision editing efficiency based on HDR in rice cells, such methods often face technical bottlenecks such as high cost, long cycle, and complex analysis. The reporter system described in the present application converts homology-mediated DNA precision repair events in rice cells into observable fluorescent signals, and uses flow cytometry (FACS) to detect the proportion of cells emitting fluorescence, and accurately calculates the HDR efficiency in rice, which has the characteristics of low cost, short cycle, and simple analysis, and provides key technical support for mining factors that can improve the HDR efficiency in rice cells. SUMMARY

[0005] The technical problem to be solved by the present application is to overcome the technical bottlenecks and deficiencies of existing deep sequencing-based HDR efficiency evaluation methods, such as high cost, long cycle, and complex analysis, and to provide a method for rapidly and accurately evaluating the HDR efficiency in rice cells.

[0006] The purpose of the present application is to provide a reporter system for detecting the HDR efficiency in rice cells, comprising designing and preparing CRISPR vectors and donor vectors for converting HDR events in rice cells into observable fluorescent signals, and delivering the above-mentioned vectors into rice protoplast cells and using flow cytometry (FACS) to evaluate the proportion of cells emitting fluorescence.

[0007] The above-mentioned object of the present application is achieved by the following technical solutions: The present application provides a CRISPR vector and a donor vector designed and prepared for converting HDR events in rice cells into observable fluorescent signals.

[0008] Specifically, the CRISPR vector encodes (1) SpCas9 protein derived from Streptococcus pyogenes, whose amino acid coding sequence is optimized for rice codons, driven by ZmUbi promoter from corn, and terminated by Nos terminator from Agrobacterium, and (2) sgRNA sequence that can target the end of the coding region of rice histone gene OsH2B (LOC_Os01g62230), driven by rice OsU6 promoter. The sgRNA target sequence is 5'-GTCTTAAGACGACGTGAACT-3' (SEQ ID NO. 1).

[0009] Specifically, the donor vector encodes an enhanced green fluorescent protein (eGFP) (SEQ ID NO.2) optimized with rice codons and lacking a start codon, and flanking the coding sequence are the left homologous arm sequence (SEQ ID NO.3) and right homologous arm sequence (SEQ ID NO.4) targeting sgRNA in the rice genome, respectively. After a DNA double-strand break occurs at the selected sgRNA target site, this donor vector can act as a repair template for the HDR pathway. Following repair, the nucleotide sequence encoding eGFP is fused to the end of the histone gene coding region within the same reading frame, resulting in the fused nucleotide sequence encoding the H2B-eGFP fusion protein, enabling the corresponding cells to emit fluorescence at the excitation wavelength.

[0010] Using the aforementioned vector, this invention provides a method for converting HDR events in rice cells into observable fluorescence signals. The method involves using rice protoplast cells as reporter cells, delivering the aforementioned CRISPR vector and donor vector into the reporter cells via polyethylene glycol (PEG)-mediated rice cell genetic transformation, and obtaining a cell population to be evaluated (population 1) after isothermal incubation. Simultaneously, to assess transformation efficiency, a vector encoding a fully enhanced green fluorescent protein gene expression cassette driven by the ZmUbi promoter from maize and terminated by the Nos terminator from Agrobacterium is delivered into the reporter cells via PEG-mediated rice cell genetic transformation, obtaining a cell population to be evaluated (population 2).

[0011] As an alternative implementation, the rice protoplast cells are derived from mesophyll cells of Nipponbare seedlings and prepared by treatment with cellulase and macrozyme.

[0012] As an alternative implementation method, after plasmid delivery, the temperature for isothermal incubation is 28 degrees Celsius for 48-72 hours.

[0013] Based on the aforementioned cell populations 1 and 2 to be evaluated, this invention provides a method for measuring the HDR efficiency of rice cells using flow cytometry. The method is as follows: for cell populations 1 and 2 respectively, the number of protoplast cells cultured for 48 hours is controlled to be above 1×10⁵ / mL, and live cells are delineated using the FSC / SSC channel of the flow cytometer. At the same time, the FITC (488nm laser) channel is used to calculate the number of fluorescent cells among the live cells.

[0014] Specifically, the percentage of fluorescent cells in cell population 1 reflects the proportion of cells that underwent HDR-based precision editing.

[0015] Specifically, the proportion of fluorescent cells in cell population 2 reflects the efficiency of PEG-mediated rice cell genetic transformation, i.e., the efficiency of plasmid delivery to reporter cells.

[0016] Based on the principle that “the proportion of fluorescent cells in population 1 = genetic transformation efficiency × HDR efficiency”, the HDR efficiency of the rice cell population to be tested is calculated as (the proportion of fluorescent cells in population 1) / (the proportion of fluorescent cells in population 2) × 100%.

[0017] The method described above for measuring the HDR efficiency of rice cells can be used to compare the effects of different experimental conditions on the HDR efficiency of rice cells, including screening for specific candidate factors that may affect the HDR efficiency of rice cells.

[0018] This invention offers the following advantages: By converting HDR events in rice cells into observable fluorescence signals and combining this with experimental techniques such as flow cytometry, it provides a method for measuring the HDR efficiency of rice cells that is low-cost, has a short operation cycle, and is easy to analyze. The gene targeted for editing in this invention is a histone gene with nuclear localization. Because of this nuclear localization, the subcellular localization of the fluorescence signal can be confirmed using fluorescence microscopy to determine the authenticity of the editing event. The fused eGFP coding sequence does not contain a start codon, significantly reducing false-positive fluorescence signals caused by the non-HDR integration of the eGFP coding sequence into the rice genome. Detailed Implementation

[0019] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0020] (1) Construction of H2B-HDR-eGFP donor vector: Using CRISPR-Cas9 technology, a green fluorescent protein expression gene (an enhanced version of rice codon-optimized green fluorescent protein) was inserted before the stop codon (TAA) of the OsH2B gene in Nipponbare rice protoplast cells. To distinguish the green fluorescence emitted by the cells as the result of precise editing, the start codon (ATG) of the green fluorescent protein expression gene was removed. To precisely integrate the eGFP coding sequence into the C-terminus of the OsH2B gene (before the stop codon), the sequence between the Cas9 target cleavage site and the stop codon in the OsH2B gene was supplemented before the eGFP sequence, and corresponding amino acid synonymous mutations were performed. Figure 1Upstream and downstream of the eGFP expression gene are homologous arms of approximately 350 bp, with sequences identical to those upstream and downstream of the Cas9 cleavage site. After Cas9 cleaves the target site, the cell initiates a homologous recombination repair mechanism, using the homologous fragment as a repair template to insert the eGFP expression gene into the C-terminus of OsH2B. A schematic diagram illustrating the principle of knocking in H2B-HDR-eGFP using CRISPR-Cas9 technology is shown below. Figure 1 As shown.

[0021] (2) Construction of CRISPR vector: The sgRNA sequence (sgRNA target site sequence: GTCTTAAGACGACGTGAACT, PAM is TGG) was cloned into the P1300 vector to construct the CRISPR vector. Among them, P1300 is a plasmid expressing SpCas9 and empty sgRNA.

[0022] (3) Evaluation of homology-mediated DNA repair efficiency in cells using a reporter system: Cas9-sgRNA vector (10 μg) and H2B-HDR-eGFP donor vector (10 μg) were transformed into 2.5 μg cells using polyethylene glycol-mediated DNA delivery technology. ×10⁶ cells / mL were collected from rice mesophyll protoplasts. The cells were cultured in the dark at 28°C for 48 hours, and then observed under a fluorescence microscope. The fluorescence efficiency of the plant cells was statistically analyzed using flow cytometry (FACS). Figure 2 This image shows the cellular fluorescence of rice protoplasts during precise insertion. Due to the precise insertion of eGFP, the green fluorescent protein fuses with histones for expression, and the expressed green fluorescence is localized in the cell nucleus. Figure 3 The results of cell fluorescence ratio analysis were performed using flow cytometry (FACS). Statistical analysis showed that the fluorescence efficiency of cells expressing only the eGFP gene was 73%, indicating a transformation efficiency of 73%. The average HDR efficiency at the OsH2B target site for the combination of CRISPR vector and donor vector expression was approximately 2.8%. Therefore, the HDR efficiency of the tested rice cell population could be calculated as (2.8%) / (73%) × 100% ≈ 3.8%. These results validate the effectiveness of the fluorescence reporter system of this invention in assessing HDR repair efficiency.

[0023] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of this invention shall be considered equivalent substitutions and shall be included within the scope of protection of this invention. Attached Figure Description

[0024] Figure 1This diagram illustrates the specific principle and donor representation of inserting the C-terminus of the endogenous OsH2B gene in rice into eGFP via HDR-mediated insertion.

[0025] Figure 2 This is a fluorescence image of gene-edited rice protoplasts. The OsH2B gene expresses core histones in rice. Subcellular localization occurs in the cell nucleus. Because HDR-mediated precise eGFP insertion leads to the fusion expression of green fluorescent protein and histones, cells that have undergone the correct insertion event will emit green fluorescence, and the green fluorescence will be localized in the cell nucleus.

[0026] Figure 3 To test HDR editing events in rice protoplasts using flow cytometry. In the figure, the eGFP group and TE group represent the positive and negative control groups, respectively. "eGFP" represents the proportion of fluorescent cells obtained using only the eGFP vector, reflecting the protoplast transformation efficiency. The "HDR-donor" and "Cas9" groups represent transformations of the donor vector and CRISPR vector separately, respectively, with no detected green fluorescence. "Cas9+HDR-donor" represents the experimental group.

[0027] SEQ ID NO.1: OsH2BTarget

[0028] GTCTTAAGACGACGTGAACTTGG.

[0029] SEQ ID NO.2: eGFP

[0030] TCGCGGGTTAGCAAGGGGGAGGAGCTCTTTACAGGCGTCGTCCCTATTCTTG TAGAACTTGATGGAGATGTTAATGGCCACAAGTTCTCAGTCTCCGGCGAAGGAGAAGGTGATGCAACATATGGAAAATTGACGCTGAAATTTATATGTACTACCGGCAAGCTGCCTGTACCATGGCCGACTCTGGTGACGACGCTCACTTATGGGGTGCAGTGCTTCTCGCGCTACCCCGATCACATGAAGCAGCACGACTTCTTTAAATCAGCCATGCCAGAAGGATATGTTCAGGAGAGGACCATCTTCTTCAAGGACGACGGGAATTACAAGACCCGTGCTGAGGTGAAGTTTGAGGGTGACACCCTCGTCAACAGAATTGAGCTGAAGGGAATTGATTTTAAGGAGGATGGTAACATCCTCGGCCATAAGCTGGAGTACAACTACAATAGCCACAACGTGTACATCATGGCGGACAAACAAAAGAACGGCATCAAGGTGAACTTCAAAATAAGGCATAATATTGAAGATGGTTCTGTTCAATTGGCCGACCACTACCAGCAGAACACTCCCATCGGCGACGGCCCGGTGCTCCTCCCGGACAATCATTATTTAAGTACACAATCTGCTTTGTCCAAAGATCCAAATGAGAAGCGCGACCATATGGTGCTTCTTGAGTTCGTCACGGCGGCAGGGATAACATTGGGGATGGATGAACTATACAAATGA

[0031] SEQ ID NO.3: Left homologous arm sequence

[0032] GGAGAAGAAGCCCAAGGCCGAGAAGCGGGTGCCGGGCGCCAAGGAGGGCGG CGGCGAGAAGAAGGGGAAGAAGAAGGCCAAGAAGAGCGTCGAAACTTATAAGATCTACATTTTCAAGGTCCTCAAGCAGGTGCATCCCGATATCGGGATATCGTCCAAGGCCATGTCGATCATGAACTCGTTCATCAACGATATCTTCGAGAAGCTCGCCCAGGAGGCCGCCCGTCTCGCCCGCTACAACAAGAAGCCGACCATCACCTCCCGCGAGATCCAGACCTCGGTGCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCTGAGGGCACCAAGGCCGTCACAAAATTCACGTCGTCT

[0033] SEQ ID NO.4: Right homologous arm sequence

[0034] TCACGTCGTCTTAAGACGCGTGATCTGTTCATGTTCGTTGGATGTTTATCTG TTCTGATGTTTATTTAGAGCGCTCTTAGATTTCCCACATGGAACAATGTAGTATCGGTGAAATTCGCTATAAATGAATCGCTGATCTTATCACAACTTTCAATGTGTTTCTCTTGGTGCTTGAATTCCTGTGAATTTGTGGTTTGTGCTTTGAACGGGCTGCAGGAAATGTCAAATGAGTGACCGCAGAGGCTACCTACGGAGGATTTTGTAATTTGTATCAGTGGAAAAAGTTTGTGATGTATCAGAGTGAATAATACCGAATTTATGGGATTTAGATTACAGAATAATATAGAATGTTTTGAACACATGTTAAGTACTCTACAGGCCTTTAGAAGT

[0035] SEQ ID NO.5: P1300-H2B-g1-F:

[0036] GTGTGTCTTAAGACGACGTGAACT

[0037] SEQ ID NO.6: P1300-H2B-g1-R:

[0038] AAACAGTTCACGTCGTCGTTAAGAC

Claims

1. A fluorescent reporter system for evaluating the efficiency of homology-mediated DNA repair in rice cells, characterized in that, Includes the following steps: S1. Construct CRISPR vectors and donor vectors, and deliver them into rice reporter cells to stimulate the histone gene expression in rice. OsH2B The amino acid coding sequence is fused with the nucleotide sequence encoding the fluorescent protein at the same reading frame at the end; S2. Using flow cytometry, detect the proportion of fluorescent cells among the transformed live cells in the reporter cells treated in step S1, and estimate the homology-mediated DNA repair efficiency in rice cells.

2. The method according to claim 1, characterized in that, The fluorescent protein mentioned in step S1 is enhanced green fluorescent protein (eGFP), whose coding sequence has the start codon removed.

3. The method according to claim 1, characterized in that, The reporter cells described in step S1 are mesophyll protoplasts derived from seedlings of the Nipponbare rice variety. They are prepared by digesting young leaf tissue with cellulase and cleavage enzyme, and after vector delivery treatment, they are cultured at a constant temperature of 28 degrees Celsius for 48-72 hours. The delivery method is polyethylene glycol-mediated genetic transformation of rice protoplast cells.

4. The method according to claim 1, characterized in that, The CRISPR vector described in step S1 contains a gene that can target rice histone genes. OsH2B The sgRNA at the end of the amino acid coding sequence is targeted as shown in SEQ ID NO.

1.

5. The method according to claim 1, characterized in that, The donor vector in step S1 comprises an eGFP coding sequence optimized with rice codons, as shown in SEQ ID NO.2, homologous arm sequences in the rice genome located approximately 350 bp upstream and downstream of the genomic target site of claim 2, as shown in SEQ ID NO.3, and homologous arm sequences in the rice genome located approximately 350 bp upstream and downstream of the genomic target site of claim 2, as shown in SEQ ID NO.

4.

6. The method according to claim 1, characterized in that, In step S2, the flow cytometry detection uses the FSC / SSC channel to delineate live cells, and simultaneously uses the FITC channel to measure the number of cells emitting fluorescence under 488nm excitation light.

7. The method according to claim 1, characterized in that, The calculation method described in step S2 is as follows: Rice cell HDR efficiency = (proportion of fluorescent cells in population 1) / (proportion of fluorescent cells in population 2) × 100%; Population 1 is the reporter cell population after simultaneous delivery of CRISPR vector and donor vector according to the method described in claim 1; Population 2 is the reporter cell population after delivery of vector encoding complete fluorescent protein gene expression cassette according to the method described in claim 1.

8. The complete fluorescent protein gene expression cassette according to claim 7, characterized in that, Driven by the ZmUbi promoter from maize and terminated by the Nos terminator from Agrobacterium, it has a nucleotide sequence encoding eGFP amino acids that has been codon-optimized by rice.

9. The method according to any one of claims 1-8 is used to compare the effects of different experimental conditions on the HDR efficiency of rice cells, including applications such as screening candidate factors that may affect the HDR efficiency of rice cells.

Images