Product and method for improving yield of breviscapine in plant and method for constructing tobacco synthetic biological chassis of breviscapine

Abstract

The invention relates to the technical field of gene engineering, in particular to a product and a method for improving the yield of breviscapine in a plant body and a construction method of a tobacco synthetic biological chassis of breviscapine. The invention provides an application of any one or more gene sequences as shown in SEQ ID NO.1-SEQ ID NO.6 in improving the yield of breviscapine in a plant. The application comprises the following steps: connecting any one or more gene sequences as shown in SEQ ID NO.1-SEQ ID NO.6 with a pCAMBIA1302 vector to obtain a recombinant expression vector; transforming the recombinant expression vector into agrobacterium to obtain recombinant bacteria; a bacterial suspension of the recombinant bacteria is utilized to infect a plant to obtain a high-yield breviscapine plant, the yield of scutellarin in an obtained transgenic tobacco plant reaches 42.09 mu g / g DW, and a foundation is laid for efficient heterologous synthesis of breviscapine in tobacco.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a product, method for increasing the yield of scutellarin in plants, and a method for constructing a tobacco biosynthetic chassis for scutellarin. Background Technology

[0002] Erigeron breviscapus, also known as Erigeron breviscapus, is a plant belonging to the Asteraceae family. Erigeron breviscapus(Vant.) Hand.-Mazz. The dried whole herb of *Erigeron breviscapus*. *Erigeron breviscapus* contains various active ingredients, with nearly 200 compounds isolated to date. Flavonoids and their glycosides, polysaccharides, and caffeoyl compounds are the main active components. Scutellarin is a mixture of flavonoid compounds extracted from *Erigeron breviscapus*. Scutellarin B, or baicalin (SCU), is the main active substance of *Erigeron breviscapus*, possessing rich pharmacological effects, including vasodilation, nerve protection, and inhibition of platelet aggregation. It has good therapeutic effects on cerebral ischemia-reperfusion injury, tumors, osteoarthritis, atherosclerosis, and Alzheimer's disease. Especially in tumor treatment, scutellarin B has good inhibitory effects on breast cancer, lung cancer, liver cancer, prostate cancer, gastric cancer, and melanoma.

[0003] The sources of scutellarin are limited, and relying solely on traditional plant extraction methods cannot meet market demand. To address this issue, researchers have been continuously studying the synthetic pathway of scutellarin. One study, using genomics and synthetic biology methods, constructed a complete synthetic pathway of scutellarin in *Saccharomyces cerevisiae*, identifying the key enzyme flavonoid-7-O-glucuronide transferase (FGLP-7-O-glucuronide) from *Scutellaria baicalensis*. EbF7GAT ) and flavonoid-6-hydroxylase ( EbF6H Through metabolic engineering optimization, the engineered strain was able to directly produce baicalin and apigenin-7-O-glucuronide, the main active components of scutellarin, from glucose, with yields reaching 108 mg / L. - ¹With 185 mg / L - ¹. In *Yarrowia lipolytica*, existing technology uses CRISPR / Cas9 for multi-round gene integration, achieving a baicalin yield of 346 mg / L in the fermenter. Subsequently, researchers screened highly active P450 enzyme combinations ( SbF6H-ATR2 The introduction of heterologous hemoglobin to improve oxygen supply ultimately yielded a maximum production of 703 mg / L in shake flasks. In addition, other studies have utilized plants as a chassis to produce scutellarin, identifying a naturally occurring scutellarin precursor in Artemisia annua and heterologously expressing flavonoid synthase II from Erigeron breviscapus. EbFNSII ), flavonoid-6-hydroxylase ( EbF6H ) and flavonoid-7-O-glucuronyltransferase ( EbF7GAT( ), successfully synthesized scutellarin from Artemisia annua. Further research was conducted using scutellaria baicalensis-derived... SbF6H It significantly increased yield (up to 0.64 mg / g dry weight) without affecting artemisinin synthesis. This provides a new strategy for the rapid, large-scale production of plant natural products.

[0004] Tobacco is a commonly used substrate plant for synthetic biology, possessing unique advantages in the synthesis of flavonoids. It is rich in phenylpropanoid precursors, such as naringenin and apigenin, which provide a solid metabolic foundation for the biosynthesis of flavonoids. Furthermore, Nicotiana benthamiana and Nicotiana commonifolia, among other tobacco varieties, have high economic value, relatively short growth cycles, suitability for genetic transformation, good disease and stress resistance, and can be cultivated on a large scale. They are currently widely used in various synthetic biology experiments.

[0005] Utilizing tobacco as a biological chassis plant to synthesize scutellarin has significant biological implications, and based on this, this invention is proposed. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a product, a method for increasing the yield of scutellarin in plants, and a method for constructing a tobacco biosynthetic chassis for scutellarin.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of any one or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 in increasing the yield of scutellarin in plants. The gene sequences are ligated with the pCAMBIA1302 vector to obtain a recombinant expression vector; the recombinant expression vector is transformed into Agrobacterium to obtain recombinant bacteria; and plants are infected with a suspension of the recombinant bacteria to obtain plants that produce high yields of scutellarin.

[0008] Preferably, the gene sequence described in SEQ ID NO.1 is the stellol synthase gene from *Erigeron breviscapus*. The gene sequence described in SEQ ID NO.2 is the charone isomerase gene of *Erigeron breviscapus*. The gene sequence described in SEQ ID NO.3 is the flavonoid synthase II gene from *Erigeron breviscapus*. The gene sequence described in SEQ ID NO.4 is the 7-O-glucuronide transferase gene of *Erigeron breviscapus* flavonoids; The gene sequence described in SEQ ID NO.5 is the *Erigeron breviscapus* uridine diphosphate glucose dehydrogenase gene; The gene sequence described in SEQ ID NO.6 is the 6-hydroxylase gene of scutellaria baicalensis flavonoids.

[0009] Preferably, the Agrobacterium is Agrobacterium GV3101; OD of the bacterial suspension of the recombinant bacteria 600 It ranges from 0.5 to 0.7.

[0010] Preferably, the plant is tobacco.

[0011] The present invention also provides an expression cassette for increasing the production of scutellarin in plants, comprising any one of the following: (1) Recombinant expression vector; (2) Recombinant bacteria; The recombinant expression vector is constructed by ligating any one or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 with the pCAMBIA1302 vector. The method for constructing the recombinant bacteria is as follows: transforming any one or more gene sequences shown in SEQ ID NO.1~SEQ ID NO.6 into Agrobacterium GV3101; or transforming the recombinant expression vector described in (1) into Agrobacterium GV3101.

[0012] The present invention also provides the application of the expression cassette in increasing the yield of scutellarin in plants.

[0013] The present invention also provides a method for increasing the yield of scutellarin in plants, comprising the following steps: Transform one or more of the gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 into a plant; or transform any one of the expression cassettes described in claim 5 into a plant.

[0014] This invention also provides a method for constructing a tobacco synthetic biology chassis for scutellarin, comprising the following steps: One or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 are ligated to the pCAMBIA1302 vector to obtain a recombinant expression vector; the recombinant expression vector is transformed into Agrobacterium to obtain recombinant bacteria; tobacco is infected using a bacterial suspension of the recombinant bacteria.

[0015] Preferably, the Agrobacterium is Agrobacterium GV3101; OD of the bacterial suspension of the recombinant bacteria 600 It ranges from 0.5 to 0.7.

[0016] The present invention also provides the application of primer pairs for detecting the expression levels of any one or more genes shown in SEQ ID NO.1 to SEQ ID NO.6 in screening superior varieties with high yield of scutellarin, and the primer pairs for detecting the expression level of gene SEQ ID NO.1 are shown in SEQ ID NO.31 to SEQ ID NO.32; The primer pairs for detecting the expression level of the gene in SEQ ID NO.2 are shown in SEQ ID NO.33~SEQ ID NO.34; The primer pairs for detecting the expression level of the gene in SEQ ID NO.3 are shown in SEQ ID NO.35~SEQ ID NO.36; The primer pairs for detecting the expression level of the gene in SEQ ID NO.4 are shown in SEQ ID NO.37~SEQ ID NO.38; The primer pairs for detecting the expression level of the gene in SEQ ID NO. 5 are shown in SEQ ID NO. 39~SEQ ID NO. 40; The primer pairs for detecting the expression level of the gene SEQ ID NO.6 are shown in SEQ ID NO.41~SEQ ID NO.42.

[0017] The present invention has the following advantages: (1) By transiently expressing six genes related to the synthesis of scutellarin in Tobacco Benzoin, this invention successfully obtained transgenic tobacco plants that can be stably inherited. The highest yield of baicalin reached 42.09 μg / g DW. This invention created a stable genetic material for the heterologous synthesis of scutellarin in cultivated tobacco, laying the foundation for the efficient heterologous synthesis of scutellarin in tobacco and opening up a new path for the production of natural products.

[0018] (2) This invention also clarified the functional characteristics of 6 genes in the scutellarin synthesis pathway: Scutellaria baicalensis flavonoid synthase II gene EbFNSII Playing the most important role, further steps can be taken to knock out other flavonoid pathway genes and screen for those with higher activity. EbFNSII Homologous genes are used to increase product yield; the secondary key enzyme is the 7-O-glucuronide transferase gene of *Erigeron breviscapus* flavonoids. EbF7GAT As the "core functional enzyme" of the pathway, it directly determines whether the target product is generated and its purity, and is an indispensable key component of the pathway. The *Dendrobium nobile* uridine diphosphate glucose dehydrogenase gene... EbUDPGDH It merely provides auxiliary materials for the reaction, and its function can be compensated by endogenous metabolism in the host. Its necessity and regulatory value for the pathway are significantly lower than that of other substances. EbF7GAT ; Erigeron breviscapus flavonoid 6-hydroxylase gene EbF6H It is a key rate-limiting enzyme in the biosynthetic pathway of ligustrazine, and its catalytic efficiency and substrate specificity have a significant impact on the yield of the target product.EbF6H The source of the catalyst significantly affects the yield of scutellarin, so a heterogeneous source with high catalytic activity is selected. EbF6H It can effectively increase production. Attached Figure Description

[0019] Figure 1 This describes the synthetic pathway of scutellarin and related flavonoids; Figure 2 This is a schematic diagram of the structure of the pCAMBIA1302 series of plant recombinant expression vectors; Figure 3 The standard curves for each compound are shown below (a is the standard curve for naringenin, b is the standard curve for apigenin, c is the standard curve for apigenin-7-O-glucuronide, and d is the standard curve for baicalin). Figure 4 For vector digestion and cloning of target gene fragments; Figure 5 Subcellular localization maps of each gene; Figure 6 Genetic transformation of tobacco; Figure 7 The results of the detection of the target gene in transgenic tobacco and wild-type plants; Figure 8 These are the results of quantitative real-time PCR detection of transgenic tobacco lines; Figure 9 This is a diagram showing the growth results of transgenic tobacco in group S6; Figure 10 This is a qualitative detection result from liquid chromatography-mass spectrometry; Figure 11 The results of the detection of the target products in each group of transgenic plants; Figure 12 This is a heatmap showing the distribution of flavonoid compounds in genetically modified tobacco. Detailed Implementation

[0020] In this invention, the chalcone synthase gene from *Erigeron breviscapus* is used. EbCHS ( Erigeron breviscapus Chalcone Synthase

[0021] In the present invention, the erigeron breviscapus chalcone isomerase gene EbCHI ( Erigeronbreviscapus Chalcone! somerase ) is as shown in SEQ ID NO.2, SEQ ID NO.2: ATGGCTGCTACTACAACACCTCTTACAACATCATTGCAAGTTGAATCAATCGTGTTCCCTTCTTCTGTTAAGCCACCTGGTTCAACAAAATCTCTTTTTCTTGGTGGTGCTGGAGTTAGAGGAATGGAGATTCAAGGTAATTTCGTTAAGTTCACCGGAATTGGTGTTTATCTTGAAGATAAGGCTATCCCACTTCTTGCTGCTAAATGGATGGGTAAGTCTTCAACTGAATTGTTGGATTCTGTGGAATTTTTCAGGGATATCGTTACAGGTCCATTTGAAAAGTTCACACAAGTTACAATGATCCTCCCTTTGACTGGAAAGCAATATTCAGAAAAGGTGTCAGAAATGTGCGTTGGAGTTTGGAAGGCTCATGGTGTTTATACAGATGCTGATGGAACAACAATCGAGAAGTTTCTTGAGGTTTTCAAGGATAAGAACTTCCTTCCAGGTTCTTCAATTCTTTTCACAACTTCACCTCTCGGTTCTCTTACAATTTCTTTTTCTAAGGACTCCACCATCCCAGAAGCTGCTAATGTTGTTTTGGAGAATGAAAAGCTCTCCCAAGCTGTTATTGAGTCAGTTATTGGTAAGAACGGAGTTTCACCTGCTACTAAGCAATCATTGGCTTCTAGGCTTTTTGATTTGATGAAGAAGTTCGACGAGGAGCTTTCTGCTTCAGTTGAAGTTGCTGATGTTTCAAAATACGGACTT。

[0022] In the present invention, the erigeron breviscapus flavone synthase II gene EbFNSII ( Erigeron breviscapus Flavone Synthase II

[0023] In this invention, the 7-O-glucuronyl transferase gene of *Erigeron breviscapus* flavonoids is used. EbF7GAT ( Erigeron breviscapus Flavonoid 7-O-Glucosyltransferase

[0024] In this invention, the *Erigeron breviscapus* uridine diphosphate glucose dehydrogenase gene... EbUDPGDH ( Erigeron breviscapus UDP-Glucose Dehydrogenase

[0025] In this invention, the flavonoid 6-hydroxylase gene of *Erigeron breviscapus* is used. EbF6H ( Erigeron breviscapus Flavonoid 6-Hydroxylas

[0026] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1

[0028] 1. Materials and Methods

[0029] 1.1 Plant materials

[0030] Tobacco tested: Tobacco Benedict ( Nicotiana benthamiana ), cultivated at the Tobacco College of Henan Agricultural University, under the following cultivation conditions: 25℃, 16 h / 8 h (light / dark), and 60% relative humidity. Common tobacco ( Nicotiana tabacum Variety K326, aseptic culture, culture conditions: 28℃, 16 h / 8 h (light / dark), relative humidity 60%.

[0031] 1.2 Construction of Recombinant Expression Vectors

[0032] The pathway for synthesizing scutellarin is as follows: Figure 1 As shown. The six genes (SEQ ID NO.1~SEQ ID NO.6) required for scutellarin synthesis in *Lysimachia christinae* are listed below: *Lysimachia christinae* charone synthase gene. EbCHS ( Erigeron breviscapus Chalcone Synthase ), *Erigeron breviscapus* charone isomerase gene EbCHI ( Erigeronbreviscapus Chalcone!somerase ), the flavonoid synthase II gene of *Erigeron breviscapus* EbFNSII ( Erigeron breviscapus Flavone Synthase II ), 7-O-glucuronide transferase gene of flavonoids from *Erigeron breviscapus* EbF7GAT ( Erigeron breviscapus Flavonoid 7-O- Glucosyltransferase ), *Erigeron breviscapus* uridine diphosphate glucose dehydrogenase gene EbUDPGDH ( Erigeron breviscapus UDP-Glucose Dehydrogenase ), and the flavonoid 6-hydroxylase gene of *Erigeron breviscapus*. EbF6H ( Erigeron breviscapus Flavonoid 6-Hydroxylas e) All synthesis was commissioned to Jiangsu Saisofi Company.

[0033] Use restriction endonucleases NcoI and BcuIThe plant expression vector pCAMBIA1304-GFP was double-digested with enzymes, and the target gene fragments (SEQ ID NO.1~SEQ ID NO.6) obtained above were ligated into the double-digested plant expression vector pCAMBIA1304-GFP by seamless cloning, resulting in six recombinant plasmids: pCAMBIA1304-EbCHS, pCAMBIA1304-EbCHI, pCAMBIA1304-EbFNSII, pCAMBIA1304-EbF7GAT, pCAMBIA1304-EbUDPGDH, and pCAMBIA1304-EbF6H.

[0034] Using the pCAMBIA1302 vector as a backbone, the vector was modified to retain its inherent CaMV 35S promoter and Tnos terminator. The AtUBQ10 promoter was amplified from Arabidopsis thaliana genomic DNA (accession number: GCF_000001735.4) using KOD One PCR. The PMAS promoter, Te9 terminator, Thsp terminator, and three 2A self-cleaving peptide sequences (P2A, T2A, E2A) were synthesized by Genewiz to construct a multi-gene expression system. The vector employs a modular design, containing three tandem expression units. Each unit utilizes a promoter and a 2A self-cleaving peptide to drive the co-expression of two genes. Using seamless degradation technology, key pathway enzyme genes were precisely inserted sequentially into predetermined sites (…). Figure 2 ).

[0035] promoterCaMV 35S: TGAGACTTTTCAAACAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTACTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCTCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCAACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCATTTGGAGAGAACA (SEQ IDNO.47).

[0036] PMAS: TTTTCAAATCAGTGCGCAAGACGTGACGTAAGTATCCGAGTCAGTTTTTATTTTTCTACTAATTTGGTCGTTTATTTCGGCGTGTAGGACATGGCAACCGGGCCTGAATTTCGCGGGTATTCTGTTTCTATTCCAACTTTTTCTTGATCCGCAGCCATTAACGACTTTTGAATAGATACGCTGACACGCCAAGCCTCGCTAGTCAAAAGTGTACCAAACAACGCTTTACAGCAAGAACGGAATGCGCGTGACGCTCGCGGTGACGCCATTTCGCCTTTTCAGAAATGGATAAATAGCCTTGCTTCCTATTATATCTTCCCAAATTACCAATACATTACACTAGCATCTGAATTTCATAACCAATCTCGATACACCAAATCG(SEQ ID NO.48)。

[0037] AtUBQ10:(SEQ ID NO.49)。

[0038] Terminator Te9: AGCTTTCGTTCGTATCATCGGTTTCGACAACGTTCGTCAAGTTCAATGCATCAGTTTCATTGCGCACACACCAGAATCCTACTGAGTTTGAGTATTATGGCATTGGGAAAACTGTTTTTCTTGTACCATTTGTTGTGCTTGTAATTTACTGTGTTTTTTATTCGGTTTTCGCTATCGAACTGTGAAATGGAAATGGATGGAGAAGAGTTAATGAATGATATGGTCCTTTTGTTCATTCTCAAATTAATATTATTTGTTTTTTCTCTTATTTGTTGTGTGTTGAATTTGAAATTATAAGAGATATGCAAACATTTTGTTTTGAGTAAAAATGTGTCAAATCGTGGCCTCTAATGACCGAAGTTAATATGAGGAGTAAAACACTTGTAGTTGTACCATTATGCTTATTCACTAGGCAACAAATATATTTTCAGACCTAGAAAAGCTGCAAATGTTACTGAATACAAGTATGTCCTCTTGTGTTTTAGACATTTATGAACTTTCCTTTATGTAATTTTCCAGAATCCTTGTCAGATTCTAATCATTGCTTTATAATTATAGTTATACTCATGGATTTGTAGTTGAGTATGAAAATATTTTTTAATGCATTTTATGACTTGCCAATTGATTGACAACATGCATCAA (SEQ ID NO.50).

[0039] Thsp: ATATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGGTTGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAACATCTCATTATAATGAATAAACAAATGTTTCTATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTCCAGCATATAACTACTGTATGTGCTATGGTATGGACTATGGAATATGATTAAAGATAAG (SEQ ID NO.51).

[0040] Tnos: GATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGAC GTTATTTATGAGATGGGTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATC (SEQ ID NO.52).

[0041] P2A:GCCACAAATTTCTCATTGCTTAAGCAGGCTGGAGATGTTGAAGAAAATCCAGGGCCA (SEQ ID NO. 53).

[0042] T2A: GAAGGTAGGGGGAGTCTGCTCACTTGCGGTGACGTGGAGGAATCCCGGACCT (SEQ ID NO. 54).

[0043] E2A: CAGTGCACTAACTATGCTCTCCTCAAGCTAGCTGGTGATGTTGAATCTAATCCTGGACCT (SEQ ID NO. 55).

[0044] In the first round of assembly, the first step is to... EbCHS The gene is inserted and will be directionally cloned to a predetermined site between the promoter (35S) and the P2A peptide. This is based on the vector... NcoI and EcoRI To approximate the flanking sequences of the double restriction enzyme sites, a pair of specific primers containing homologous arms were designed: the forward primer was 1302-EbCHS-F, and the reverse primer was EbCHS-P2A-R. Subsequently, [the following steps were taken]. NcoI and EcoRI Restriction endonucleases (Thermo Fisher Scientific) were used to double-digest the "downstream of the 35S promoter - upstream of P2A" region in the modified pCAMBIA1302 vector, linearizing the vector and exposing homologous recombination ends. Homologous recombination was mediated using the ClonExpressUltraOneStepCloning Kit V2 (Nanjing Novizan Biotechnology Co., Ltd.), employing primers 1302-EbCHS-F and EbCHS-P2A-R to transport the chemically synthesized... EbCHSThe fragment was ligated to the corresponding site in the linearized vector, and the recombinant plasmid p1302-EbCHS was successfully constructed.

[0045] Second round of assembly focus EbCHI Gene insertion enables tandem expression with EbCHS. Synthetic [genes / materials] are used. EbCHI Based on the flanking sequence of the downstream SacI site of P2A in the vector, a pair of specific primers containing homologous arms were designed: the forward primer was P2A-EbCHI-F, and the reverse primer was EbCHI-Thsp-R. Simultaneously, a fusion P2A peptide coding sequence was designed upstream of the EbCHI gene using homologous arms. The restriction endonuclease SacI was used to target p1302-35S- EbCHS After the vector was digested with enzymes to obtain a linearized vector, homologous recombination was mediated using the ClonExpress Ultra One Step Cloning Kit V2 (Nanjing Novizan Biotechnology Co., Ltd.). Primers P2A-EbCHI-F and EbCHI-Thsp-R were used to... EbCHI The fragment was directionally inserted into the vector to form a new recombinant plasmid p1302-EbCHS-EbCHI.

[0046] The third round of assembly is underway. EbFNSII Gene insertion was performed using the gene ligation method described above. p1302-EbCHS-EbCHI was digested with the restriction endonuclease BglII, and homologous recombination was mediated using the ClonExpress Ultra One Step Cloning KitV2 (Nanjing Novizan Biotechnology Co., Ltd.). EbFNSII The fragment was directionally inserted into the vector to form a new recombinant plasmid p1302-EbCHS-EbCHI-EbFNSII. The primers were 1302-EbFNSII-F and EbFNSII-T2A-R.

[0047] Similarly, using the vector p1302-EbCHS-EbCHI-EbFNSII, connections were made. EbF7GAT The fragment was used to form the recombinant plasmid p1302-EbCHS-EbCHI-EbFNSII-EbF7GAT (primers were T2A-EbF7GAT-F and EbF7GAT-E9T-R). Then, ligation was performed on this plasmid. EbUDPGDH The recombinant plasmid p1302-EbCHS-EbCHI-EbFNSII-EbF7GAT-EbUDPGDH was formed (primers were 1302-EbUDPGDH-F and EbUDPGDH-E2A-R). Based on this, ligation was performed... EbF6HGene fragments were used to form the recombinant plasmid p1302-EbCHS-EbCHI-EbFNSII-EbF7GAT-EbUDPGDH-EbF6H (primers were E2A-EbF6H-F and EbF7H-NOS-R).

[0048] Table 1 lists the ligation primers.

[0049] 1.3 Transient transformation of Tobacco Benzoinus

[0050] The constructed plasmids were transformed into Agrobacterium GV3101, and the Agrobacterium culture was expanded until the OD of the culture was reached. 600 When the OD value was 0.8, the bacterial cells were collected by centrifugation at 5000 rpm for 3 min, and then the OD value of the bacterial suspension was adjusted. 600 =Approximately 0.6, using 5-week-old, unflowered tobacco plants, select the 3rd to 5th leaves below the top of the tobacco plant for injection. Before injection, make a small hole on the back of the leaf with a needle, and then use a needleless syringe to inject the treated Agrobacterium resuspension into the back of the tobacco leaves and mark them.

[0051] Table 2 Instantaneous Transformation and Infection

[0052] 1.4 Stable transformation of cultivated tobacco

[0053] Tobacco K326 was transformed using the leaf disc method. The constructed plasmid pCAMBIA1304-EbCHS+EbCHI+EbFNSII+EbF7GAT+EbUDPGDH+EbF6H was transformed into Agrobacterium GV3101. Agrobacterium culture was then expanded, and the OD of the culture was measured. 600 =0.6, centrifuge at 5000 rpm for 3 min to collect bacterial cells, and then adjust the OD of the Agrobacterium suspension. 600 =Approximately 0.6. Leaves pre-cultured for 2 days were immersed in the bacterial solution for 8 minutes, shaking continuously to aid infection. After infection, the water was absorbed, and the leaves were transferred to a co-culture medium. After 2 days of dark culture, they were transferred to differentiation medium. After screening, the differentiated shoots were transferred to rooting medium. Once the tobacco seedlings had developed roots and 6-7 leaves, they were transplanted into pots for further cultivation.

[0054] 1.5 PCR detection of transgenic plants

[0055] To detect the integration of genes EbCHS, EbCHI, EbFNSII, EbF7GAT, EbUDPGDH, and EbF6H into the transgenic tobacco genome, approximately 10 mg of fresh leaf tissue from the target tobacco plant was collected, added to liquid nitrogen, and ground into a fine powder using a small steel ball. Total DNA from the tobacco leaves was obtained by adding a coarse DNA extraction buffer. The DNA from the transgenic plants was then analyzed using 2×Taq PCR Star Mix. EbCHS, EbCHI, EbFNSII, EbF7GAT, EbUDPGDH, EbF6H Genes and hygromycin resistance genes ( Hyg The assay was validated. The plasmid served as a positive control. Wild-type (WT) plant DNA was extracted as a negative control. Primers are shown in Table 3 below.

[0056] Table 3 Detection primers

[0057] 1.6 Real-time quantitative PCR (RT-qPCR) analysis

[0058] To detect the relative expression level of the introduced gene in transgenic plants, leaf samples of transgenic tobacco were ground into powder in a mortar with liquid nitrogen. RNA extraction and cDNA synthesis were then performed according to the instructions of the RNA extraction kit and reverse transcription kit. RNA quality and concentration were assessed using a 1% agarose gel electrophoresis. The tobacco L25 gene (accession number: L18908.1) was used as an internal control gene. The PCR system consisted of: 20 μL: 10 μL of 2×HQ SYBR qPCR Mix (Without ROX), 0.4 μL each of forward and reverse primers (10 μmol / L), 8.2 μL of dd H2O, and 1 μL of cDNA. PCR reaction conditions were: 95℃ for 3 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 20 s, for 40 cycles. The relative expression level of the gene was calculated using the 2-ΔΔCt method. Primers are shown in Table 4.

[0059] Table 4 Primers for RT-qPCR detection

[0060] 1.7 Detection of scutellarin based on UPLC-MS

[0061] (1) Qualitative analysis of scutellarin

[0062] The accumulation of scutellarin was analyzed using HPLC-MS / MS. First, 0.2 g of dried and ground sample powder from both transgenic and wild-type plants was weighed. All samples were immersed in 3 ml of 50% methanol and extracted by sonication for 1 h. The supernatant was then collected by centrifugation at 13000×g for 10 min and filtered through a 0.22 µM Millipore filter.

[0063] HPLC-MS / MS analysis was performed using an AB Sciex 4500 QTRAP LC / MS / MS system (Toronto, ON, Canada) and an Agilent Technologies 1260 Series LC system (Agilent, Santa Clara, CA, USA). The instrument was equipped with a Luna Omega PS C18 column (100 mm × 2.1 mm, 1.6 μm). Mobile phase A was water (0.1% formic acid), and mobile phase B was pure acetonitrile. Gradient elution was used to analyze the target products naringenin, apigenin, apigenin-7-O-glucuronide, and baicalin. The elution program is shown in Table 5.

[0064] Table 5 Gradient Elution

[0065] Electrospray ionization (ESI) was performed in positive ion mode. Target products were detected in optimal multiple reaction detection (MRM) mode. Ion source information: naringenin [273.1 / 153.1], apigenin [270.9 / 153.1], apigenin-7-O-glucopyranoside [447.2 / 271.1], baicalin [463.1 / 287.1].

[0066] (2) Quantitative analysis of scutellarin

[0067] Preparation of the standard: Accurately weigh 1.00 mg of the standard scutellarin, then prepare a 0.1 mg / mL solution with solvent (methanol:ddH2O=1:1), and then dilute with solvent to prepare solutions with concentration gradients of 0.002, 0.02, 0.2, and 2 μg / mL.

[0068] Plotting the standard curve: The standard solutions of different mass concentrations were analyzed by HPLC to obtain the peak areas corresponding to different concentrations. Then, using the peak area as the Y value and the concentration (mg / mL) as the x value, a standard curve was plotted in Microsoft Excel, yielding a linear equation: y = 8.41374e 5 x+-1186.03023, R 2 =0.99913.

[0069] A solution of baicalin (or other products such as baicalin, apigenin-7-O glucuronide, apigenin, and naringenin) from transgenic tobacco was prepared by ultrasonic extraction. HPLC-MS / MS was used to identify and analyze baicalin, apigenin-7-O glucuronide, apigenin, and naringenin from transgenic tobacco. The linear regression equations for the standard solutions of each compound are shown in Table 6 below. Figure 3 As shown.

[0070] Table 6. Linear regression equations for each compound standard.

[0071] After obtaining chromatographic analysis results for different tobacco genotypes, the peak area was used as the Y value and substituted into the above equation to calculate the x value. Results are expressed as nanograms per gram of fresh sample, with three biological replicates. SPSS 20.0 was used for analysis of variance.

[0072] 1.8 Determination of the content of flavonoids, chlorogenic acid, and hyoscyamine

[0073] The effects of genes involved in the heterologous synthesis of scutellarin on the content of endogenous flavonoids, chlorogenic acid, and hyoscyamine in tobacco were analyzed. Wild-type (WT) tobacco and transgenic materials (S1-S6) with different gene combinations were used as samples to detect the relative contents of rutin, quercetin, kaempferol, luteolin, hesperidin, piperidin, naringin, astragalin, isorhamnetin, isorhamnetin-3-O-glucoside, chlorogenic acid, and hyoscyamine. 0.2 g of dried and ground transgenic and wild-type plant sample powder was weighed. All samples were immersed in 3 ml of 50% methanol and ultrasonically extracted for 1 h. The supernatant was then collected by centrifugation at 13000×g for 10 min and filtered through a 0.22 µM Millipore filter. HPLC-MS / MS methods were used for detection.

[0074] 1.9 Data Processing

[0075] All samples were collected randomly. SPSS 21.0 statistical software was used for analysis. Origin 2025b (OriginLab Co., Northampton, Massachusetts, USA) was used to generate data graphs.

[0076] 2. Results and Analysis

[0077] 2.1 Construction of multi-gene expression vectors

[0078] A single gene fragment was amplified using cDNA of scutellarin. EbCHS, EbCHI, EbFNSII, EbF7GAT, EbUDPGDH, EbF6H, Electrophoresis results as follows Figure 4As shown. The empty vector pCAMBIA1304(-GFP) was digested with enzymes, and a single gene fragment was ligated into the digested vector pCAMBIA1304(-GFP) using a seamless cloning enzyme, thus constructing recombinant plasmids pCAMBIA1304-EbCHS, pCAMBIA1304-EbCHI, pCAMBIA1304-EbFNSII, pCAMBIA1304-EbF7GAT, pCAMBIA1304-EbUDPGDH, and pCAMBIA1304-EbF6H.

[0079] Recombinant plasmids p1302-EbCHS, p1302-EbCHS-EbCHI, p1302-EbCHS-EbCHI-EbFNSII, p1302-EbCHS-EbCHI-EbFNSII-EbF7GAT, p1302-EbCHS-EbCHI-EbFNSII-EbF7GAT-EbUDPGDH, and p1302-EbCHS-EbCHI-EbFNSII-EbF7GAT-EbUDPGDH-EbF6H were obtained using the pCAMBIA1302 vector as the backbone.

[0080] The sizes of each gene fragment are as follows: EbCHS : 1194bp; EbCHI 714bp; EbFNSII : 1557bp; EbF7GAT : 1416bp; EbUDPGDH 1440bp; EbF6H : 1560bp.

[0081] 2.2 Expression analysis of the gene for transient transformation of scutellarin synthesis in Nicotiana benthamiana

[0082] The pathway in tobacco provides sufficient substrates for the synthesis of scutellarin; therefore, overexpressing key genes involved in scutellarin synthesis in tobacco can reconstruct the scutellarin synthesis pathway. This is for research purposes. EbCHS, EbCHI, EbFNSII, EbF7GAT, EbUDPGDH, EbF6H Subcellular localization of the proteins was determined by injecting Agrobacterium GV3101 carrying recombinant plasmids pCAMBIA1304-EbCHS, pCAMBIA1304-EbCHI, pCAMBIA1304-EbFNSII, pCAMBIA1304-EbF7GAT, pCAMBIA1304-EbUDPGDH, and pCAMBIA1304-EbF6H into tobacco leaves. The leaves were observed under a laser confocal microscope 36 hours later. Results are as follows: Figure 5 Confocal analysis showed that the fluorescence signal of the empty vector control pCAMBIA1304(-GFP) appeared in the cytoplasm and chloroplasts. EbCHS, EbCHI, EbF6HIt is mainly located in chloroplasts, while EbFNSII, EbF7GAT, EbUDPGDH They are located in the cytoplasm and chloroplasts.

[0083] GFP: Green fluorescent protein fluorescence; Chloroplast: Chloroplast autofluorescence; Bright field: Bright field; Merged: Superposition of green fluorescent protein fluorescence, chloroplast autofluorescence, and bright field.

[0084] 2.3 Genetic transformation of scutellarin-based transgenic tobacco

[0085] Tobacco was transformed using Agrobacterium-mediated transformation, with a recombinant plasmid containing the target gene introduced into plant K326. After preparing the Agrobacterium culture for infection, the prepared K326 plants were placed together with the Agrobacterium culture and shaken to aid infection. After infection, the leaf surfaces were dried, and the plants were placed on a co-culture medium and incubated in the dark for 2 days. Subsequently, the leaves from the co-culture medium were transferred to differentiation medium to await leaf differentiation. Results are as follows... Figure 6 As shown.

[0086] Figure 6 A represents a K326 leaf after infection, awaiting callus growth; B represents a leaf with callus growth, from which small buds can be cut off and transferred to a selection medium to await further growth; C represents a bud cut from the callus, which is then transferred individually to a culture bottle to root after it grows; D represents a complete plantlet grown from a small bud; and E represents a tobacco seedling transferred from a culture bottle to nutrient soil, which is a transgenic plantlet.

[0087] 2.4 Molecular identification of scutellarin in transgenic tobacco

[0088] Transgenic plants containing plasmids S1, S2, S3, S4, S5, and S6 were obtained through stable genetic transformation. DNA was extracted from the leaf tissues of transgenic tobacco plants, and the target gene fragments were identified. EbCHS, EbCHI, EbFNSII, EbF7GAT, EbUDPGDH, EbF6H Electrophoresis results ( Figure 7 The results showed that the three transgenic tobacco plants of S6 were tested. EbCHS, EbCHI, EbFNSII EbF7GAT, EbUDPGDH, EbF6H PCR amplification of the gene showed clear target bands, meaning that all three identified tobacco plants were positive. Similarly, one S5 transgenic plant, three S4, three S3, and three S2 transgenic plants, and two S1 transgenic plants were also identified.

[0089] Hyg The segment length is 1026bp.

[0090] The results of quantitative real-time PCR detection of gene expression levels in transgenic tobacco are as follows: Figure 8 As shown. Except for plant S6-8 EbUDPGDH, EbF6HIn addition, the relative expression levels of each gene were significantly higher than those of the control group, indicating that the exogenous gene had been successfully integrated into the tobacco genome and expressed. In particular, the overall expression levels of plants S6-9 were high, which confirmed the effectiveness of the heterologous expression system and showed that the target gene had been normally transcribed, laying the foundation for the subsequent synthesis of metabolites.

[0091] 2.5 HPLC-MS / MS Analysis of Scutellarin in Transgenic Tobacco

[0092] The comparison results of genetically modified tobacco in group S6 are as follows: Figure 9 As shown.

[0093] Target compounds in genetically modified tobacco were qualitatively identified using liquid chromatography-mass spectrometry (LC-MS). Extraction was performed on leaves of genetically modified tobacco, and the retention times and characteristic ions of each component in the sample were precisely compared with commercial standards. This successfully identified key products in the pathway: naringenin, apigenin, baicalin, and apigenin-7-O-glucuronide. Figure 10 This provides direct evidence for the successful construction of the synthetic pathway of scutellarin in tobacco. Figure 10 In the text, Scu represents baicalin, Apigenin-7-OG represents apigenin-7-O-glucuronide, Nar represents naringenin, and Api represents apigenin.

[0094] By analyzing the accumulation of four target metabolic flavonoids in transgenic tobacco ( Figure 11 The study revealed trends in the target products. When only upstream genes (S1 to S3) were present, precursor substances accumulated significantly, with naringenin production in groups S1 and S2 and apigenin production in group S3 showing a significant increase compared to the control group. Introducing [product name] from group S4... EbF7GAT Initially, the metabolic flow shifts to the intermediate apigenin-7-O-glucuronide, whose yield increases, while apigenin is consumed. Ultimately, only in the S6 group, which contains all six genes, is the key end product baicalin efficiently synthesized, as seen in the S6-9 strain, which yields 42.09 μg / g Dw.

[0095] The results showed that genes were introduced into the S1 group plants. EbCHS Subsequently, the content of naringenin in the S2 group was significantly higher than that in the CK group, which is attributed to the action of related enzymes contained in tobacco. The S2 group introduced a gene based on the original S1 group. EbCHI Subsequently, the yields of the products naringenin, apigenin, apigenin-7-O-glucuronide, and baicalin did not change significantly compared to group S1, proving that these products are naturally present in tobacco. EbCHI The gene already fulfills the pathway's function; no further transfection is needed in subsequent experiments. EbCHI Gene.

[0096] Group S3 is an extension of Group S2. EbFNSII After gene modification, the apigenin content increased, even without the addition of [a specific ingredient]. EbFNSII Before the gene was introduced, the apigenin content did not increase significantly, indicating that... EbFNSII It is a key gene in the synthesis pathway of *Erigeron breviscapus*. Introduced in group S3. Eb The content of apigenin-7-O-glucuronide and baicalin, products of the FNSII gene, did not increase significantly after gene transplantation. Groups S4 and S5 introduced [the following gene] on the original basis. EbF7GAT , EbUDPGDH The content of the gene-derived product apigenin-7-O-glucuronide was significantly increased compared to the CK group, but the content of baicalin was increased, though not significantly. Group S6 introduced [a gene-derived product] on top of the existing [gene]. EbF6H After gene therapy, the contents of apigenin-7-O-glucuronide and baicalin were significantly increased compared to the control group, with the highest yield of baicalin reaching 42.09 ug / g Dw. This indicates that... Eb The introduction of the F6H gene can increase the yield of the final product, baicalin. This also indicates that... EbF6H These are key genes in the pathway. The entire dataset confirms the correctness of the synthetic pathway design and provides important evidence for elucidating the flavonoid metabolic regulatory network and developing efficient biosynthetic systems.

[0097] 2.6 Effects of Heterologous Transplantation of Scutellarin Genome on Tobacco Flavonoids, Chlorogenic Acid, and Hyoscyamine

[0098] To clarify the regulatory effect of heterologous synthesis of scutellarin pathway gene combinations on endogenous secondary metabolism in tobacco, the contents of flavonoids, chlorogenic acid, and hyoscyamine in wild-type tobacco and six transgenic gene groups were measured. Simultaneously, the accumulation patterns of target substances under different gene combinations were analyzed in conjunction with the content of target products. The results are as follows: Flavonoids such as rutin, naringin, and piperidin were detected in wild-type tobacco. Trace amounts of naringenin-7-O-glucoside, quercetin, hesperidin, isorhamnetin-3-O-glucoside, as well as basal accumulation of chlorogenic acid and hyoscyamine were also detected, indicating that the endogenous metabolic pathway in tobacco can autonomously synthesize the above-mentioned secondary metabolites. After the gene combination of the scutellarin synthesis pathway was introduced, the content of the target substances in each transgenic gene group changed to varying degrees. Among the flavonoids, the contents of rutin, naringin, and naringenin-7-O-glucoside showed a trend of first significantly increasing, then slightly decreasing, and then increasing again with the tandem combination of gene combinations, and the contents of each transgenic group were generally higher than those of the control group (CK). The contents of quercetin, piperidin, and isorhamnetin-3-O-glucoside also showed a trend of first increasing, then decreasing, and then increasing again, with relatively small overall increases and decreases. The contents of hesperidin and astragaloside showed a trend of first increasing and then decreasing. These results indicate that the introduction of heterologous genes can significantly promote the synthesis and accumulation of tobacco flavonoids. The contents of chlorogenic acid and hyoscyamine showed a trend of first increasing, then slightly decreasing, and then increasing again in all transgenic groups. Only the chlorogenic acid content in the S1 group was slightly lower than that in the CK group. The contents of chlorogenic acid and hyoscyamine in all other transgenic groups were higher than those in the CK control group. This indicates that the introduction of heterologous scutellarin synthesis pathway genes effectively stimulated the overall activation of the main pathway of endogenous phenylpropanoid secondary metabolism in tobacco.

[0099] Furthermore, the introduction of genes into the scutellarin synthesis pathway also promoted a gradual increase in the content of the target product. Using naringenin-7-O-glucoside as the direct synthesis pathway product, apigenin, apigenin-7-O-glucuronide, and baicalin as heterologous synthesis pathway products, and rutin, quercetin, kaempferol, luteolin, hesperidin, piperidin, narcissin, astragalin, isorhamnetin, and isorhamnetin-3-O-glucoside as indirect synthesis pathway products, analysis of the detection results showed that from WT to S1 and then to S6 groups, the content of naringenin-7-O-glucoside in the direct synthesis pathway showed a trend of first increasing, then decreasing, and then increasing again. The content in group S4 was relatively low, presumably due to insufficient sample size leading to data bias error. The contents of the other transgenic genes were significantly higher than the control group (CK). The contents of each product in the indirect synthesis pathway were generally lower than those in the CK group to varying degrees. However, the contents of each target product in the heterologous synthesis pathway showed a gradual increasing trend compared to the CK group. The above results indicate that the introduction of heterologous synthesis of scutellarin pathway genes can regulate the flow of tobacco endogenous metabolic pathways, prompting more endogenous metabolic flux to be allocated towards the synthesis of target products, thereby achieving the targeted accumulation of heterologous synthesis pathway products.

[0100] The proportions of flavonoids in different metabolic pathways relative to total flavonoids in transgenic tobacco obtained from different groups are shown in Table 7.

[0101] Table 7. Proportion of each metabolic pathway of flavonoids in total flavonoids.

[0102] Heatmap of flavonoid content distribution in genetically modified tobacco as shown in the figure. Figure 12 As shown.

[0103] As can be seen from the above embodiments, this invention successfully obtained a transgenic tobacco plant with stable heritability by transiently expressing six genes related to the synthesis of scutellarin in *Nicotiana benthamiana*. The highest yield of baicalin reached 42.09 μg / g DW. This invention created a stable genetic material for the heterologous synthesis of scutellarin in cultivated tobacco, laying the foundation for the efficient heterologous synthesis of scutellarin in tobacco and opening up a new avenue for the production of natural products.

[0104] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of any one or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 in increasing the yield of scutellarin in plants, characterized in that, One or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 are ligated to the pCAMBIA1302 vector to obtain a recombinant expression vector; the recombinant expression vector is transformed into Agrobacterium to obtain recombinant bacteria; plants are infected with a suspension of the recombinant bacteria to obtain plants that produce high yields of scutellarin.

2. The application according to claim 1, characterized in that, The gene sequence described in SEQ ID NO.1 is the charone synthase gene from *Erigeron breviscapus*. The gene sequence described in SEQ ID NO.2 is the charone isomerase gene of *Erigeron breviscapus*. The gene sequence described in SEQ ID NO.3 is the flavonoid synthase II gene from *Erigeron breviscapus*. The gene sequence described in SEQ ID NO.4 is the 7-O-glucuronide transferase gene of *Erigeron breviscapus* flavonoids; The gene sequence described in SEQ ID NO.5 is the *Erigeron breviscapus* uridine diphosphate glucose dehydrogenase gene; The gene sequence described in SEQ ID NO.6 is the 6-hydroxylase gene of scutellaria baicalensis flavonoids.

3. The application according to claim 1, characterized in that, The Agrobacterium species is Agrobacterium GV3101; OD of the bacterial suspension of the recombinant bacteria 600 It ranges from 0.5 to 0.

7.

4. The application according to claim 1, characterized in that, The plant in question is tobacco.

5. An expression cassette for increasing the production of scutellarin in plants, characterized in that, Including any of the following: (1) Recombinant expression vector; (2) Recombinant bacteria; The recombinant expression vector is constructed by ligating any one or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 with the pCAMBIA1302 vector. The method for constructing the recombinant bacteria is as follows: transforming any one or more gene sequences shown in SEQ ID NO.1~SEQ ID NO.6 into Agrobacterium GV3101; or transforming the recombinant expression vector described in (1) into Agrobacterium GV3101.

6. The application of the expression cassette according to claim 5 in increasing the yield of scutellarin in plants.

7. A method for increasing the yield of scutellarin in plants, characterized in that, Includes the following steps: Transform one or more of the gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 into a plant; or transform any one of the expression cassettes described in claim 5 into a plant.

8. A method for constructing a tobacco synthetic biology chassis for scutellarin, characterized in that, Includes the following steps: One or more gene sequences shown in SEQ ID NO.1 to SEQ ID NO.6 are ligated to the pCAMBIA1302 vector to obtain a recombinant expression vector; the recombinant expression vector is transformed into Agrobacterium to obtain recombinant bacteria; tobacco is infected using a bacterial suspension of the recombinant bacteria.

9. The construction method according to claim 8, characterized in that, The Agrobacterium species is Agrobacterium GV3101; OD of the bacterial suspension of the recombinant bacteria 600 It ranges from 0.5 to 0.

7.

10. The application of primer pairs for detecting the expression levels of any one or more genes shown in SEQ ID NO.1 to SEQ ID NO.6 in screening superior varieties that produce high yields of scutellarin, characterized in that... The primer pairs for detecting the expression level of the gene in SEQ ID NO.1 are shown in SEQ ID NO.31~SEQ ID NO.32; The primer pairs for detecting the expression level of the gene in SEQ ID NO.2 are shown in SEQ ID NO.33~SEQ ID NO.34; The primer pairs for detecting the expression level of the gene in SEQ ID NO.3 are shown in SEQ ID NO.35~SEQ ID NO.36; The primer pairs for detecting the expression level of the gene in SEQ ID NO.4 are shown in SEQ ID NO.37~SEQ ID NO.38; The primer pairs for detecting the expression level of the gene in SEQ ID NO. 5 are shown in SEQ ID NO. 39~SEQ ID NO. 40; The primer pairs for detecting the expression level of the gene SEQ ID NO.6 are shown in SEQ ID NO.41~SEQ ID NO.42.

Images