Primer composition and method for simultaneously detecting lilium regale and lilium lancifolium
By designing specific primers and probes for fluorescent PCR technology, the problem of distinguishing between Lilium lancifolium and Lilium tigrinum has been solved, achieving rapid, low-cost, and highly sensitive identification, which is suitable for adulteration detection in deep-processed lily products.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGXI PROVINCIAL INST OF FOOD INSPECTION & TESTING (JIANGXI NAT FRUIT & VEGETABLE PROD & PROCESSED FOOD QUALITY SUPERVISION & INSPECTION CENT)
- Filing Date
- 2026-01-20
- Publication Date
- 2026-05-01
AI Technical Summary
Existing technologies are insufficient to effectively distinguish between Lilium lancifolium and Lilium tigrinum, especially in processed products. The testing costs are high, the time required is long, and the sensitivity is low, making it difficult to detect adulteration.
Specific primers and probes were designed, and primer compositions were constructed to simultaneously identify components of both *Lilium tigrinum* and *Lilium tigrinum* by detecting the circular chloroplast genomes of *Lilium tigrinum* and *Lilium tigrinum* using real-time PCR technology.
It achieves rapid, low-cost, and highly sensitive identification of Lilium lancifolium and Lilium tigrinum, effectively identifying adulteration, solving the identification problem in existing technologies, and possessing good specificity and repeatability.
Smart Images

Figure CN121555688B_ABST
Abstract
Description
Primer composition and method for simultaneous detection of Lilium tigrinum and Lilium tigrinum. Technical Field
[0001] This invention relates to the field of food testing technology, and more specifically to primer compositions and methods for the simultaneous detection of Lilium tigrinum and Lilium tigrinum. Background Technology
[0002] Longya lily (Lilium brownii var. viridulum Baker) is a variety of wild lily, widely cultivated in Jiangxi, Hunan, Guangxi, and other regions. Its powder has high medicinal and edible value, but the powder yield is low, resulting in a higher market price than other lily powder products. In recent years, unscrupulous merchants have frequently adulterated Longya lily powder with cheap lily powder or other starches, or even directly sold starch products as pure Longya lily powder, seriously damaging consumer interests and brand value. Among these, Lilium lancifolium Thunb., with its wide distribution, has bulbils and bulbils that can be processed into lily powder, and its lower price makes it a common adulterator for Longya lily powder. Therefore, there is a need for technical methods to identify Longya lily and its products.
[0003] Currently, the main methods for identifying lilies and their products include spectrometry, scanning electron microscopy, and electronic tongue technology. However, while spectrometry and electronic tongue technology offer fast detection speeds, they suffer from low sensitivity, poor specificity, and limited resolution, making them difficult to accurately identify highly processed products, varieties with low levels of adulteration, or those of similar species. Scanning electron microscopy provides reliable results, but it is costly, time-consuming, and requires highly skilled personnel, making it unsuitable for routine testing.
[0004] Quantitative real-time polymerase chain reaction (PCR) is a classic molecular biology technique. By designing specific primers and probes, it amplifies specific target DNA fragments, and after capturing the fluorescence signal, it can also be used to identify certain biological species. However, highly processed products such as lily powder undergo high-temperature and rinsing processes during processing, which significantly damages the DNA. The amount of usable DNA template is limited, and the composition is complex, making it easy for false negatives in PCR tests to occur due to poor DNA template quality. Summary of the Invention
[0005] Based on this, the present invention provides primer compositions and methods for simultaneously detecting Lilium tigrinum and Lilium tigrinum, thereby solving at least one problem in the prior art.
[0006] In a first aspect, the present invention provides a primer composition for simultaneously detecting *Lilium tigrinum* and *Lilium tigrinum*, comprising a primer set for detecting *Lilium tigrinum* and a primer set for detecting *Lilium tigrinum*, wherein the primer set for detecting *Lilium tigrinum* includes primers as shown in SEQ ID No. 1 and primers as shown in SEQ ID No. 2, and the primer set for detecting *Lilium tigrinum* includes primers as shown in SEQ ID No. 4 and primers as shown in SEQ ID No. 5. Specifically, SEQ ID No. 1 is GTTTTGCGAACCATTTGATTC, SEQ ID No. 2 is GTGAATTAGAGTTGGAATGAGAT, SEQ ID No. 4 is CAAATAAATGTAAGGACTGGTTCG, and SEQ ID No. 5 is CTAATTTTTGGGACTCTACACGG.
[0007] The primer composition provided by this invention for simultaneously detecting *Lilium tigrinum* and *Lilium tigrinum* can simultaneously detect both *Lilium tigrinum* and *Lilium tigrinum*, thus enabling the determination of whether *Lilium tigrinum* or its products are adulterated with *Lilium tigrinum* or its products. Preferably, the primer composition is used to simultaneously detect *Lilium tigrinum* components and / or *Lilium tigrinum* components in *Lilium tigrinum* powder products (*Lilium tigrinum* powder).
[0008] In some optional embodiments, the primer composition for simultaneously detecting *Lilium tigrinum* and *Lilium tigrinum* further includes probes for detecting *Lilium tigrinum* and for detecting *Lilium tigrinum*, wherein the probe for detecting *Lilium tigrinum* includes the sequence shown in SEQ ID No. 3, and the probe for detecting *Lilium tigrinum* includes the sequence shown in SEQ ID No. 6. Specifically, SEQ ID No. 3 is CGAAATCAAATGATTCGCAAAAACTCGAGATA, and SEQ ID No. 6 is ATTATATAGGTATCTTTGTGGGGTGGGGT.
[0009] In some optional embodiments, the probe for detecting *Lilium tigrinum* is FAM-CGAAATCAAATGATTCGCAAAAACTCGAGATA-TAMRA, and the probe for detecting *Lilium tigrinum* is HEX-ATTATTATAGGTATCTTTGTGGGGTGGGGT-BHQ1. Wherein, FAM represents 6-carboxyfluorescein, TAMRA represents 6-carboxytetramethylrhodamine, HEX represents hexachloro-6-carboxyfluorescein, and BHQ1 represents black hole quencher 1.
[0010] In some optional embodiments, the dragon tooth lily is the Wanzai dragon tooth lily. The Wanzai dragon tooth lily refers to the dragon tooth lily (Lilium brownii var. viridulum Baker) originating from Wanzai County, Yichun City, Jiangxi Province.
[0011] Secondly, the present invention provides a kit for simultaneously detecting Lilium longiflorum and Lilium tigrinum, comprising the primer composition for simultaneously detecting Lilium longiflorum and Lilium tigrinum.
[0012] In some optional embodiments, the kit for simultaneously detecting Lilium tigrinum and Lilium tigrinum also includes dNTPs, Taq DNA polymerase, and buffer.
[0013] In some optional embodiments, the kit for simultaneously detecting Lilium tigrinum and Lilium tigrinum also includes a PCR mix.
[0014] Thirdly, the present invention provides a method for simultaneously detecting Lilium tigrinum and Lilium tigrinum, comprising the following steps:
[0015] Extract genomic DNA from the sample to be tested;
[0016] Using the genomic DNA as a template, a double fluorescent PCR amplification was performed in a reaction system containing the primer composition for simultaneous detection of Lilium tigrinum and Lilium tigrinum.
[0017] Based on the results of dual fluorescence PCR amplification, it is determined whether the sample to be tested contains strychnine and / or lilacinus components. Specifically, if a typical amplification curve appears in the FAM fluorescence channel, the sample to be tested contains strychnine; if a typical amplification curve appears in the HEX fluorescence channel, the sample to be tested contains lilacinus components.
[0018] In some optional embodiments, the reaction system, in 25 μL, comprises: 1.0 μMol of primer as shown in SEQ ID No. 1, 1.0 μMol of primer as shown in SEQ ID No. 2, 1.0 μMol of probe for detecting Lilium tigrinum, 0.25 μMol of primer as shown in SEQ ID No. 4, 0.25 μMol of primer as shown in SEQ ID No. 5, 0.25 μMol of probe for detecting Lilium tigrinum, 12.5 μL of PCR mix, 5 μL of genomic DNA, and the remainder being distilled water.
[0019] In some optional embodiments, the program for the duplex fluorescent PCR amplification includes: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s; 60°C annealing extension for 15 s; 45 cycles.
[0020] Due to the adoption of the above technical solutions, the embodiments of the present invention have at least the following beneficial effects: Based on the fluorescence quantitative PCR technology to identify Lilium longiflorum and Lilium tigrinum, the two lily components can be detected by fluorescence PCR in one step, which can effectively identify adulterated products of Lilium longiflorum powder mixed with Lilium tigrinum powder, and solve the technical problem of difficulty in distinguishing Lilium longiflorum and Lilium tigrinum in the prior art; compared with other lily identification methods such as electronic tongue and electron microscopy, fluorescence PCR detection has the advantages of low cost, high sensitivity, strong specificity and fast detection speed. Attached Figure Description
[0021] Figure 1 shows the fluorescence amplification curves of leaf samples from *Lilium tigrinum* plants in Example 1 of this invention. The blue curve represents the FAM channel for *Lilium tigrinum* detection, and the orange curve represents the HEX channel for *Lilium tigrinum* detection. A typical amplification curve indicates the detection of the component.
[0022] Figure 2 shows the fluorescence amplification curves of bulbils from *Lilium tigrinum* plants in Example 1 of this invention. The blue curve represents the FAM channel for detecting *Lilium tigrinum*, and the orange curve represents the HEX channel for detecting *Lilium tigrinum*. A typical amplification curve indicates that the component was detected.
[0023] Figure 3 shows the fluorescence amplification curve of sample 1 of *Lilium tigrinum* powder in Example 1 of the present invention. The blue curve represents the FAM channel for detecting *Lilium tigrinum*, and the orange curve represents the HEX channel for detecting *Lilium tigrinum*. A typical amplification curve indicates that the component was detected.
[0024] Figure 4 shows the fluorescence amplification curves of sample 2 of *Lilium tigrinum* powder in Example 1 of this invention. The blue curve represents the FAM channel for detecting *Lilium tigrinum*, and the orange curve represents the HEX channel for detecting *Lilium tigrinum*. A typical amplification curve indicates that the component was detected.
[0025] Figure 5 shows the fluorescence amplification curves of 8 samples in Example 2 of the present invention. The blue curve represents the FAM channel for detecting Lilium lancifolium, and a typical amplification curve indicates that the component is detected.
[0026] Figure 6 shows the fluorescence amplification curves of 8 samples in Example 3 of the present invention. The green curve represents the HEX channel for detecting Lilium tigrinum, and the presence of a typical amplification curve indicates that the component was detected.
[0027] Figure 7 shows the fluorescence amplification curves of 11 samples in Comparative Example 1. The blue curve represents the FAM channel for detecting Lilium lancifolium, and a typical amplification curve indicates that the component was detected.
[0028] Figure 8 shows the fluorescence amplification curves of the four samples in Comparative Example 1. The blue curve represents the FAM channel for detecting Lilium lancifolium, and a typical amplification curve indicates that the component was detected.
[0029] Figure 9 shows the fluorescence amplification curves of the 7 samples in Comparative Example 2. The blue curve represents the FAM channel for detecting Lilium lancifolium, and a typical amplification curve indicates that the component was detected.
[0030] Figure 10 shows the fluorescence amplification curves of 10 samples in Comparative Example 3. The blue curve represents the FAM channel for detecting Lilium lancifolium, and a typical amplification curve indicates that the component was detected. Detailed Implementation
[0031] The following will provide a clear and complete description of the concept and technical effects of the present invention, so as to fully explain the purpose, solution and effects of the present invention.
[0032] To address the problem of poor DNA quality and difficulty in effective detection of deep-processed lily products, this invention proposes to sequence the circular chloroplast genomes of Lilium longiflorum and Lilium tigrinum, and design specific primers and probes based on the sequencing results to ensure accurate and reliable detection results in deep-processed lily products.
[0033] In the following embodiments, the primers and probes used are shown in Table 1.
[0034] Table 1 Primers and probes for simultaneous detection of Lilium tigrinum and Lilium tigrinum.
[0035]
[0036] The target genes for each primer and probe were selected from circular chloroplast DNA. After chloroplast genome sequencing and annotation analysis, the primers and probes were designed using Geneious Prime bioinformatics software. Gene sequencing and primer / probe assembly were both performed by Sangon Biotech (Shanghai) Co., Ltd.
[0037] Example 1
[0038] Whole genomes were extracted from leaves of *Lilium lancifolium* collected from a lily planting base in Wanzai County, bulbils of *Lilium tigrinum* collected from a lily plantation in Wanzai County, and powder of *Lilium lancifolium* purchased from a market in Wanzai County in June 2025. Using these whole genomes as DNA templates, a 25 μL reaction system was constructed using the primer set and probes shown in Table 1: the final concentrations of ccsA-ndhD-F, ccsA-ndhD-R, and ccsA-ndhD-P were all 1.0 μMol, and the final concentrations of ndhA-F, ndhA-R, and ndhA-P were all 0.25 μMol. A PCR mix of 12.5 μL, template of 5 μL, and distilled water were added to a final volume of 25 μL. Fluorescent PCR amplification was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing and extension for 15 s, for 45 cycles. Distilled water was used as a blank sample as a control.
[0039] The results after fluorescence PCR amplification are shown in Figures 1-4 and Table 2. It can be seen that fluorescence PCR can specifically amplify the target genes of Lilium lancifolium and Lilium tigrinum simultaneously, indicating that the detection method of the present invention has good specificity.
[0040] Table 2. Fluorescent PCR amplification information of each sample in Example 1, where a Ct value ≤ 40 indicates that the target component was detected, and N / A indicates that the target component was not detected.
[0041]
[0042] Example 2
[0043] Whole genomes were extracted from leaves of *Lilium lancifolium* and bulbils of *Lilium tigrinum* collected from the lily planting base in Wanzai County. Using these whole genomes as DNA templates, a 25 μL reaction system was constructed using the primer set and probes shown in Table 1: the final concentrations of ccsA-ndhD-F, ccsA-ndhD-R, and ccsA-ndhD-P were all 1.0 μmol; 12.5 μL of PCR mix was added; 5 μL of template was added; and distilled water was brought to a final volume of 25 μL. Fluorescent PCR amplification was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing and extension for 15 s; for 45 cycles. Distilled water was used as a blank sample as a control.
[0044] The results after fluorescence PCR amplification are shown in Figure 5 and Table 3. It can be seen that the fluorescence PCR targeting the gene of *Lilium tigrinum* can specifically amplify the target gene of *Lilium tigrinum*, and will not produce non-specific amplification for *Lilium tigrinum*. Moreover, the parallelism of the four parallel results of the two lilies is good, indicating that the primer and probe set for detecting *Lilium tigrinum* in this invention has good repeatability and specificity.
[0045] Table 3. Fluorescent PCR amplification information of each sample in Example 2, where a Ct value ≤ 40 indicates that the target component was detected, and N / A indicates that the target component was not detected.
[0046]
[0047] Example 3
[0048] Whole genomes were extracted from bulbils of *Lilium tigrinum* and leaves of *Lilium longiflorum* collected from the lily planting base in Wanzai County. Using these whole genomes as DNA templates, a 25 μL reaction system was constructed using the primer set and probes shown in Table 1: the final concentrations of ndhA-F, ndhA-R, and ndhA-P were all 0.25 μmol; 12.5 μL of PCR mix, 5 μL of template, and distilled water were added to a final volume of 25 μL. Fluorescent PCR amplification was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing and extension for 15 s, for 40 cycles. Distilled water was used as a blank sample as a control.
[0049] The results after fluorescence PCR amplification are shown in Figure 6 and Table 4. It can be seen that the fluorescence PCR targeting the gene of Lilium tigrinum can specifically amplify the target gene of Lilium tigrinum, and will not produce non-specific amplification for Lilium tigrinum. Moreover, the parallelism of the four parallel results of the two lilies is good, indicating that the primer and probe set for detecting Lilium tigrinum of the present invention has good repeatability and specificity.
[0050] Table 4 shows the fluorescence PCR amplification information of each sample in the examples, where a Ct value ≤ 35 indicates that the target component was detected, and N / A indicates that the target component was not detected.
[0051]
[0052] To compare with other primer sets and probes, the primers and probes shown in Table 5 were used for detection.
[0053] Table 5 Primers and probes used in the comparative examples
[0054]
[0055] Comparative Example 1
[0056] Whole genomes were extracted from leaves of *Lilium lancifolium* and bulbils of *Lilium tigrinum* collected from the lily planting base in Wanzai County. Using these whole genomes as DNA templates, a 25 μL reaction system was constructed using the primer sets and probes shown in Table 5: psbI-trnS(GCU)-trnG(GCC)-F, psbI-trnS(GCU)-trnG(GCC)-R, and psbI-trnS(GCU)-trnG(GCC)-P, with a final concentration of 1.0 μmol each. 12.5 μL of PCR mix, 5 μL of template, and distilled water were added to a final volume of 25 μL. Fluorescent PCR amplification was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing and extension for 15 s, for 45 cycles. Distilled water was used as a blank sample as a control.
[0057] The results after fluorescence PCR amplification are shown in Figures 7 and 8 and Table 6. It can be seen that when amplifying both Lilium longiflorum and Lilium tigrinum, they can be effectively amplified and produce fluorescence. This indicates that the primer set and probe are not specific enough to distinguish between Lilium longiflorum and Lilium tigrinum, and cannot meet the purpose of identification.
[0058] Table 6 shows the fluorescence PCR amplification information for each sample in the comparative example. A Ct value ≤ 40 indicates the detection of the target component, and N / A indicates that the target component was not detected.
[0059]
[0060] Comparative Example 2
[0061] Whole genomes were extracted from leaves of *Lilium lancifolium* and bulbils of *Lilium tigrinum* collected from the lily planting base in Wanzai County, as well as from powders of *Lilium lancifolium* and *Lilium tigrinum* purchased from the Wanzai County market in June 2025. Using these whole genomes as DNA templates, a 25 μL reaction system was constructed using the primer set and probes shown in Table 5: the final concentrations of ccsA-ndhD-2-F, ccsA-ndhD-2-R, and ccsA-ndhD-2-P were all 1.0 μmol, 12.5 μL of PCR mix, 5 μL of template, and distilled water to a final volume of 25 μL. Fluorescent PCR amplification was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing and extension for 15 s, for 45 cycles. Distilled water was used as a blank sample as a control.
[0062] The results after fluorescence PCR amplification are shown in Figure 9 and Table 7. It can be seen that when amplifying *Lilium lancifolium* and *Lilium tigrinum*, neither can be effectively amplified and produce fluorescence. This indicates that the primers and probes are too specific, and neither of the two lilies can be detected, thus failing to meet the purpose of identification.
[0063] Table 7 shows the fluorescence PCR amplification information for each sample in the comparative example, where a Ct value ≤ 40 indicates that the target component was detected, and N / A indicates that the target component was not detected.
[0064]
[0065] Comparative Example 3
[0066] Whole genomes were extracted from leaves of *Lilium lancifolium* collected from the Wanzai County lily planting base, bulbils of *Lilium tigrinum* collected from the same plantation, leaves of *Lilium lancifolium* purchased from Hunan Province, and leaves of *Lilium lancifolium* purchased from Lanzhou. Using these whole genomes as DNA templates, a 25 μL reaction system was constructed using the primer set and probes shown in Table 5: the final concentrations of LbAGPS1-F, LbAGPS1-R, and LbAGPS1-P were all 1.0 μmol; 12.5 μL of PCR mix, 5 μL of template, and distilled water were added to a final volume of 25 μL. Fluorescent PCR amplification was performed under the following conditions: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing and extension for 15 s; for 45 cycles. Distilled water was used as a blank sample as a control.
[0067] The results of fluorescence PCR amplification are shown in Figure 10 and Table 8. It can be seen that when amplifying Wanzai Longya Lily, Wanzai Lilium lancifolium, Hunan Longya Lily, and Lanzhou Cai Lily, they can all be effectively amplified and produce fluorescence. This indicates that the primer set and probe are not specific enough to distinguish Longya Lily from other lily varieties and cannot meet the purpose of identification.
[0068] Table 8 shows the fluorescence PCR amplification information for each sample in the comparative example, where a Ct value ≤ 40 indicates that the target component was detected, and N / A indicates that the target component was not detected.
[0069]
[0070] The above description is merely a preferred embodiment of the present invention. The present invention is not limited to the above-described embodiments. Any embodiment that achieves the technical effects of the present invention by the same or equivalent means should fall within the protection scope of the present invention. Within the protection scope of the present invention, various modifications and variations can be made to the technical solutions and / or implementation methods.
Claims
1. A primer composition for the simultaneous detection of *Lilium tigrinum* and *Lilium tigrinum*, characterized in that, The invention includes a primer set for detecting *Lilium tigrinum*, a probe for detecting *Lilium tigrinum*, and a primer set for detecting *Lilium tigrinum*, wherein the primer set for detecting *Lilium tigrinum* includes primers as shown in SEQ ID No. 1 and primers as shown in SEQ ID No. 2, and the probe for detecting *Lilium tigrinum* includes the sequence shown in SEQ ID No. 3; the primer set for detecting *Lilium tigrinum* includes primers as shown in SEQ ID No. 4 and primers as shown in SEQ ID No. 5, and the probe for detecting *Lilium tigrinum* includes the sequence shown in SEQ ID No.
6.
2. The primer composition for simultaneous detection of *Lilium tigrinum* and *Lilium tigrinum* according to claim 1, characterized in that, The probe used to detect Lilium tigrinum is FAM-CGAAATCAAATGATTCGCAAAAACTCGAGATA-TAMRA, and the probe used to detect Lilium tigrinum is HEX-ATTATTATAGGTATCTTTGTGGGGTGGGGT-BHQ1.
3. The primer composition for simultaneous detection of *Lilium tigrinum* and *Lilium tigrinum* according to claim 1, characterized in that, The dragon tooth lily mentioned is the Wanzai dragon tooth lily.
4. A kit for simultaneously detecting Lilium tigrinum and Lilium tigrinum, characterized in that, Includes the primer composition for simultaneous detection of Lilium tigrinum and Lilium tigrinum as described in any of claims 1-3.
5. The kit for simultaneously detecting Lilium tigrinum and Lilium tigrinum according to claim 4, characterized in that, The kit for simultaneously detecting Lilium longiflorum and Lilium tigrinum also includes dNTPs, Taq DNA polymerase, and buffer.
6. The kit for simultaneously detecting Lilium tigrinum and Lilium tigrinum according to claim 4, characterized in that, The kit for simultaneously detecting Lilium tigrinum and Lilium tigrinum also includes a PCR mix.
7. A method for simultaneously detecting *Lilium tigrinum* and *Lilium tigrinum*, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; Using the genomic DNA as a template, a duplex fluorescence PCR amplification is performed in a reaction system containing the primer composition for simultaneous detection of *Lilium tigrinum* and *Lilium tigrinum* as described in claim 2. Based on the duplex fluorescence PCR amplification results, it is determined whether the sample to be tested contains *Lilium tigrinum* components and / or *Lilium tigrinum* components. If a typical amplification curve appears in the FAM fluorescence channel, the sample to be tested contains *Lilium tigrinum* components; if a typical amplification curve appears in the HEX fluorescence channel, the sample to be tested contains *Lilium tigrinum* components.
8. The method according to claim 7, characterized in that, The procedure for the dual fluorescence PCR amplification includes: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s; 60℃ annealing extension for 15s; 45 cycles.