Dicamba monooxygenase mutant DicX4M2 and application thereof

Abstract

The invention relates to a dicamba monooxygenase mutant DicX4M2 and application of the dicamba monooxygenase mutant DicX4M2. In particular to a dicamba monooxygenase mutant DicX4M2, a gene for coding the dicamba monooxygenase mutant DicX4M2, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for improving the activity of the dicamba monooxygenase, a method for preparing the dicamba monooxygenase mutant DicX4M2 and application of the dicamba monooxygenase mutant DicX4M2 and the dicamba monooxygenase mutant DicX4M2. Compared with the wild type dicamba monooxygenase, the dicamba monooxygenase mutant DicX4M2 obtained after the 82nd histidine of the wild type dicamba monooxygenase is replaced with isoleucine and the 190th phenylalanine of the wild type dicamba monooxygenase is replaced with leucine has the advantages that the enzyme activity is obviously improved, and the dicamba monooxygenase mutant DicX4M2 has a better dicamba degradation effect; the dicamba-resistant crops can be prepared, and the dicamba resistance of the crops is improved.

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, specifically to a dicamba monooxygenase mutant DicX4M2, a gene encoding the dicamba monooxygenase mutant DicX4M2, a recombinant vector into which the gene is inserted, a transformant into which the gene is transformed, a method for improving dicamba monooxygenase activity, a method for preparing the dicamba monooxygenase mutant DicX4M2, and their applications. Background Technology

[0002] Herbicides are widely used to control harmful plants such as weeds, shrubs, and trees in farmland, orchards, flower nurseries, and grasslands. The invention and use of herbicides have greatly promoted the development of modern agriculture, especially in crop production where herbicides are used extensively. This has significantly reduced the cost of manual weeding, mitigated the risk of crop yield reduction due to competition from weeds, and improved agricultural production efficiency. However, herbicides lack selectivity, sometimes causing phytotoxicity to the primary crop, subsequent crops, or other crops in adjacent fields. Highly selective herbicides, on the other hand, often have a narrow spectrum of activity, failing to control multiple weeds simultaneously. These limitations restrict their application. With the development of biotechnology, the use of plant genetic engineering to create herbicide-tolerant crops has largely solved these problems, significantly changing agricultural production patterns.

[0003] Dicamba, also known as dicamba herbicide, is a selective and systemic post-emergence auxin herbicide. Developed in 1961 by Velscool Chemical Corporation in the United States, its chemical name is 3,6-dichloro-2-methoxybenzoic acid (CAS: 1918-00-9), and its molecular weight is 221.04. At room temperature, its solubility in water is 6.5 g / L. It should be stored in a dry, airtight, cool, and dark place. It is chemically stable. Dicamba is a broad-spectrum broadleaf herbicide used for post-emergence spraying. It is rapidly absorbed by the leaves, stems, and roots of weeds and translocated upwards and downwards through the phloem and xylem. It inhibits the normal activity of plant hormones, causing physiological disorders in weeds, stem twisting and deformities, leaf wrinkling and discoloration, ultimately leading to weed death. It is particularly effective in controlling annual and perennial broadleaf weeds during crop growth. Because dicamba is effective, has low production costs, is environmentally friendly, and is virtually non-toxic to wild organisms and humans, it has been widely used to control weeds in fields.

[0004] However, dicamba may also cause herbicide damage to crops in the main field, or to subsequent crops and other crops in adjacent fields, affecting crop growth.

[0005] dicThe X4 gene (described in patent 201910977573.2) is a gene encoding dicamba monooxygenase obtained from microbial metagenomic data of soil samples around a pharmaceutical factory in southern China. This gene catalyzes the demethoxylation of dicamba molecules, thereby neutralizing the herbicidal activity of dicamba. However, the activity of dicamba monooxygenase still needs further improvement. Summary of the Invention

[0006] The purpose of this disclosure is to provide a dicamba monooxygenase mutant, DicX4M2, a gene encoding the dicamba monooxygenase mutant DicX4M2, a recombinant vector containing the gene, a transformant containing the gene, a method for improving dicamba monooxygenase activity, a method for preparing the dicamba monooxygenase mutant DicX4M2, and their applications. The dicamba monooxygenase mutant DicX4M2 disclosed in this disclosure exhibits significantly enhanced activity.

[0007] To achieve the above objectives, the first aspect of this disclosure provides a dicamba monooxygenase mutant, DicX4M2, the amino acid sequence of which is shown in SEQ ID NO: 1; The mutant DicX4M2 is formed by replacing histidine at position 82 with isoleucine and phenylalanine at position 190 with leucine in the wild-type dicamba monooxygenase.

[0008] The second aspect of this disclosure provides a gene encoding the mutant DicX4M2 described in the first aspect, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0009] A third aspect of this disclosure provides a recombinant vector, which is a recombinant expression vector, wherein the recombinant vector is inserted with the gene described in the second aspect.

[0010] This disclosure provides a fourth aspect of a transformant, wherein the gene introduced into the transformant includes the gene described in the second aspect, or the transformant contains the recombinant vector described in the third aspect.

[0011] Optionally, the host of the transformant is any one of Escherichia coli, yeast, and Bacillus subtilis.

[0012] The fifth aspect of this disclosure provides a method for improving the activity of dicamba monooxygenase, the method comprising replacing histidine at position 82 of wild-type dicamba monooxygenase with isoleucine and phenylalanine at position 190 with leucine.

[0013] The sixth aspect of this disclosure provides a method for preparing the dicamba monooxygenase mutant DicX4M2, the method comprising: inoculating the transformant described in the fourth aspect into a culture medium for cultivation to obtain the cultured material.

[0014] Optionally, the culture conditions include: a temperature of 35-38℃ and a time of 24-72h; The culture medium is selected from LB medium and / or MSM medium.

[0015] The seventh aspect of this disclosure provides the use of the dicamba monooxygenase mutant DicX4M2 described in the first aspect in the preparation of dicamba-resistant crops.

[0016] This disclosure provides, in its eighth aspect, the use of the gene described in the second aspect, the recombinant vector described in the third aspect, or the transformant described in the fourth aspect in the preparation of dicamba-resistant crops.

[0017] By using the above technical solution, the dicamba monooxygenase mutant DicX4M2, obtained by replacing histidine at position 82 with isoleucine and phenylalanine at position 190 with leucine, has significantly increased enzyme activity compared with wild-type dicamba monooxygenase, and has a better effect on degrading dicamba; it can produce dicamba-resistant crops and improve the crop's resistance to dicamba.

[0018] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0019] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a plate chart for screening dicamba mutants, where a represents BW25113; b represents BW- ddm A1- ddm B; c represents BW- ddm A1- ddm B- dic X4; d represents BW- ddm A1- ddm B- dic X4M2.

[0020] Figure 2 This is a test chart of the DCSA standard sample.

[0021] Figure 3 It's BW- ddm A1- ddm B- dic Graph showing the detection of DCSA content in X4 recombinant Escherichia coli samples.

[0022] Figure 4 It's BW- ddm A1- ddm B-dic Graph showing the detection of DCSA content in X4M2 recombinant Escherichia coli samples. Detailed Implementation

[0023] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0024] The first aspect of this disclosure provides a dicamba monooxygenase mutant, DicX4M2, the amino acid sequence of which is shown in SEQ ID NO: 1; The mutant DicX4M2 is formed by replacing histidine at position 82 with isoleucine and phenylalanine at position 190 with leucine in the wild-type dicamba monooxygenase.

[0025] The inventors of this disclosure discovered that the dicamba monooxygenase mutant DicX4M2, obtained by replacing histidine at position 82 with isoleucine (His82Ile / H82I) and phenylalanine at position 190 with leucine (Phe190Leu / F294L) in wild-type dicamba monooxygenase, exhibits significantly increased enzyme activity and better dicamba degradation effect compared to wild-type dicamba monooxygenase.

[0026] The amino acid sequence of wild-type dicamba monooxygenase is shown in SEQ ID NO: 2, and the nucleotide sequence is shown in SEQ ID NO: 4.

[0027] The second aspect of this disclosure provides a gene encoding the mutant DicX4M2 described in the first aspect, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0028] A third aspect of this disclosure provides a recombinant vector, which is a recombinant expression vector, wherein the recombinant vector is inserted with the gene described in the second aspect.

[0029] This disclosure provides a fourth aspect of a transformant, wherein the gene introduced into the transformant includes the gene described in the second aspect, or the transformant contains the recombinant vector described in the third aspect.

[0030] Optionally, the host of the transformant is any one of Escherichia coli, yeast, and Bacillus subtilis.

[0031] The fifth aspect of this disclosure provides a method for improving the activity of dicamba monooxygenase, the method comprising replacing histidine at position 82 of wild-type dicamba monooxygenase with isoleucine and phenylalanine at position 190 with leucine.

[0032] The sixth aspect of this disclosure provides a method for preparing the dicamba monooxygenase mutant DicX4M2, the method comprising: inoculating the transformant described in the fourth aspect into a culture medium for cultivation to obtain the cultured material.

[0033] In one embodiment, the culture conditions include: a temperature of 35-38°C and a time of 24-72 hours; preferably, a temperature of 37°C and a time of 48 hours. The culture medium is selected from LB medium and / or MSM medium.

[0034] The seventh aspect of this disclosure provides the use of the dicamba monooxygenase mutant DicX4M2 described in the first aspect in the preparation of dicamba-resistant crops.

[0035] This disclosure provides, in its eighth aspect, the use of the gene described in the second aspect, the recombinant vector described in the third aspect, or the transformant described in the fourth aspect in the preparation of dicamba-resistant crops.

[0036] In this disclosure, introducing the gene encoding the dicamba monooxygenase mutant DicX4M2, a recombinant vector containing the dicamba monooxygenase mutant DicX4M2, or a transformant into crops can produce crops with dicamba resistance, thereby improving the crops' resistance to dicamba. These crops include, but are not limited to, tobacco, soybeans, and cotton.

[0037] The present disclosure will be further illustrated by the following examples, but the present disclosure is not limited thereto.

[0038] All raw materials used in the embodiments can be obtained through commercial purchase.

[0039] Example 1 This embodiment is used to illustrate BW- ddm A1- ddm Construction of recombinant Escherichia coli B: Dicamba O-demethylase (DMO) consists of three components (reductase DIC (…)). ddm A1), iron-sulfur protein DIC ( ddm B) and oxygenase DIC ( dic X4), only when all three components are combined can significant O-demethylase activity be detected. Since *E. coli* lacks reductase and iron-sulfur protein components, these two components need to be integrated into the *E. coli* genome. dic After X4 was mutated, a recombinant vector was constructed and transformed into E. coli to screen for suitable mutants.

[0040] Genes ddm A1 and ddm B is integrated into the E. coli genome and mainly consists of two parts: 1. Based on CRISPR-Cas9 gene editing technology, the target site of the BW25113 genome in chassis cells was cut, resulting in double-stranded DNA breaks (DSBs) at the target site. 2. The target gene is knocked into the genome via homologous recombination at the DSB using the λ-RED homologous recombination system. This system mainly consists of two plasmids: pTargetF and pCas#62225. The pTargetF plasmid primarily expresses gRNA to guide the Cas9 protein in targeting and cleaving the BW25113 genome; the pCas#62225 plasmid primarily expresses the Cas9 protein and the λ-RED homologous recombination system for targeted cleavage and subsequent homologous recombination knock-in of the fusion fragment.

[0041] The main experimental steps are as follows: S1. Take the frozen product stored at -80℃. Escherichia coli BW25113 ( E. coli BW25113 was inoculated onto LB solid medium using the streak plate method and incubated upside down in a 37°C incubator for 18 hours to grow single colonies. S2, Pick E.coli Single colony of BW25113 was cultured at 37°C and 220 rpm on a shaker until OD200 was reached. 600 =0.6-0.8, centrifuge at 4℃ and 8000rpm for 3 min to collect bacterial cells, and wash twice with pre-chilled 12% glycerol on ice under the same conditions. Finally, resuspend the bacterial cells in 100μL of pre-chilled 12% glycerol. At this point, the bacterial cells are obtained. E.coli BW25113 competent cells are ready for immediate transformation. They can be used experimentally or stored at -80°C. S3, in E.coli Add 400 ng of pCas#62225 plasmid to BW25113 competent cells, mix gently, and add to a pre-chilled 0.2 cm electroporation cuvette. Electroporate at 2000 V, 25 μF, and 200 Ω. Then add 900 μL of LB liquid medium to the electroporated cells and incubate at 30°C and 220 rpm for 2-3 hours. Spread the culture onto LB (Kan) agar plates and incubate upside down at 30°C for 24 hours to obtain cells containing pCas#62225 plasmid. E. coli BW25113 strain BW-pCas; S4. Pick single colonies of BW-pCas and incubate them in LB (Kan) liquid medium at 30°C and 220 rpm until OD. 600=Approximately 0.4, add 0.1mM IPTG and culture for 1 hour to induce expression of the λ-RED homologous recombination system. Then, prepare BW-pCas into competent cells using the same method as step S2. The competent cells can be used directly or stored in a -80℃ freezer. S5. Take BW-pCas competent cells induced by arabinose, add 400 ng of gene fusion fragment (gene + upstream and downstream homologous arms) and 200 ng of pTargetF- yjiP_yjiR After plasmidization, electroporation can be performed. The electroporation program settings and subsequent incubation process are the same as shown in step S3. The incubated culture is spread on LB (Kan+Spec) solid plates and incubated upside down at 30°C for 24 hours to obtain single colonies after electroporation. S6. Colony PCR screening was conducted to identify positive clones with the target fragment successfully knocked into them. The PCR products were then sequenced to further confirm the positive clones. S7. Plasmid elimination was performed on the selected positive clones. First, single colonies were picked and incubated in LB (Kan) liquid medium supplemented with 0.2% arabinose for 12 hours at 30°C and 220 rpm to eliminate the pTargetF plasmid. Then, the bacterial culture was transferred to LB liquid medium at a 1% inoculum and incubated at 37°C and 220 rpm for 18 hours to eliminate the pCas#62225 plasmid, resulting in integrated plasmids. ddm A1 and ddm B gene strain BW- ddm A1 -ddm B. Design primers to validate the integration results.

[0042] Example 2 This embodiment is used to illustrate BW- ddm A1 -ddm B- dic Construction of X4 recombinant Escherichia coli: Constructing plasmid pACYC184- dic The experimental steps for building X4 are as follows: 1. The vector was linearized by double digestion of the empty vector plasmid pACYC184. The reaction system is shown in Table 1.

[0043] Table 1. Double enzyme digestion reaction system

[0044] Note: The enzyme volume should not exceed 10% of the total reaction volume (37℃, 45min).

[0045] The digested products were recovered using agarose gel electrophoresis (the number of bases in the insert fragment was 1397 bp, and the number of bases in the cloning vector was 5042 bp).

[0046] Reorganization: The optimal amount of cloning vector used in the ClonExpress II recombination reaction system is 0.03 pmol, and the optimal amount of insert fragment is 0.06 pmol (vector to insert molar ratio is 1:2). The DNA mass corresponding to these molar amounts can be roughly calculated using the following formula: Optimal cloning vector usage = [0.02 × number of cloning vector base pairs] ng (0.03 pmol); The optimal amount of insert fragment used = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol).

[0047] 2. Utilizing homologous arms containing enzyme cleavage sites upstream and downstream ( Xba Upstream and Kpn downstream primer pair dic PCR was performed on the X4 gene.

[0048] F: ATCTGTGTCCGGAGGTCTAGATTGACAGCTAGCTCAGTCCTAGGTA (SEQ ID NO: 5); R: TGCAGGTGATCCCCGGGTACCTCAGCCGCGCAGACCCGT (SEQ ID NO: 6).

[0049] The reaction system is shown in Table 2: Table 2

[0050] 3. (1) Ligate the linearized vector and the insert fragment to construct the recombinant plasmid pACYC184- dic X4, the reaction system is shown in Table 3: Table 3 Recombinant plasmid construction system

[0051] (2) Use a pipette to gently aspirate and mix (do not shake to mix), and briefly centrifuge to collect the reaction solution to the bottom of the tube.

[0052] (3) React at 37℃ for 30 min; then cool to 4℃ or immediately place on ice to cool.

[0053] (4) Thaw cloned competent Escherichia coli BW- on ice ddm A1 -ddm B. Add 10 μL of recombinant product to 100 μL of competent cells, gently tap the tube wall to mix (do not shake to mix), and incubate on ice for 30 min. (Note: The transformation volume of recombinant product should not exceed 1 / 10 of the volume of competent cells used).

[0054] (5) After heat shock in a 42℃ water bath for 45 seconds, immediately place it on ice to cool for 3 minutes.

[0055] (6) Add 900 μL SOC or LB medium (without antibiotics) and shake at 37°C for 1 h (200 rpm).

[0056] (7) Preheat the LB solid medium plates with the corresponding resistance in an incubator at 37°C.

[0057] (8) Centrifuge at 5000 rpm (2400×g) for 5 min and discard 900 μL of supernatant. Resuspend the bacterial cells in the remaining culture medium and spread them evenly on a plate containing Tc using a sterile spreader. Incubate upside down in a 37℃ incubator for 16 h.

[0058] (9) Select several clones from the recombinant reaction transformation plate for colony PCR identification. Obtain recombinant Escherichia coli BW- ddm A1- ddm B- dic X4.

[0059] Example 3 This embodiment is for illustration. dic Construction of the X4 gene mutant library and screening of enzymes with high resistance to dicamba herbicide: pACYC184- dic Using X4 plasmid as a template, the QuickMutation™ random gene mutation kit was used to... dic The X4 gene underwent random mutation PCR. The PCR product was recovered using a PCR product recovery kit and ligated into the pACYC184 linearized plasmid according to the method in Example 2. The ligation product was then transformed into BW- ddm A1- ddm Recombinant E. coli B was screened by plating on plates containing Tc. Positive clones were then plated on LB plates containing Tc and LB plates containing dicamba, respectively, using BW- ddm A1- ddm B- dic X4 recombinant *E. coli* served as a control. Wild-type *E. coli* showed no growth susceptibility at 50 mM dicamba concentration, but its tolerance to 3,6-dichlorosalicylic acid (DCSA, a dicamba degradation product) was an order of magnitude lower. If dicamba monooxygenase in the strain degrades dicamba to DCSA, leading to intracellular DCSA accumulation, it will inhibit cell growth. Theoretically, the higher the enzyme activity level, the faster the cell growth will be inhibited. Therefore, a reverse selection method can be used to screen for highly dicamba-resistant mutants.

[0060] 1. dic PCR reaction for random mutations in the X4 gene: Primer sequences: F: ATCTGTGTCCGGAGGTCTAGATTGACAGCTAGCTCAGTCCTAGGTASEQ ID NO: 5); R: TGCAGGTGATCCCCGGGTACCTCAGCCGCGCAGACCCGT (SEQ ID NO: 6).

[0061] The PCR reaction system is shown in Table 4 below: Table 4

[0062] 2. dic Construction of X4 mutant recombinant E. coli: The method is the same as in Example 2.

[0063] 3. Screening for mutants with high resistance to dicamba: Positive clones growing on LB(Tc) plates were picked and inoculated into 96-well plates containing LB(Tc) medium and 96-well plates containing LB(Dicamba) medium, respectively. The plates were incubated at 37°C with shaking for 48 hours. Colonies with poor or slow growth in LB(Dicamba) medium were selected from the corresponding wells of another 96-well plate and plated onto LB plates containing Tc and LB plates containing dicamba for verification (using BW-). ddm A1- ddm B- dic (X4 recombinant E. coli was used as a control) Figure 1 The plasmid was extracted and DNA sequencing analysis was performed. A resistant mutant was obtained, which has two amino acid mutation sites: amino acid at position 82 is mutated from histidine to isoleucine, and amino acid at position 190 is mutated from phenylalanine to leucine. This mutant was named DicX4M2.

[0064] Example 4 This example illustrates the determination of the catalytic activity of the DicX4M2 mutant enzyme: The changes in the content of dicamba degradation product DCSA in recombinant Escherichia coli culture medium containing the DicX4M2 mutant enzyme were determined by liquid chromatography-mass spectrometry (control group was recombinant Escherichia coli containing wild-type dicamba monooxygenase DicX4).

[0065] (1) Activate the control strain and the recombinant engineered strain by streaking them onto LB solid medium plates; (2) Pick a single colony and inoculate it into liquid LB medium containing the corresponding antibiotic, and incubate at 37°C until the mid-to-late stage of the exponential growth. (3) Centrifuge at 4000 rpm for 4 min to collect the bacterial cells, resuspend them in MSM medium and wash them twice; (4) The strain was resuspended in 50 mL of MSM medium containing 500 mg / L dicamba; (5) Collect bacteria after 48 hours of incubation and measure OD. 600 Samples were taken for liquid chromatography-mass spectrometry (LC-MS) determination of DCSA content in the culture medium.

[0066] Chromatographic conditions: Column: ZORBAX Eclipse Plus C18 Rapid Resolution 4.6x100mm 3.5-Micron; Oven temperature: 35℃; Injection volume: 5.0μL. The mobile phase and linear elution gradient are shown in Table 5.

[0067] Mass spectrometry conditions: negative ion mode using an electrospray ionization source; determination; ion source temperature: 250℃; desolvent gas temperature: 350℃; desolvent gas flow rate: 11.0 L·min -1 Quadrupole temperature: 100℃.

[0068] Table 5

[0069] Test results as follows Figures 2 - 4 As shown, in BW- ddm A1- ddm B- dic X4 recombinant E. coli and BW- ddm A1- ddm B- dic DCSA characteristic peaks were observed in all X4M2 recombinant E. coli, indicating that some dicamba was degraded into DCSA within 48 hours, and BW- ddm A1- ddm B- dic The DCSA content in X4M2 recombinant E. coli was significantly higher than that in BW- ddm A1- ddm B- dic The DCSA content in recombinant E. coli X4 was analyzed. In summary, compared with the control group, the degradation rate of the DicX4M2 mutant enzyme was higher, indicating that the DicX4M2 mutant enzyme has higher activity.

[0070] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0071] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0072] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A dicamba monooxygenase mutant, DicX4M2, characterized in that, The amino acid sequence of the mutant DicX4M2 is shown in SEQ ID NO: 1; The mutant DicX4M2 is formed by replacing histidine at position 82 with isoleucine and phenylalanine at position 190 with leucine in the wild-type dicamba monooxygenase.

2. The gene encoding the mutant DicX4M2 of claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:

3.

3. A recombinant vector, characterized in that, The recombinant vector is a recombinant expression vector, and the recombinant vector is inserted with the gene described in claim 2.

4. A transformant, characterized in that, The gene introduced into the transformant includes the gene described in claim 2, or the recombinant vector described in claim 3 is introduced into the transformant.

5. The transformant according to claim 4, wherein, The host of the transformant is any one of Escherichia coli, yeast, and Bacillus subtilis.

6. A method for increasing the activity of dicamba monooxygenase, characterized in that, This method involves replacing histidine at position 82 of wild-type dicamba monooxygenase with isoleucine and phenylalanine at position 190 with leucine.

7. A method for preparing the dicamba monooxygenase mutant DicX4M2, characterized in that, The method includes: inoculating the transformant according to claim 4 or 5 into a culture medium for cultivation to obtain the cultured material.

8. The method according to claim 7, wherein, The culture conditions include: a temperature of 35-38℃ and a time of 24-72h; The culture medium is selected from LB medium and / or MSM medium.

9. The use of the dicamba monooxygenase mutant DicX4M2 according to claim 1 in the preparation of dicamba-resistant crops.

10. The use of the gene of claim 2, the recombinant vector of claim 3, or the transformant of claim 4 in the preparation of dicamba-resistant crops.

Images