An engineered strain for producing L-isoleucine, a construction method and application thereof

Abstract

This invention relates to the fields of transcription factor engineering and metabolic engineering, and discloses an engineered strain that produces L-isoleucine, its construction method, and its applications. This strain... E. coli K12, MG1655 ( E. coli A1) serves as the host, integrating the subunit of the host factor IHF. ihfβ, ihfα Natural promoter replaced with P trc Strong promoters enable IHF overexpression, resulting in engineered bacteria. E. coli IHF4. This invention also discloses the construction steps of this strain, as well as its application method for L-isoleucine production by inoculating it into a fermentation medium, culturing it at 36-38℃ and 200 r / min for 40-60 h, and adjusting the pH and supplementing sugar. This engineered strain increases the yield of L-isoleucine by 42.11% compared to the starting strain. The construction method is simple and suitable for industrial microbial fermentation production of L-isoleucine.

Description

Technical Field

[0001] This invention relates to the fields of transcription factor engineering and metabolic engineering, and in particular to an engineered strain that produces L-isoleucine, its construction method, and its application. Background Technology

[0002] L-Isoleucine, a nonpolar hydrophobic amino acid, is one of the three major branched-chain amino acids and one of the eight essential amino acids for the human body. It plays an important role in life metabolism, such as promoting cell growth, enhancing the immune system, participating in protein synthesis and metabolism, and regulating glucose metabolism. It is widely used in the food, medicine, and feed industries.

[0003] Currently, the main method for producing L-isoleucine is microbial fermentation, with Corynebacterium glutamicum and Escherichia coli being commonly used microorganisms in this fermentation process. Escherichia coli is widely used as a model strain in industrial production. Existing methods for modifying Escherichia coli strains mainly focus on weakening branched metabolic pathways, enhancing precursor supply, and removing feedback inhibition of the final product. However, research on improving L-isoleucine production through transcription factor engineering is rarely reported.

[0004] Transcription factors are important regulators that alter complex metabolic pathways in microorganisms. Their unique "multi-point regulation" characteristic enables global, efficient, and specific dynamic regulation of target metabolic pathways. Integration host factors (IHFs) are global transcription factors in *E. coli*, composed of… ihfα and ihfβ Composed of two subunits, it plays a core role in regulating DNA replication, site-specific recombination, gene expression regulation, recruiting RNA polymerase, and maintaining chromosome structure through sequence-specific binding and inducing DNA bending. Summary of the Invention

[0005] This invention provides an engineered strain for producing L-isoleucine, its construction method, and its application. By overexpressing the transcription factor IHF in Escherichia coli, the fermentation yield of L-isoleucine is increased.

[0006] On one hand, the present invention provides an engineered strain for producing L-isoleucine, wherein the engineered strain is an Escherichia coli engineered strain that overexpresses the transcription factor IHF.

[0007] Furthermore, the *E. coli* is E.coli K12, MG1655 ( E.coli A1).

[0008] Furthermore, the engineered strain was obtained by CRISPR / Cas9 gene editing using the pTarget and pCas dual plasmid system.

[0009] On the other hand, the present invention provides a method for constructing an engineered strain that produces L-isoleucine, comprising the following steps:

[0010] (1) Using primer gRNA- ihfβ ptrc -F / gRNA- ihfβ ptrc -R and its corresponding ihfα Primers were used to construct plasmid pTarget- using reverse PCR. ihfβ and pTarget- ihfα ; (2) Preparation of P-containing trc Fusion fragments of strong starters UD ihfβ / UD ihfα Construct recombinant plasmid pTarget- ihf β ptrc -UD ihfβ and pTarget- ihfα ptrc -UD ihfα ; (3) First, set pTarget- ihfβ ptrc -UD ihfβ Transplantation of host bacteria containing pCas plasmid E.coli K12, MG1655, to achieve ihfβ Promoter replacement, followed by plasmid loss treatment to obtain strains E. coli P trc - ihfβ ; (4) Then pTarget- ihfα ptrc -UD ihfα Transformed with pCas plasmid E. coli P trc - ihfβ After plasmid loss processing, the following was achieved. ihfα The engineered bacteria were obtained by replacing the promoter. E. coli P trc - ihfβihfα .

[0011] Furthermore, the method for constructing the plasmid described in step (1) above is as follows: According to CHOPCHOP tools and ihfβ sgRNA was designed using the gene promoter sequence, and a 20 bp target sequence was suspended at the 5' end of the primer. The primer gRNA- ihfβptrc -F / gRNA- ihfβ ptrc -R was used to construct plasmid pTarget- through reverse PCR amplification. ihfβ ; According to CHOPCHOP tools and ihfα sgRNA was designed using the gene promoter sequence, and a 20 bp target sequence was suspended at the 5' end of the primer. The primer gRNA- ihfα ptrc -F / gRNA- ihfα ptrc -R was amplified by reverse PCR to construct the plasmid pTarget- ihfα .

[0012] Furthermore, the method for constructing the recombinant plasmid described in step (2) above is as follows: by E. coli Using the MG1655 genome as a template, amplification was performed separately. ihfβ and ihfα Upstream and downstream homologous arms of the gene were overlapped by PCR to obtain P-containing genes. trc fusion fragment UD ihfβ and UD ihfα ; UD respectively ihfβ Fragments and UD ihfα The fragment was ligated into plasmid pTarget- by XbaI and SalI restriction enzyme digestion. ihfβ and plasmid pTarget- ihfα , respectively convert E. coli The recombinant plasmid pTarget- was obtained after screening and identification using DH5α. ihfβ ptrc -UD ihfβ and pTarget- ihfα ptrc -UD ihfα .

[0013] In another aspect, the present invention provides an application of the above-mentioned engineered strain in the production of L-isoleucine.

[0014] Furthermore, the application involves inoculating the engineered strain into a fermentation medium and culturing it at 36-38°C and 200 r / min for 40-60 h.

[0015] Furthermore, during the above-mentioned culture process, ammonia water was used to adjust the pH to 6.8-7.2, and the residual sugar concentration was monitored. When sugar was deficient, 400-600 g / L glucose was used to supplement sugar, and the final residual sugar concentration was controlled to be below 1% (w / v).

[0016] Furthermore, the fermentation medium described above is as follows: glucose 20 g / L, tryptone 3 g / L, yeast extract 5 g / L, NH4(SO4)2 10 g / L, KH2PO4 1.5 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 10 mg / L, MnSO4·7H2O 10 mg / L, V B1 2 mg / L, V H 2 mg / L, pH 6.8~7.2.

[0017] Compared with the prior art, the present invention has at least the following advantages: This invention provides an engineered strain that overexpresses the transcription factor IHF. E. coli IHF4 increases the biomass of the strain by enhancing the expression intensity of the transcription factor IHF, while simultaneously increasing the production of L-isoleucine from the starting strain. E.coli The concentration of A1 increased from 2.09 g / L to 2.97 g / L. E. coli The yield of IHF4 strain was increased by 42.11%. The method for constructing the engineered strain provided by this invention is simple, easy to use, and has good application prospects.

[0018] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the following describes the embodiments of the present invention in detail. Attached Figure Description

[0019] Figure 1 For the starting strain E. coli A1 and IHF deletion strains E. coli Comparison of growth curves of IHF1; Figure 2 For the starting strain E. coli A1 and IHF overexpression strains E. coli Comparison of growth curves for IHF4; Figure 3 For the starting strain E. coli A1 and IHF deletion strains E. coli A comparison of L-isoleucine production in IHF1, where A1 represents... E. coli A1, IHF1 indicates E. coli IHF1; Figure 4 For the starting strain E. coli A1 and IHF overexpression strains E. coli A comparison of L-isoleucine production in IHF4, where A1 represents... E. coli A1, IHF4 indicates E. coli IHF4. Detailed Implementation

[0020] Materials involved: plasmids pTarget and pCas were purchased from Wuhan Miaoling Biotechnology Co., Ltd.; restriction endonucleases such as EcoRI, SalRI, and XbaRI, and T4 ligase were purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.; Phanta Max Master Mix high-fidelity enzyme premix was purchased from Nanjing Novizan Biotechnology Co., Ltd.; synthetic primers, E .coli DH5α competent cells, DNA marker, spectinomycin hydrochloride, kanamycin sulfate, isopropyl-β-D-thiogalactoside (IPTG), and L-arabinose were all purchased from Shanghai Sangon Biotech Co., Ltd.; plasmid extraction kits, DNA gel purification kits, and bacterial DNA extraction kits were all purchased from Omega Bio-Tek, USA. LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0. Seed culture medium: glucose 10.0 g / L, tryptone 3.0 g / L, yeast extract 5.0 g / L, NH4(SO4)2 2.0 g / L, KH2PO4 1.2 g / L, MgSO4·7H2O 0.6 g / L, pH 7.0-7.2, sterilized at 115℃ for 15 min. Fermentation medium: Glucose 20 g / L, tryptone 3 g / L, yeast extract 5 g / L, NH4(SO4)2 10 g / L, KH2PO4 1.5 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 10 mg / L, MnSO4·7H2O 10 mg / L, V B1 2mg / L, V H Sterilize at 115°C for 15 min with 2 mg / L phenol red indicator, pH 6.8-7.2, and phenol red indicator at 8 mg / L.

[0021] In the following examples, the CRISPR / Cas9 system was used for gene editing, and the pTarget and pCas plasmids were used to knock out and overexpress the transcription factor IHF. The relevant primers, plasmids, and bacterial strains are shown in Tables 1 and 2.

[0022] Table 1: Strains and Plasmids

[0023] Table 2: Primer sequences

[0024] Example 1 strains E. coli Building IHF4: (1) ihfβThe natural promoter of the gene is replaced with P trc To increase expression levels: using Escherichia coli E. coli Using the MG1655 genome as a template, primers were used to... ihfβ ptrc -UP-F / ihfβ ptrc -UP-R and ihfβ ptrc -Down-F / ihfβ ptrc Down-R amplification ihfβ Upstream and downstream homologous arms of a gene, P trc The promoter sequence (AACTAGGGAATTCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAAGCCTTGCGAAAGAGGAGAAATACTAGAG) is contained in the primer. ihf β ptrc In Down-F, the downstream homologous arm includes P trc promoter sequence, ihfβ The gene and a downstream sequence of the gene. The fusion fragment UD was obtained using overlap PCR. ihfβ (This fusion fragment contains) ihfβ The upstream homologous arm of the gene merges with the downstream fusion sequence, where the downstream fusion sequence integrates P. trc The promoter sequence (total length 537 bp) is pTarget- ihfβ ptrc -UD ihfβ Plasmid construction, based on the CHOPCHOP tool and ihfβ The promoter sequence of the sgRNA was designed, and the target sequence sgRNA 20bp was suspended at the 5' end of the primer. The sgRNA was then activated via primer gRNA- ihfβ ptrc -F / gRNA- ihfβ ptrc -R is used for reverse PCR amplification to construct plasmid pTarget- ihfβ Using the XbaI / SalI restriction site to... ihfβ UD of genes ihfβ Connect to pTarget- ihfβ After transformation E. coli DH5α, LB solid medium containing 50 μg / mL spectinomycin, and recombinant plasmid pTarget- were screened and identified by sequencing. ihfβ ptrc -UD ihfβ The recombinant plasmid was transferred into a cell containing the pCas plasmid. E. coliIn A1 competent cells, using primer T ihfβ ptrc -F / T ihfβ ptrc -R was used for colony PCR to verify positive transformants. Positive colonies were transferred to LB liquid medium containing 50 μg / mL kanamycin and 0.5 mmol / L IPTG and incubated overnight at 30°C to allow pTarget- ihfβ -UD ihfβ The pCas plasmid was lost; then the strain was cultured overnight at 42°C with shaking to induce its loss, thus obtaining the strain. E. coli P trc - ihfβ .

[0025] (2) ihfα The natural promoter of the gene is replaced with P trc To increase expression levels: using Escherichia coli E. coli Using the MG1655 genome as a template, primers were used to... ihfα ptrc -UP-F / ihfα ptrc -UP-R and ihfα ptrc -Down-F / ihfα ptrc Down-R amplification ihfα Upstream and downstream homologous arms of a gene, P trc The promoter sequence is contained in the primer ihfα ptrc In Down-F, the downstream homologous arm includes P trc promoter sequence, ihfα The gene and a downstream sequence of the gene. The fusion fragment UD was obtained using overlap PCR. ihfα (This fusion fragment contains) ihfα The upstream homologous arm of the gene merges with the downstream fusion sequence, where the downstream fusion sequence integrates P. trc The promoter sequence (total length 485 bp) is used. ihfα ptrc -UD ihfα Plasmid construction, based on the CHOPCHOP tool and ihfα sgRNAs were designed based on the spacer region sequence of the upstream gene. A 20bp target sgRNA sequence was suspended at the 5' end of the primer. The sgRNA was then transferred via primer gRNA- ihfα ptrc -F / gRNA- ihfα ptrc -R is used for reverse PCR amplification to construct plasmid pTarget- ihfαUsing the XbaⅠ / SalI restriction site, ihfα UD of genes ihfα Connect to pTarget- ​ After transformation ​ DH5α, LB solid medium containing 50 μg / mL spectinomycin, and recombinant plasmid pTarget- were screened and identified by sequencing. ​ ptrc -UD ihfα The recombinant plasmid was transferred into a cell containing the pCas plasmid. ​ P trc - ​ In competent cells, using primer T ​ ptrc -F / T ​ ptrc -R was used for colony PCR to verify positive transformants. The plasmid was then lost using the same method described above to obtain the bacterial strain. ​ IHF4 ( ​ P trc - ​ ).

[0026] Comparative Example 1 (1) Transcription factor IHF-deficient strains ​ Construction of IHF1: ​ and ​ Subunits were knocked out separately. ​ Gene knockout, in E. coli ​ Using the MG1655 genome as a template, according to ​ Design upstream homologous arm primers based on gene upstream and downstream sequences. ​ -Up-F / ​ -Up-R and downstream homologous arm primers ​ -Down-F / ​ Down-R amplification ​ β Upstream and downstream homologous arms of the gene were obtained using overlap PCR. ​ Fusion fragments of upstream and downstream homologous arms UD ihfβ Used for same-origin template repair. pTarget- ​ UD ihfβ Plasmid construction, based on the CHOPCHOP tool and ​ Sequence design of sgRNA involves suspending the target sequence sgRNA 20 bp at the 5' end of the primer, and then using the primer gRNA- ​ -F / gRNA- ​ -R is used for reverse PCR amplification to construct plasmid pTarget- ​ Using the EcoRI / SalI restriction site to... ​ UD of genesihfβ Connect to pTarget- ​ After transformation ​ DH5α, LB solid medium containing 50 μg / mL spectinomycin, and recombinant plasmid pTarget- were screened and identified by sequencing. ​ UD ihfβ The recombinant plasmid was transferred to a substrate containing the pCas plasmid using an electroporator (1.8 kV, 5 ms). E. ​ A1 competent cells (induced with a final concentration of 10 mmol / L arabinose) were recovered and plated on LB agar plates containing 50 μg / mL spectinomycin and kanamycin. The plates were incubated overnight at 30°C. After colonies appeared, they were analyzed using primer T. ​ -F / T ​ -R was used for colony PCR to verify positive strains. After successful editing and sequencing, positive colonies were transferred to LB liquid medium containing 50 μg / mL kanamycin and 0.5 mmol / L IPTG and incubated overnight at 30°C to allow pTarget- ​ UD ihfβ The pCas plasmid was lost; then the strain was cultured overnight at 42°C with shaking to induce its loss, thus obtaining the strain. ​ Δ ​

[0027] (2) ​ Gene knockout, in E. coli ​ Using the MG1655 genome as a template, according to ​ Design upstream homologous arm primers based on gene upstream and downstream sequences. ​ -Up-F / ​ -Up-R and downstream homologous arm primers ​ -Down-F / ​ Down-R amplification ​ Upstream and downstream homologous arms of the gene were obtained using overlap PCR. ​ Fusion fragments of upstream and downstream homologous arms UD ihfα Used for same-origin template repair. pTarget- ​ UD ihfα Plasmid construction, based on the CHOPCHOP tool and ​ Sequence design of sgRNA involves suspending the target sequence sgRNA 20 bp at the 5' end of the primer, and then using the primer gRNA- ​ -F / gRNA- ​ -R is used for reverse PCR amplification to construct plasmid pTarget- ​ Using the EcoRI / SalI restriction site to... ​ UD of genes ihfα Connect to pTarget-​ After transformation ​ DH5α, LB solid medium containing 50 μg / mL spectinomycin, and recombinant plasmid pTarget- were screened and identified by sequencing. ​ UD ihfα The recombinant plasmid was transferred into a cell containing the pCas plasmid. ​ Δ ​ In competent cells, using primer T ​ -F / T ​ -R was used for colony PCR to verify positive transformants. The plasmid was then lost using the same method described above to obtain the bacterial strain. ​ Δ ​ Δ ​ ( ​ IHF1) 。

[0028] Test Example 1 (1) Shake-flask fermentation: Activated fresh colonies were picked using an inoculation loop and inoculated into a 250 mL Erlenmeyer flask containing 50 mL of seed culture medium. The flask was incubated at 37 ℃ and 200 r / min for 10 h. Then, a 10% (v / v) inoculation was transferred to a 500 mL Erlenmeyer flask containing 90 mL of fermentation medium. The flask was sealed with nine layers of gauze and incubated at 37 ℃ and 200 r / min for 48 h. During fermentation, the pH was adjusted to 6.8 using 50% ammonia based on the color change of phenol red. Residual sugar concentration was measured using an SBA-40E biosensor. If sugar deficiency occurred, 600 g / L glucose was used to supplement sugar, controlling the final residual sugar concentration to below 1% (w / v).

[0029] (2) L-Isoleucine detection and biomass detection The fermentation broth was centrifuged at 8000 r / min for 10 min, and the supernatant was collected. The fermentation broth was derivatized using 1% (v / v) 2,4-dinitrofluorobenzene, and the L-isoleucine content was determined by high-performance liquid chromatography (HPLC). The HPLC conditions were: binary high-pressure gradient elution with 50% acetonitrile and 4.1 g / L sodium acetate (pH 6.8); column temperature 33℃; detection wavelength 360 nm; injection volume 20 µL; flow rate 1 mL / min. OD was measured using a UV spectrophotometer. 600 The biomass of the strain was monitored by the absorbance at a wavelength of nm.

[0030] The culture method in step (1) is used to... ​ A1、 ​ IHF1, ​IHF4 was cultured in shake flasks to assess the effect of transcription factor IHF on L-isoleucine synthesis. The biomass of the strain and the concentration of L-isoleucine in the fermentation supernatant were measured using the method described in step (2). Specific results are shown in Table 3. (Starting strain...) ​ A1 and IHF-deleted strains ​ The growth curves of IHF1 can be compared in the following figures: ​ Starting strain ​ A1 and IHF overexpression strains E. ​ The growth curves of IHF4 can be compared in the following figures: ​ Starting strain ​ A1 and IHF deletion strains ​ A comparison of L-isoleucine production in IHF1 is shown below. ​ Starting strain ​ A1 and IHF overexpression strains ​ A comparison of L-isoleucine production in IHF4 is shown below. ​ .

[0031] Table 3 Shake-flask fermentation of L-isoleucine-engineered bacteria

[0032] Table 3 shows that enhancing the expression intensity of transcription factor IHF significantly increased the biomass of the strain, and simultaneously increased the L-isoleucine production from 2.09 g / L in the starting strain A1 to 2.97 g / L in the engineered strain. ​ The L-isoleucine production of IHF4 was 42.11% higher than that of the starting strain; while the biomass of the transcription factor IHF-deficient strain decreased significantly, with its L-isoleucine production decreasing from 2.09 g / L in the starting strain A1 to 1.22 g / L. ​ The yield of strain IHF1 was 41.63% lower than that of the original strain. These results fully demonstrate that overexpression of the transcription factor IHF in Escherichia coli can significantly improve the L-isoleucine production performance of the strain.

[0033] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An engineered bacterial strain for producing L-isoleucine, characterized in that, The engineered strain uses Escherichia coli as the host bacterium and overexpresses the transcription factor IHF.

2. The engineered strain according to claim 1, characterized in that, The Escherichia coli is E. coli K12, MG1655.

3. The engineered strain according to claim 1, characterized in that, The *E. coli* strain was obtained using CRISPR / Cas9 gene editing with the pTarget and pCas dual plasmid system. ihfβ、ihfα Natural promoter replaced with P trc Strong starter.

4. A method for constructing an engineered strain that produces L-isoleucine, comprising the following steps: (1) Using primer gRNA- ihfβ ptrc -F / gRNA- ihfβ ptrc -R and its corresponding ihfα Primers were used to construct plasmid pTarget- using reverse PCR. ihfβ and pTarget- ihfα ; (2) Prepare P-containing products separately trc Fusion fragments of strong starters UD ihfβ and UD ihfα And construct the recombinant plasmid pTarget- ihfβ ptrc -UD ihfβ and pTarget- ihfα ptrc -UD ihfα ; (3) First, set pTarget- ihfβ ptrc -UD ihfβ Transplantation of host bacteria containing pCas plasmid E. coli K12, MG1655, to achieve ihfβ Promoter replacement, followed by plasmid loss treatment to obtain strains E. coli P trc - ihfβ ; (4) Then pTarget- ihfα ptrc -UD ihfα Transformed with pCas plasmid E. coli P trc - ihfβ ,accomplish ihfα The promoter was replaced, followed by plasmid loss processing, to obtain the engineered bacteria. E. coli P trc - ihfβihfα .

5. The construction method according to claim 4, characterized in that, The plasmid construction method in step (1) is as follows: According to CHOPCHOP tools and ihfβ sgRNA was designed using the gene promoter sequence, and a 20 bp target sequence was suspended at the 5' end of the primer. The primer gRNA- ihfβ ptrc -F / gRNA- ihfβ ptrc -R was used to construct plasmid pTarget- through reverse PCR amplification. ihfβ ; According to CHOPCHOP tools and ihfα sgRNA was designed using the gene promoter sequence, and a 20 bp target sequence was suspended at the 5' end of the primer. The primer gRNA- ihfα ptrc -F / gRNA- ihfα ptrc -R was used to construct plasmid pTarget- through reverse PCR amplification. ihfα .

6. The construction method according to claim 4, characterized in that, The method for constructing the recombinant plasmid in step (2) is as follows: by E. coli Using the MG1655 genome as a template, amplification was performed separately. ihfβ and ihfα Upstream and downstream homologous arms of the gene were obtained by overlap PCR, respectively, containing P. trc fusion fragment UD ihfβ and UD ihfα ; UD respectively ihfβ Fragments and UD ihfα The fragment was ligated into plasmid pTarget- by XbaI and SalI restriction enzyme digestion. ihfβ and plasmid pTarget- ihfα , respectively convert E. coli The recombinant plasmid pTarget- was obtained after screening and identification using DH5α. ihfβ ptrc -UD ihfβ and pTarget- ihfα ptrc -UD ihfα .

7. The application of the engineered strain according to claim 1 in the production of L-isoleucine, characterized in that, The application involves inoculating the engineered strain into a fermentation medium and culturing it at 36-38°C and 200 r / min for 40-60 h.

8. The application according to claim 7, characterized in that, During the cultivation process, ammonia was used to adjust the pH to 6.8-7.2, and the residual sugar concentration was monitored. When sugar was deficient, 600 g / L glucose was used to supplement sugar, and the final residual sugar concentration was controlled to be below 1% (w / v).

9. The application according to claim 7, characterized in that, The fermentation medium consisted of: glucose 20 g / L, tryptone 3 g / L, yeast extract 5 g / L, NH4(SO4)2 10 g / L, KH2PO4 1.5 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 10 mg / L, MnSO4·7H2O 10 mg / L, and V... B1 2 mg / L, V H 2 mg / L, pH 6.8~7.2.

Images