Preparation method and application of self-assembled DNA crystal

Abstract

The invention belongs to the technical field of biological materials, and relates to a preparation method of a self-assembled DNA crystal. According to the method, polyamine with a specific concentration is introduced as an auxiliary agent, in the high-temperature annealing step (the temperature is gradually reduced to 4-30 DEG C from 85-100 DEG C), the polyamine contributes to effective folding and stabilization of DNA chains, dependence on traditional metal ions is avoided, rapid formation of DNA crystals is promoted, the molar ratio of DNA to the polyamine in the DNA mixed solution is determined to be (1-5): (50-50000), and the method has the advantages that the method is simple and convenient to operate, and the method is suitable for large-scale popularization and application. The DNA self-assembly efficiency is ensured, and meanwhile, the quality and the stability of the crystal are optimized.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological materials, and relates to a preparation method and application of a self-assembled DNA crystal. BACKGROUND

[0002] DNA is a key biological macromolecule, mainly composed of three basic components, namely four different bases (adenine A, guanine G, thymine T and cytosine C), deoxyribose and phosphate. The four bases follow specific rules, that is, adenine and thymine, guanine and cytosine form base complementary pairing through hydrogen bonds, so that two DNA chains can be tightly combined to form a stable double helix structure. This complex molecular structure not only carries the genetic information of living organisms, but also plays a crucial role in the development and function maintenance of biological individuals.

[0003] In 1982, Professor Seeman creatively proposed an innovative concept-DNA nanotechnology. The core idea of this technology is to design DNA sequences carefully so that they can self-assemble into DNA Holliday structures and various tile structures, and further construct one-dimensional, two-dimensional and even three-dimensional complex DNA structures through the self-assembly process. This innovative breakthrough has transformed DNA from a simple genetic material into a new type of nanomaterial.

[0004] DNA has been widely used in the construction of DNA nanostructures due to its controllability and programmability at the nanoscale, as well as its excellent biocompatibility and addressability. One of the main goals of DNA structure nanotechnology is to use DNA molecules to construct three-dimensional crystals as a periodic molecular scaffold to precisely arrange, capture or aggregate guest molecules. Specifically, the formation of DNA crystals first involves several DNA chains forming small DNA tile structure units through molecular self-assembly, and then these structure units further self-assemble into regularly arranged three-dimensional DNA lattice structures through their sticky end complementary pairing.

[0005] DNA crystals have shown great application potential in many fields due to their unique advantages, such as low-cost synthesis, easy characterization, high biological safety, and precise three-dimensional structure, etc. For example, they can be used to precisely manipulate dye distribution and density, construct pH-responsive switch systems, regulate guest molecule release, and act as molecular sieves, etc.

[0006] However, the practical application of current DNA crystals still faces some challenges. One is that the synthesis speed of DNA crystals is slow and the growth period is long. The second is that the polyanion characteristics of DNA require self-assembly in a high concentration of magnesium ion environment to overcome the strong electrostatic repulsion between double-stranded DNA, thereby forming a tightly arranged DNA structure. However, this also limits the subsequent processing operation of the DNA crystal, and the biocompatibility in a high magnesium ion environment is low, which may affect the application of the DNA crystal combined with other metal ions. In addition, the self-assembly process of the DNA crystal excessively depends on the complementary pairing of the relatively short sticky ends, which to some extent limits the strong interaction strength between the DNA crystal and other structural units, and therefore it is urgent to develop a new assembly strategy to overcome such limitations. SUMMARY

[0007] The purpose of the present application is to solve the above-mentioned problems existing in the prior art, and a preparation method of DNA crystal self-assembly induced by polyamine solution is proposed. The prepared DNA crystal has stronger physical stability, biocompatibility and environmental responsiveness.

[0008] The purpose of the present application can be achieved by the following technical scheme: a preparation method of self-assembled DNA crystal, the method comprising the following steps:

[0009] S1, mixing DNA single strands constituting DNA structure units to obtain a DNA mixture;

[0010] S2, then adding a polyamine solution to the DNA mixture for slow annealing at high temperature.

[0011] In the above-mentioned preparation method of self-assembled DNA crystal, the DNA structure unit includes at least one of the following: DNA tensegrity triangular structure unit, DNA square structure unit, double-crossing DXL crystal structure unit, hexagonal arrangement structure unit based on tensegrity triangle, 13-mer structure unit, 8-nt structure unit, six-helix structure unit and its derivative structure, 8x8x4 nanocrystal structure unit and its derivative structure, six-fold crystal, amphiphilic DNA unit / C-star crystal structure unit, DNA origami crystal structure unit and its derivative structure.

[0012] The DNA tensegrity triangular structure unit is a triangular structure formed by self-assembly of three DNA strands through base complementary pairing, wherein each strand is connected to each other through a precisely designed sequence to form a stable and symmetrical geometric shape. The tensegrity structure emphasizes the mechanical balance inside the structure, making the whole structure more stable.

[0013] The DNA tensegrity triangle structure unit can be a DNA tensegrity triangle derived structure of a 4x5 primitive or a 6x5 primitive. The 4x5 primitive and the 6x5 primitive are based on a DNA tensegrity triangle deformed to form a tensegrity square primitive, which can further self-assemble to construct a larger and more complex three-dimensional crystal structure. "4x5" and "6x5" describe the basic size of the primitive or the number of constituent elements, for example, "4x5 primitive" means that the structure is composed of 4 continuous and repeated 5-base sequence units as the basic module of a rectangular grid. Similarly, "6x5 primitive" can refer to 6 continuous and repeated 5-base sequence units arranged in a specific manner, which are self-assembled by carefully designed DNA sequences, and each unit is connected to each other through specific base pairing.

[0014] The double-crossing DXL crystal structure unit is a DNA strand with a specific sequence that self-assembles into a highly ordered two-dimensional or three-dimensional crystal structure under specific conditions.

[0015] The hexagonal arrangement structure unit based on the tensegrity triangle is a hexagonal arrangement unit designed based on the DNA tensegrity triangle, which can be assembled into a three-dimensional structure similar to a honeycomb.

[0016] 13-mer primitive refers to a DNA fragment composed of 13 base pairs, which can be connected to each other through specifically designed sequences to form a specific crystal structure.

[0017] The amphiphilic DNA primitive / C-star crystal structure unit contains amphiphilic DNA molecules, i.e., DNA strands with both hydrophilic and hydrophobic parts. The C-star structure refers to the end of the DNA strand being chemically modified to form a central "star" structure with multiple DNA arms connected around it, which is conducive to forming stable three-dimensional assemblies.

[0018] The DNA origami crystal structure primitive and its derived structures are a DNA origami technology that uses long "scaffold" DNA strands and short "peg" DNA strands to fold into a predetermined two-dimensional or three-dimensional shape through base pairing.

[0019] In the above method for preparing a self-assembled DNA crystal, the polyamine includes at least one of spermine, putrescine, arginine, spermidine, ethylenediamine, melamine, and a melamine derivative.

[0020] As a preferred, the DNA structural unit is a 4-turn tensegrity triangle unit, which is composed of a central chain L chain, an edge chain M chain, and an angle chain S chain. Each S chain has two end portions that are complementary to one end portion of two M chains, and the number of complementary base pairs is 13 or 14. The sticky end of each M chain and S chain is two bases long. Each M chain is 42 bases long and is divided into three segments from the 5' end to the 3' end, with the number of bases in each segment being 13, 17, and 12. Each L chain is a three-segment repeat sequence and is complementary to the middle portion of three M chains in the center of the tensegrity triangle structure unit. The length of the complementary pairing between the L chain and each M chain is 17 bases.

[0021] In the above method for preparing a self-assembled DNA crystal, the molar ratio of the central chain L chain, the edge chain M chain, and the angle chain S chain is (1-2) : (2-5) : (2-5). When the three chains are mixed in this specific ratio, the self-assembly efficiency reaches an optimal state, not only ensuring the high efficiency of the assembly process, but also significantly improving the purity of the product. This means that, under this specific ratio, the base pairing between DNA chains is more accurate, reducing the possibility of incorrect pairing, thereby improving the uniformity and integrity of the structure.

[0022] As a preferred, the molar ratio of the central chain L chain, the edge chain M chain, and the angle chain S chain is 1:3:3. When the ratio is adjusted, even slightly, such as mixing in a ratio other than 1:3:3, the assembly yield of the tensegrity triangle often decreases significantly. This indicates that the molar ratio between the three chains has a decisive influence on the assembly efficiency and product quality. Lower yield not only reflects the decrease in assembly efficiency, but also may mean that a large number of non-target structures or incomplete intermediates are generated, thereby reducing the overall purity of the product. Due to the strict specificity of DNA base pairing and the complex dynamics of DNA chain interactions, at the optimal ratio of 1:3:3, DNA chains can achieve the best spatial arrangement and pairing balance, ensuring that each chain can find its appropriate pairing partner, thereby quickly and accurately forming the expected triangular structure. Conversely, changes in the ratio can disrupt this balance, causing pairing confusion in local regions, hindering the correct folding and stabilization of the structure. Therefore, the present application not only emphasizes the importance of molar ratio selection in designing DNA nanostructures, but also provides a key parameter reference for future DNA-based nanostructure design, i.e., optimizing the self-assembly process by precisely regulating the inter-chain ratio to obtain high-quality nanostructures, laying a solid foundation for the application of DNA nanotechnology in the fields of biosensing, drug delivery, materials science, and others.

[0023] In the above method for preparing a self-assembled DNA crystal, the total DNA concentration in the DNA mixture in step S1 is 2-25 μM.

[0024] In the method for preparing the self-assembled DNA crystal, the concentration of the polyamine solution in step S2 is 500-1500 μM. By adjusting the concentration of the polyamine, the present application can realize fine control of the DNA self-assembly strategy, and further explore and optimize different nanostructure designs. However, in a polyamine environment with too high a concentration, the DNA self-assembly path may deviate, and this structural deviation directly leads to the diversity of the crystal morphology, suggesting that a too high concentration of spermidine may promote the formation of other types of DNA supramolecular assemblies, resulting in an increase in impurity crystals. Therefore, when pursuing a specific DNA nanostructure, the amount of spermidine added needs to be carefully controlled to avoid the generation of non-target structures. With a lower concentration of spermidine, the process of DNA self-assembly into a crystal is more slow and requires more patience. In this process, from the initial aggregation of DNA chains to the gradual appearance of micron-sized crystals, a relatively long waiting period often needs to be experienced, greatly affecting the synthesis efficiency.

[0025] Preferably, the polyamine solution is a spermidine aqueous solution.

[0026] In the method for preparing the self-assembled DNA crystal, the high-temperature slow annealing is specifically gradient cooling from 85-100℃ to 4-30℃. By adding an appropriate amount of polyamine, the present application can also significantly reduce the temperature sensitivity of DNA crystal formation, effectively promote the recognition, pairing and stable combination between DNA chains, accelerate the nucleation and growth process of the crystal, and greatly widen the kinetic differences caused by temperature in high-temperature slow annealing to promote the combination between DNA chains and the self-assembly of the crystal nucleus.

[0027] In the method for preparing the self-assembled DNA crystal, the size of the self-assembled DNA crystal is 50 nm-500 μm, and the shape of the self-assembled DNA crystal includes at least one of a DNA rhombic crystal, a DNA cubic crystal, a DNA rectangular crystal, a 13-mer hexagonal crystal, a double-crossed DNA bipyramidal crystal and a derivative structure thereof.

[0028] As preferred, the self-assembled DNA crystal is stable in pure water at 4-30℃ for more than 7 days, and still maintains the integrity of the structure after repeated freezing and thawing for more than 10 times, repeated centrifugation for more than 10 times. The self-assembled DNA crystal of the present application can maintain its structural integrity for more than 7 days in pure water at 4-30℃, which means that the crystal can maintain stability for a long time under mild environmental conditions, without the need for special low-temperature refrigeration facilities, greatly simplifying the storage and transportation process, and paving the way for its wide application in and out of the laboratory; the crystal can still maintain the integrity of its original structure and functional activity after at least 10 repeated freezing and thawing cycles, which is crucial for the stability of the DNA crystal during long-term storage, especially in the logistics link that needs to cross different temperature conditions, the anti-freezing and thawing ability of the crystal ensures the safety of its structure under extreme temperature changes, avoiding damage or degradation caused by freezing and thawing; and even after high-frequency high-speed centrifugation, the self-assembled DNA crystal of the present application shows no signs of structural damage or loss of function, which indicates that the crystal has excellent mechanical strength and structural flexibility, and can maintain the stability of its geometric shape and internal structure under high centrifugal force, which is particularly important for scenarios that need to be operated under experimental conditions such as centrifugal separation. It can be seen that the self-assembled DNA crystal prepared by the present application meets the application in the fields of later biomedical, information storage, nanomanufacturing, etc.

[0029] The self-assembled DNA crystal of the present application has a highly ordered three-dimensional lattice arrangement and a clear spatial lattice (such as P3, P4, P6), and due to its three-dimensional characteristics, there will be a variety of lattice diffraction points when the electron microscope is taken from different spatial angles and the crystal is diffracted. Moreover, it has excellent physical properties that are completely different from traditional magnesium ions, such as being able to exist stably in pure water for more than 72 hours, maintaining the crystal form intact after 5000G centrifugation for 5 minutes, and the crystal can still recover and its shape is not damaged after three cycles of in-situ dehydration and rehydration and repeated freezing and thawing.

[0030] The present application also provides an application of the self-assembled DNA crystal prepared by the above preparation method in nanomanufacturing, semiconductor, DNA storage, biosensor, drug carrier, and biomaterial.

[0031] Compared with the prior art, the present application has the following beneficial effects:

[0032] 1.The present application is self-assembled by three DNA single strands (central chain L chain, side chain M chain and corner chain S chain) designed carefully, L chain contains repeated sequences, which are complementary to the middle part of three M chains respectively; while the two ends of each S chain are complementary to the part of two M chains respectively, forming an accurate tensegrity triangular structure unit. According to the specific molar ratio (L chain: M chain: S chain = (1-2): (2-5): (2-5)), the three DNA chains are mixed, and then diluted to a concentration of 2-25 μM, which ensures the efficient and orderly self-assembly process.

[0033] 2.The present application introduces a specific concentration of polyamine as an auxiliary agent, which helps the effective folding and stabilization of DNA chains in the high-temperature annealing step (gradually cooling from 85-100 ℃ to 4-30 ℃), avoiding the dependence on traditional metal ions, promoting the rapid formation of DNA crystals, and determining the molar ratio of DNA and polyamine in the DNA mixture as 1-5: 50-50000, which ensures the efficiency of DNA self-assembly while optimizing the quality and stability of the crystals.

[0034] 3.The self-assembled DNA rhombic crystal finally prepared by the present application has wide application prospects and can be applied in the fields of biosensors, drug carriers and biomaterials, etc., which embodies its great potential in nanotechnology and biological engineering technology. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 Electrophoresis characterization figure of DNA tensegrity triangle prepared for Example 1.

[0036] Figure 2 Optical microscope figure of DNA rhombic crystal prepared for Example 1.

[0037] Figure 3 Lattice structure observed in the TEM image of the DNA crystal prepared for Example 1.

[0038] Figure 4 Stability of the DNA crystal prepared for Example 1 in pure water at different times after Hoechest33342 staining.

[0039] Figure 5 Different types of DNA crystals prepared for Examples 2-3.

[0040] Figure 6 Optical microscope figure of DNA crystal prepared for Comparative Example 5. DETAILED DESCRIPTION

[0041] The following are specific embodiments of the present application, which further describe the technical solutions of the present application, but the protection scope of the present application is not limited thereto.

[0042] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0043] The materials, reagents, etc. used in the following examples can be obtained commercially unless otherwise specified.

[0044] DNA strand dissolution and spermidine solution preparation: The three DNA strands used in the experiment were synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. and purified by ULTRAPAGE. The three DNA dry powders were dissolved in primary water, and the DNA concentration was determined.

[0045] Spermidine trihydrochloride was purchased from Shenguo Bioengineering (Shanghai) Co., Ltd. A 10 mmol / L spermidine solution was prepared using primary water, mixed uniformly, and stored in a 4°C refrigerator in the dark.

[0046] Example 1:

[0047] The three DNA strands shown in SEQ ID NO. 1-3 in Table 1 were mixed in a PCR tube at a L:M:S molar ratio of 1:3:3, and the total concentration of the three DNA strands was 20 μM. After adding primary water, 10 mmol / L spermidine solution was added to make the final concentration of spermidine 1 mM, and the mixed DNA solution was placed in a PCR instrument to cool from 95°C to 20°C.

[0048] Polyacrylamide gel electrophoresis: 10% native PAGE gels were prepared using 19:1 acrylamide / bisacrylamide solution and TAE / 12.5 mM Mg 2+ buffer solution containing 40 mM tris base (pH 8.0), 20 mM acetic acid, 2 mM ethylenediaminetetraacetic acid (EDTA), and 12.5 mM magnesium acetate. The gel was run at room temperature, then stained with gel-red, and scanned using a Bio-rad all-in-one imaging analysis system (ChemiDoc MP). Figure 1 A DNA monolithic triangle electrophoresis characterization chart was prepared for Example 1. As can be seen from the chart, lane 1 is a 20 bp marker, lane 9 is a DNA triangle induced by spermidine, and lane 10 is a DNA triangle induced by traditional magnesium ions. The results show that the spermidine-induced monolithic triangle is successfully synthesized, and compared with the traditional magnesium ion-induced monolithic triangle, the product induced by spermidine has higher purity, and the three single strands are correctly combined in proportion.

[0049] Freeze sample preparation for transmission electron microscope (TEM): Put a piece of copper mesh with the front side up on a clean filter paper. Take the prepared annealed spermidine crystal solution and drop it on the copper mesh. Let the crystal deposit on the copper mesh. After half an hour, remove the solution. Prepare the dye by mixing uranyl acetate with deionized water and ultrasonic. Take the dye solution with a pipette and drop it on the copper mesh. Stain for 60-120s. Put the copper mesh back in the grid and fill it with ethanol solution. Put it in liquid nitrogen and dry overnight. Take the copper mesh out the next day for transmission electron microscope imaging.

[0050] Table 1: Sequence of center chain L chain, side chain M chain, angle chain S chain

[0051]

[0052] Figure 2 The optical microscope image of the DNA rhombus crystal prepared in Example 1 shows that spermidine can induce DNA to self-assemble into rhombus crystals with uniform size and regular shape.

[0053] Figure 3 The TEM image of the DNA crystal prepared in Example 1 shows a crystal lattice structure. The spermidine crystal has a clear crystal lattice structure of a tensioned whole triangle.

[0054] Characterization of the physical stability of the DNA crystal: (1) Water solution stability: Mix spermidine crystals with Hoechest 33342 dye and incubate in the dark for 30 min. Centrifuge and wash to remove excess impurities. Observe the morphology of spermidine crystals in pure water at different times using a confocal microscope. (2) In-situ dehydration and rehydration stability: Take the spermidine crystal solution and drop it on a clean glass slide. Observe under a microscope and mark the position of the crystal. Then put the glass slide in a freeze dryer. After the droplet is completely dried, add pure water to re-dissolve and observe the morphology of the spermidine crystal. Figure 4 The stability of the DNA crystal prepared in Example 1 in pure water at different times after Hoechest 33342 staining shows that the stability of the spermidine crystal is significantly enhanced and can exist stably in pure water for 72 h or more, and the crystal morphology is complete.

[0055] Example 2:

[0056] The difference from Example 1 is that the DNA structural motif is a 2turn tensioned whole triangle motif.

[0057] Three DNA strands shown in SEQ ID NO. 4-6 in Table 2 were mixed in a PCR tube in a molar ratio of 1:3:3, and the total concentration of the three DNA strands was 40 μM. After adding primary water, 100 mmol / L spermidine solution was added to make the final concentration of spermidine 40 mM, and the mixed DNA solution was placed in a PCR instrument to cool from 95°C to 20°C.

[0058] Table 2: sequences of the center chain L chain, the edge chain M chain, and the corner chain S chain

[0059] Central chain L chain SEQ ID NO. 4: ACACCGTACACCGTACACCGT Side chain M chain SEQ ID NO. 5: GAGCAGCCTGTACGGACATCA Corner chain S chain SEQ ID NO. 6: TCTGATGTGGCTGC

[0060] Example 3:

[0061] The difference from Example 1 is that the DNA structural motif is a 13-mer motif, and the 13-mer motif is shown in SEQ ID NO. 7: GGACAGCTGGGAG.

[0062] 200 μM of 13-mer single-stranded DNA was mixed in a PCR tube. After adding primary water, 10 mmol / L spermidine solution was added to make the final concentration of spermidine 2 mM, and the mixed DNA solution was placed in a PCR instrument to cool from 95°C to 20°C.

[0063] Example 4:

[0064] The difference from Example 1 is that the DNA structural motif is a DXL crystal motif, and the DXL crystal motif is shown in SEQ ID NO. 8: CGACGCGTGGCGCCGC.

[0065] 200 mM of DXL single-stranded DNA was mixed in a PCR tube. After adding primary water, 1 mol / L spermidine solution was added to make the final concentration of spermidine 100 mM, and the mixed DNA solution was placed in a PCR instrument to cool from 95°C to 20°C.

[0066] Comparative Example 1:

[0067] The difference from Example 1 is that the molar ratio of the center chain L chain, the edge chain M chain, and the corner chain S chain is 1:1:1. By electrophoresis characterization, a small amount of tensioned whole triangle was still generated when the three DNA strands reacted in a ratio of 1:1:1, but a large amount of incomplete reaction combination of single strands and multiple chains existed, resulting in low product purity.

[0068] Comparative Example 2:

[0069] The difference from Example 1 is that the spermidine final concentration is 300 μM.

[0070] No crystal is generated after annealing in Comparative Example 2.

[0071] Comparative Example 3:

[0072] The difference from Example 1 is that the spermidine final concentration is 200 mM.

[0073] After annealing in Comparative Example 3, the crystal morphology is unstable, and there are many impurity crystals, which means that the crystal structure formed cannot maintain the expected order and consistency, which indicates that in the high-concentration spermidine environment, in addition to the target structure, a large amount of by-products or non-target assemblies are also formed. The presence of these impurity crystals not only reduces the purity of the product, but also affects the subsequent structure analysis and application performance evaluation.

[0074] Comparative Example 4:

[0075] The difference from Example 1 is that the mixed DNA solution is incubated at room temperature overnight.

[0076] The DNA crystal prepared in Comparative Example 4 contains only a small amount of DNA rhombic crystal, and there are still a large number of incomplete reaction DNA chain combination impurities.

[0077] Figure 5 The different types of DNA crystals prepared in Examples 2-3. As can be seen from the figure, the spermidine of the specific molar ratio of the present application can induce 2turn, 13-mer, DXL crystal self-assembly, and guide the ordered arrangement of DNA molecules through specific interaction with DNA molecules. In-depth exploration of this induction mechanism will help us more accurately control the process of DNA self-assembly, and thus design more novel DNA nanostructures with novel structures and functions.

[0078] Figure 6 The optical microscope image of the DNA crystal prepared in Comparative Example 3. As can be seen from the figure, the crystal morphology after annealing is irregular, and the size is uneven.

[0079] In summary, the present application is self-assembled by three DNA single strands (central chain L chain, side chain M chain and corner chain S chain) designed carefully, the L chain contains repeated sequences, which are respectively complementary to the middle part of three M chains; and the two ends of each S chain are respectively complementary to part of two M chains, forming an accurate tensioned whole triangular structure unit, according to the specific molar ratio (L chain: M chain: S chain = 1:3:3) mixing three DNA chains, and diluting them to a concentration of 15-25 μM, ensuring the efficient and orderly self-assembly process, and by introducing a specific concentration of spermidine as an auxiliary agent, in the high temperature annealing step (gradually cooling from 90-100 DEG C to 15-25 DEG C), spermidine helps the effective folding and stabilization of DNA chain, avoids the dependence on traditional metal ions, promotes the rapid formation of DNA rhombic crystal, and determines the molar ratio of DNA and spermidine in the DNA mixture to be 1:50-50000, which ensures the DNA self-assembly efficiency, optimizes the quality and stability of the crystal.

[0080] The technical means disclosed in the technical scheme of the present application is not limited to the technical means disclosed in the above technical means, but also includes the technical scheme composed of any combination of the above technical features. The above is the specific implementation of the present application, it should be pointed out that, for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, these improvements and refinements are also considered as the protection scope of the present application.

[0081] The specific embodiments described herein are merely illustrative of the present application. Those skilled in the art can make various modifications or supplements to the described specific embodiments or use similar ways to replace, but will not deviate from the spirit of the present application or exceed the scope defined by the appended claims.

Claims

1. A method for preparing a self-assembled DNA crystal, characterized by, The method comprises the following steps: S1, mixing DNA single strands constituting DNA structural units to obtain a DNA mixture; S2, then adding a polyamine solution to the DNA mixture to obtain a self-assembled DNA crystal through slow annealing at high temperature.

2. The method for preparing a self-assembled DNA crystal according to claim 1, characterized in that, The DNA structural units comprise at least one of a DNA tensegrity triangular structure unit, a DNA square structure unit, a double-cross DXL crystal structure unit, a hexagonal arrangement structure unit based on a tensegrity triangle, a 13-mer structure unit, an 8-nt structure unit, a six-helix structure unit and a derivative structure thereof, an 8*8*4 nanocrystal structure unit and a derivative structure thereof, a six-reconfiguration crystal, an amphiphilic DNA primitive / C-star crystal structure unit, a DNA origami crystal structure unit and a derivative structure thereof.

3. The method for preparing a self-assembled DNA crystal according to claim 1, characterized in that, The polyamine comprises at least one of spermine, putrescine, arginine, spermidine, ethylenediamine, melamine, a melamine derivative.

4. A method for preparing a self-assembled DNA crystal according to claim 1 or 2, characterized in that, The DNA structural unit is a 4turn tensegrity triangular unit, the triangular unit is composed of a center chain L chain, an edge chain M chain and an angle chain S chain, two end portions of each S chain are respectively complementary to one end portion of two M chains, and the number of complementary paired bases is 13 or 14; and the sticky end of each M chain and S chain is two bases in length; each M chain is 42 bases in length; and from the 5' end to the 3' end, each M chain is divided into three segments, and the number of bases in each segment is 13, 17 and 12; each L chain is a three-segment repeat sequence, and is complementary to the middle portion of three M chains in the center of the tensegrity triangular structure unit, and the length of the complementary pairing between the L chain and each M chain is 17 bases.

5. The method for preparing a self-assembled DNA crystal according to claim 4, characterized in that, The molar ratio of the center chain L chain, the edge chain M chain and the angle chain S chain is (1-2):(2-5):(2-5).

6. The method for preparing a self-assembled DNA crystal according to claim 1, characterized in that, The total concentration of DNA in the DNA mixture in step S1 is 2-25 μM.

7. The method for preparing a self-assembled DNA crystal according to claim 1, characterized in that, The concentration of the polyamine solution in step S2 is 500-1500 μM.

8. The method for preparing a self-assembled DNA crystal according to claim 1, characterized in that, The slow annealing at high temperature is specifically gradient cooling from 85-100 ℃ to 4-30 ℃.

9. The method for preparing a self-assembled DNA crystal according to claim 1, characterized in that, The size of the self-assembled DNA crystal is 50 nm-500 μm, and the shape of the self-assembled DNA crystal comprises at least one of a DNA rhombic crystal, a DNA cubic crystal, a DNA rectangular crystal, a 13-mer hexagonal crystal, a double-cross DNA bipyramidal crystal and a derivative structure thereof.

10. Application of a self-assembled DNA crystal prepared by the preparation method of claim 1 in nanomanufacturing, semiconductors, DNA storage, biosensors, drug carriers and biomaterials.

Images