METHOD FOR ADDRESSING INEFFICIENCE IN AMPLIFICATION REACTIONS
Patent Information
- Application Number
- DE602018086350
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-06-20
- Filing Date
- 2018-06-13
- Publication Date
- 2025-10-15
- Estimated Expiration
- 2038-06-13
Description
BACKGROUND
[0001] During amplification reactions, for example polymerase chain reaction or PCR reactions, bias can be introduced into the reactions. For example, some of the amplification primers may interact with each other causing primer-dimers to form. Primer-dimers form because of complementary bases shared by primers which hybridize to each other instead of their target sequence. Primer-dimers will also amplify during an amplification reaction thereby competing for amplification reagents and, in a worst-case scenario, inhibiting the target from being amplified. When primer-dimers form during a quantitative PCR, or qPCR, this will greatly affect the accuracy that is strived for when running theses types of amplification reactions.
[0002] Some of the primers may not be 100% homologous with the sequences they are targeting, for example there is one or more sequence mismatches between the primer and where it binds on the nucleic acid sequence. As amplification efficiency is sequence dependent, mismatches can cause bias amplification and lead to a shift in target amplification to the point of a target not even being detectably amplified. As such, amplification bias can greatly affect the accuracy of an amplification reaction.
[0003] DNA profiling is commonly performed in the analysis of samples collected at a crime scene or for determining the DNA profile of a population of individuals. Traditional DNA profiling methods involve size separation techniques, such as distinguishing and comparing genomic fragments containing STRs or ITRs on an electrophoresis system. More recently, DNA profiling methods have been introduced that involve PCR amplification of DNA from a sample followed by next-generation sequencing as found in PCT patent publication number WO2015 / 126766. Generating sequencable libraries can be very complex when dealing with a multitude of amplification products, each product representing one target. For example, if interrogation of 200 targets is desired then amplification of 200 targets takes place, each amplification requiring a set of primers so 400 different amplificiation primers together. Such a complex system could lead to adverse reactions that could decrease the efficiency of amplification reaction and therefore the resultant library for sequencing. Further, adverse reactions could result in desired targets being minimally or not amplified at all, therefore a target critical to interrogation could be lost or decreased to the point of non-confidence of results. One of the adverse reactions that could occur when large numbers of primers are present in an amplification reaction such as that described above for DNA profiling is the formation of primer-dimers.
[0004] The following disclosure describes methods and compositions to correct or minimize primer-dimer adverse reactions that could result in an amplification reaction, for example a complex multiplex amplification reaction. The result of correcting or minimizing the primer-dimers provides for a more efficient and robust target specific amplification system, for example for DNA forensics, fingerprinting needs, qPCR and other amplification reactions where a high degree of amplification accuracy is desired.
[0005] WO2014 / 028778 A1 teaches methods, compositions, and kits for creating genetic libraries for massively parallel genetic sequencing.SUMMARY
[0006] The invention is defined by the appended claims.BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1 illustrates the use of QCS-labeled primers in a multiplexed PCR reaction which results in amplicons more characteristic of a normal allele ratio despite PCR bias. FIG. 2 illustrates an exemplary QCS-mediated example of primer dimerization for QCS containing primers. FIG. 2 dislcoses SEQ ID NOS 449-456, respectively, in order of appearance. FIG. 3 illustrates exemplary modifications of QCS sequence incorporating primers to reduce QCS-mediated primer dimerization. A) non-modified primer dimer that results from incorporation of a random QCS sequence into an amplicon (SEQ ID NOS 457-458), B) example of one modification for reducing QCS mediated primer dimer formation (SEQ ID NOS 459-460), C) example of a second modification for reducing QCS mediated primer dimer formation (SEQ ID NOS 461-462), and D) example of combining the first and second modifications for reducing QCS based primer dimer formation (SEQ ID NOS 463-464). "N" can be any nucleotide base (e.g., A, C, T, G or U), "H" can be A, C or T, "B" can be C, T or G, "D" can be A, G or T. FIG. 4 shows a flow chart illustrating an exemplary iterative process for assembling an oligonucleotide composition provided herein. FIG. 5 shows a flow chart illustrating an exemplary parallel process, not presently claimed, for assembling an oligonucleotide composition provided herein. FIG. 6 exemplifies interactions between primers A) when the forward amelogenin primer has a random QCS included and a primer dimer is formed with the rs1805009 reverse primer (SEQ ID NOS 465-466), and B) the disruption of the primer-dimer when a modified QCS and ES sequences are included in the amelogenin forward primer (SEQ ID NOS 467-468). FIG. 7 shows the relative percentage of a library preparation (Y axis) that is primer dimers as a result of A) one or more random QCS containing primers (left column) and primers with QCS sequences and extension sequences (right column), and B) the percent of library that results in aligned sequence reads (Y axis) when only QCS sequences are used to disrupt primer dimers (left column) vs. QCS sequences in addition to extension sequences (right column). FIG. 8 shows the capillary electrophoresis traces for libraries prepared using low input DNA. FIG. 9 shows the capillary electrophoresis traces for libraries prepared using low primer concentrations. FIG. 10 demonstrates an exemplary decision tree on how to determine when an extension sequence or ES should be included in any primer sequence on the genomic sequence side of the primer (gES). FIG. 11 demonstrates an exemplary decision tree on how to determine when an extension sequence or ES should be included in any primer sequence on the adaptor sequence side of the primer (aES). FIG. 12 shows an exemplary flow diagram of determining an extension sequence, according to embodiments of the disclosure. DETAILED DESCRIPTION
[0008] Several biological applications involve the amplification of nucleic acid molecules within a population. For such applications, it can be useful to increase the total number of targets that can be selectively amplified from a population within a single amplification reaction. Such amplification is typically achieved through the use of one or more primers that can hybridize to, or promote the amplification of, a particular target nucleic acid molecule. Such amplification can be complicated by the formation of amplification artifacts, such as primer-dimers and the like. The formation of such amplification artifacts (also referred to herein as nonspecific amplification products) can consume critical amplification reagents, e.g., nucleotides, polymerase, primers, etc. Furthermore, such artifacts can frequently have shorter length relative to the intended product and can amplify more efficiently than the intended products and dominate the reaction output. The formation of such artifacts in amplification reactions, even when only a single pair of primers is employed, can complicate downstream applications such as qPCR, cloning, gene expression analysis and sample preparation for next-generation sequencing. In some downstream applications, including several next-generation sequencing methods, this problem can be compounded by the requirement to practice a secondary amplification step, since the artifacts can be further amplified during the secondary amplification.
[0009] Nucleic acid molecules amplified in a multiplex PCR reaction can be used in many downstream analysis or assays with, or without, further purification or manipulation. For example, the products of a multiplex PCR reaction (amplicons) when obtained in sufficient yield can be used for single nucleotide polymorphism (SNP) analysis, genotyping, copy number variation analysis, epigenetic analysis, gene expression analysis, hybridization arrays, analysis of gene mutations including but not limited to detection, prognosis and / or diagnosis of disease states, detection and analysis of rare or low frequency allele mutations, nucleic acid sequencing including but not limited to de novo sequencing or targeted resequencing, and the like. Multiplex target amplification is used in many molecular biology applifications including, but not limited to detection of inherited diseases, congenital disorders, mutation detection associated with cancer, newborn disorders, pathogen identification, single cell genomics, forensic science and human identification.
[0010] One of the advantages and strengths of utilizing next generation sequencing (NGS) technology for DNA fingerprinting is that many targets can be interrogated simultaneously. The standard DNA fingerprinting gel electrophoretic system is limited in its ability to resolve multiple forensic DNA targets of different sizes using different fluorescent tags, further it is unable to differentiate single nucleotide changes. Next generation sequencing methods are not so limited and sequences can be obtained and targets identified regardless of the amplicon target size with no need for fluorescence tags, including single nucleotide changes. As such, NGS forensic DNA fingerprinting technologies can interrogate hundreds of targets simultaneously, quite the differentiator over the gel electrophoretic systems which currently can differentiate only a handful of targets, all of them either STR or ITR target. Next generation sequencing DNA forensic technologies can identify single nucleotide polymorphisms, or SNPs, which can be tied to ethnic, ancestry and phenotypic types of DNA fingerprints. For example, NGS DNA forensics methodologies can not only identify STRs and ITRs that differ from person to person, or animal to animal, but SNP identification can provide insight into a person's ancestral and ethnic heritage, their eye color, hair color, etc. This type of powerful resolution is not performed by the current gel electrophoresis systems.
[0011] However, great strides forward in technology are very rarely clean and tidy. For example, in order to sequence hundreds of DNA forensic targets oftentimes a DNA fragment library has to be created and it is the library of targets that is sequenced. One method of library preparation is to amplify targets, for example by polymerase chain reaction or PCR. Polymerase chain reaction creates exponential copies of the target being amplified thereby provided many copies for sequencing. Multiple sequences of a same region provides a robust, reproducible sequencing output that can be used with confidence in DNA databanking, criminal casework, etc.
[0012] PCR methodologies have their own challenges especially when there are potentially tens or hundreds of targets being amplified simultaneously. For example, for a multiplex amplification reaction resulting in differentially lengthed amplicons, amplification bias could occur wherein a normal ratio of long to short amplicons could be skewed such that either longer amplicons or shorter amplicons could be favored, thereby skewing an expected amplicon ratio. As such, bias can affect downstream sequencing as it would provide a skewed ratio of allelic target amplicons.
[0013] Another challenge is the interaction of primer to primer binding known as primer-dimerism that can occur even under normal amplification conditions, for example when only a set or a few sets of primers are present in one amplification reaction. Primer-dimers occur when the primers in a pair anneal to each other because of complementary sequences, or primers from different primer pairs anneal to each other, thereby taking them out of the amplification reaction altogether or they are extended and become unwanted templates themselves. These adverse primer-dimer reactions can have significant effects on the PCR reaction and resultant downstream library target pool that is used for sequencing. The unwanted primer-dimers could become unwanted templates, primer-dimers could result in desired targets being unamplified or minimally amplified, etc.
[0014] All of these unwanted events consume valuable reagent resources when they are used to sequence off target DNA fragments, consume valuable time and can lead to a low number of sequencing reads for a particular target or target sequence that is totally missing or dropped out.
[0015] Methods and compositions described in this disclosure are provided to minimize or eliminate primer-dimerism thereby increasing the efficiency and on read confidence of sequencing a sample as any off target sequencing reads waste reagents, time and more importantly might allow for a target not being sequenced deeply enough or not at all.
[0016] Provided herein are oligonucleotide compositions and methods for amplifying and sequencing a plurality of target polynucleotides from a sample. Also provided are methods for assembling the oligonucleotide compositions provided herein.
[0017] The compositions and methods provided herein are useful in many molecular biology applifications including, but not limited to detection of inherited diseases, congenital disorders, mutation detection associated with cancer, newborn disorders, pathogen identification, single cell genomics, forensic science and human identification. In some embodiments, the compositions and methods provided herein are useful to perform DNA profiling analyses, e.g., for purposes of determining a person's identity or to determine familial relationships, e.g., in the context of paternity testing or ancestry related research. In some embodiments, the compositions and methods provided herein can be used, for example, as forensic methods to analyze a DNA sample from a crime scene. The compositions and methods are not limited to DNA profiling of humans, but could be equally applicable for identifying lineage and ancestry for non-human animals, for example equine, canine, bovine, porcine, feline and other animals where lineage and parentage determinations might be of use. Additionally, the compositions and methods could be equally applicable for identifying lineage, ancestry, etc. for crop or plant species. The compositions and methods herein could therefore be applicable to human, non-human animals, plants, etc. where lineage and ancestry determinations might be desired. Additionally, the compositions and methods described here can be used wherever primer-dimer reactions are problematic, such as in amplifying cancer or disease related targets, or amplification of targets of any kind.Definitions
[0018] As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a biomarker" includes a mixture of two or more biomarkers, and the like.
[0019] The term "about," particularly in reference to a given quantity, is meant to encompass deviations of plus or minus five percent.
[0020] As used herein, the terms "includes," "including," "includes," "including," "contains," "containing," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, product-by-process, or composition of matter that includes or contains an element or list of elements does not include only those elements but can include other elements not expressly listed or inherent to such process, method, product-by-process, or composition of matter.
[0021] As used herein, "amplify", "amplifying" or "amplification reaction" and their derivatives, refer generally to any action or process whereby at least a portion of a nucleic acid molecule (referred to as a template nucleic acid molecule) is replicated or copied into at least one additional nucleic acid molecule. The additional nucleic acid molecule optionally includes sequence that is substantially identical or substantially complementary to at least some portion of the template nucleic acid molecule. The template nucleic acid molecule can be single-stranded or double-stranded and the additional nucleic acid molecule can independently be single-stranded or double-stranded. Amplification optionally includes linear or exponential replication of a nucleic acid molecule. In some embodiments, such amplification can be performed using isothermal conditions; in other embodiments, such amplification can include thermocycling. In some embodiments, the amplification is a multiplex amplification that includes the simultaneous amplification of a plurality of target sequences in a single amplification reaction. In some embodiments, "amplification" includes amplification of at least some portion of DNA and RNA based nucleic acids alone, or in combination. The amplification reaction can include any of the amplification processes known to one of ordinary skill in the art.
[0022] In some embodiments, the amplification reaction includes polymerase chain reaction (PCR). As used herein, the term "polymerase chain reaction" ("PCR") refers to the method described in U.S. Pat. Nos. 4,683,195 and 4,683,202, which describe a method for increasing the concentration of a segment of a polynucleotide of interest in a mixture of genomic DNA without cloning or purification.
[0023] As used herein "multiplex PCR" or "multiplex amplification" refers to selective and non-random amplification of two or more target sequences within a sample using at least one target-specific primer. In some embodiments, multiplex amplification is performed such that some or all of the target sequences are amplified within a single reaction vessel. The "plexy" or "plex" of a given multiplex amplification refers generally to the number of different target-specific sequences that are amplified during that single multiplex amplification. In some embodiments, the plexy can be about 12-plex, 24-plex, 48-plex, 96-plex, 192-plex, 384-plex, 768-plex, 1536-plex, 3072-plex, 6144-plex or higher.
[0024] As used herein, "amplification conditions" and its derivatives, generally refers to conditions suitable for amplifying one or more nucleic acid sequences. Such amplification can be linear or exponential. In some embodiments, the amplification conditions can include isothermal conditions or alternatively can include thermocyling conditions, or a combination of isothermal and themocycling conditions. Generally, the amplification conditions include a catalyst for amplification or for nucleic acid synthesis, for example a polymerase; a primer that possesses some degree of complementarity to the nucleic acid to be amplified; and nucleotides, such as deoxyribonucleotide triphosphates (dNTPs) to promote extension of the primer once hybridized to the nucleic acid. The amplification conditions can require hybridization or annealing of a primer to a nucleic acid, extension of the primer and a denaturing step in which the extended primer is separated from the nucleic acid sequence undergoing amplification. Typically, but not necessarily, amplification conditions can include thermocycling; in some embodiments, amplification conditions include a plurality of cycles where the steps of annealing, extending and separating are repeated. Typically, the amplification conditions include cations such as Mg++ or Mn++ and can also include various modifiers of ionic strength.
[0025] As used herein, "polymerase" and its derivatives, generally refers to any enzyme that can catalyze the polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Typically but not necessarily, such nucleotide polymerization can occur in a template-dependent fashion. Such polymerases can include without limitation naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, and fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof that retain the ability to catalyze such polymerization. Optionally, the polymerase can be a mutant polymerase comprising one or more mutations involving the replacement of one or more amino acids with other amino acids, the insertion or deletion of one or more amino acids from the polymerase, or the linkage of parts of two or more polymerases. Typically, the polymerase comprises one or more active sites at which nucleotide binding and / or catalysis of nucleotide polymerization can occur. Some exemplary polymerases include without limitation DNA polymerases and RNA polymerases. The term "polymerase" and its variants, as used herein, also refers to fusion proteins comprising at least two portions linked to each other, where the first portion comprises a peptide that can catalyze the polymerization of nucleotides into a nucleic acid strand and is linked to a second portion that comprises a second polypeptide. In some embodiments, the polymerase can be optionally reactivated, for example through the use of heat, chemicals or re-addition of new amounts of polymerase into a reaction mixture. In some embodiments, the polymerase can include a hot-start polymerase or an aptamer based polymerase that optionally can be reactivated.
[0026] As used herein, the term "primer" and its derivatives refer generally to any polynucleotide that can hybridize to a target sequence of interest. Typically, the primer functions as a substrate onto which nucleotides can be polymerized by a polymerase; in some embodiments, however, the primer can become incorporated into the synthesized nucleic acid strand and provide a site to which another primer can hybridize to prime synthesis of a new strand that is complementary to the synthesized nucleic acid molecule. The primer may be comprised of any combination of nucleotides or analogs thereof. In some embodiments, the primer is a single-stranded oligonucleotide or polynucleotide. The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and may comprise ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof.
[0027] As used herein, the term "Quality Control Sequence" or "QCS" refers to a nucleic acid sequence that is inserted in a primer and allows for an increase in the abundance of amplification products from (e.g., in a multiplexed PCR) a target polynucleotide of interest. Introduction of a QCS into one or more primers of a primer pool can be useful to determine accurate allele ratios for target polynucleotides in a sample, even in a case where an amplification reaction, e.g., a multiplexed PCR, is biased to overamplify a certain subset of alleles. Introduction of a QCS can also reduce or eliminate primer dimer formation, e.g., in a primer pool solution or in the course of a multiplexed PCR reaction. Additionally, a "Quality Control Sequence" refers to a nucleic acid sequence that is inserted into a primer, thereby incorporating the sequence into an amplification product, for purposes of improving the accuracy of quantifying the abundance of original template molecules from sequence PCR products.
[0028] As used herein, the term "QCS primer" refers to a primer including a QCS sequence. In some embodiments, a QCS primer is capable of amplifying a target polynucleotide of interest to detectable levels, whereas a primer that lacks the QCS but is otherwise essentially identical to the QCS primer is not capable of amplifying the target polynucleotide of interest to a detectable level, or is only capable of amplifying the target polynucleotide of interest to very low levels, e.g., to levels close to the detection limit of an assay analyzing the target polynucleotide (e.g., qPCR). A QCS incorporated into a primer can include, e.g., fully randomized, partially randomized, or fixed sequence, or the QCS can have a combination of fully randomized, partially randomized, or fixed nucleic acid positions in its sequence. In some embodiments, a QCS primer including one or more partially randomized or fixed positions in its sequence, or a combination thereof, is capable of amplifying a target polynucleotide of interest to detectable levels, whereas an otherwise essentially identical primer that includes a fully randomized QCS is not capable of amplifying the target polynucleotide of interest to a detectable level, or is only capable of amplifying the target polynucleotide of interest to very low levels, e.g., to levels close to the detection limit of an assay analyzing the target polynucleotide.
[0029] A QCS generally does not include a sequence that is a part of, or complementary to, an adapter sequence, a universal sequencing primer (e.g., Illumina ®< 's P5 or P7 primers), or a sequence of the primer's target polynucleotide. In some embodiments, the QCS of a QCS primer, or a combination of two QCSs in a primer pair, can include so many possible sequences that it is unlikely that different copies of the same target polynucleotide in a sample are labeled by the same QCS sequence, e.g., during amplification of the target polynucleotide using the QCS primers. For example, a sample can include about 100 copies of a genome or a target polynucleotide of interest and the QCS sequence of each primer in a QCS primer pair has five fully randomized positions and one fixed position. In this example, the QCS primer pair can include 45*2= 1, 048,575 possible QCS sequences and the chance that any two of the 100 target polynucleotides of interest in the sample share the same QCS sequence, e.g., following 2 PCR cycles, is > 1:10,000.
[0030] As used herein, the term "extension sequence" or "ES" refers to a sequence added to the QCS of a QCS primer to further improve the primer's ability to amplify (e.g., in a multiplexed PCR) a target polynucleotide of interest. For example, in some experimental results the QCS in a primer also contributed to primer-dimer formation. Addition of an ES to a QCS primer can, e.g., reduce a primer dimer formation, e.g., in a primer pool solution or in the course of a multiplexed PCR reaction. In some embodiments, a QCS-ES primer is capable of amplifying a target polynucleotide of interest to detectable levels, whereas a QCS primer that lacks the ES but is otherwise essentially identical to the QCS-ES primer is not capable of amplifying the target polynucleotide of interest to a detectable level, or is only capable of amplifying the target polynucleotide of interest to very low levels, e.g., to levels close to the detection limit of an assay analyzing the target polynucleotide (e.g., qPCR). An ES in a QCS-ES primer is generally a fixed sequence. In some embodiments, the ES is shorter than the QCS in the QCS-ES primer. An ES generally does not include a sequence that is a part of, or complementary to, an adapter sequence, a universal sequencing primer (e.g., Illumina ®< 's P5 or P7 primers), or a sequence of the primer's target polynucleotide.
[0031] As used herein, the term "plurality" refers to a population of two or more, such as two or more primers or other referenced molecules. In some embodiments, the two or more molecules of a plurality of molecules are the same molecules. For example, a plurality of primers can include two or more primers having the same nucleic acid sequence. In some embodiments, the two or more of a plurality of molecules are different molecules. For example, a plurality of primers can include two or more primers having different nucleic acid sequences. A plurality includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or a 100 or more different members. A plurality can also include 200, 300, 400, 500, 1000, 5000, 10000, 50000, 1x105, 2x105, 3x105, 4x105, 5x105, 6x105, 7x105, 8 x105, 9x105, 1x106, 2x106, 3x106, 4x106, 5x106, 6x106, 7x106, 8x106, 9x106 or 1x107 or more different molecules. A plurality includes all integer numbers in between the above exemplary plurality numbers.
[0032] As used herein, the term "target polynucleotide" is intended to mean a polynucleotide that is the object of an analysis or action. The analysis or action includes subjecting the polynucleotide to copying, amplification, sequencing and / or other procedure for nucleic acid interrogation.
[0033] As used herein, the term "target specific" or "target nucleic acid specific" or "TS" when used in reference to a primer or other oligonucleotide is intended to mean a primer or other oligonucleotide that includes a nucleotide sequence specific to a target polynucleotide sequence, namely a sequence of nucleotides capable of selectively annealing to an identifying region of a target polynucleotide.
[0034] As used herein, the term "adaptor" or "adaptor sequences" and its derivatives refers to nucleic acid sequences that are appended to another nucleic acid sequence. For example, in this disclosure forward and reverse primers are used in amplification of a target sequence. Those primers comprise target specific sequences (TS), optionally a quality control sequence (QCS) with or without one or more adjacent extension sequences (ES), and an adaptor sequence. Adaptor sequences are not required, but in the examples herein adaptor sequences are present. The adaptor is substantially non-complementaty to the 3' end or the 5' end of any target sequence present in a sample. Suitable lengths are in the range of about 10-100 nucleotides, preferably about 15-50 nucleotides. An adaptor can include any combination of nucleotides or nucleic acids. In some aspects, an adaptor can include one or more cleavage groups. An adaptor can include a sequence that is substantially identical, or substantially complementary, to at least a portion of a primer such as a universal primer for use in amplification of a nucleic acid. An adaptor can include one or more of a barcode or tag to assist with downstream capture, counting, error correction, sample identification, or sequences specific to a particular sequencing platform. One or more primers of the plurality of primers described herein include an adapter sequence (AS). In some embodiments, the AS is located on the 5'-end of a quality control sequence. Exemplary adaptor sequences can be found in the FORENSEQ DNA Signature Prep Reference guide from Illumina. The current disclosure is not limited to the types of adaptors that could be incorporporated into an oligonucleotide.
[0035] As used herein, "quality control sequence 1" or "QCS1" refers to a nucleic acid sequence in which each nucleic acid position is fully randomized. A fully randomized nucleic acid position can, e.g., include any one of the four naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), or thymine (T). A TS linked to a 5-mer QCS1 including A, G, C, and T can, for example, be linked to any one of 45=1,024 possible QCS1 sequences. In some embodiments, a fully randomized nucleic acid position can include a nucleic acid including additional naturally occurring or synthetic nucleobases, such as idenosine, uracil, and the like. In some embodiments, different nucleic acids in a fully randomized nucleic acid position can be present in approximately equimolar ratios (e.g., 1:1:1:1 ratios for A, G, C and T). In some embodiments, the ratios of different nucleic acids in a fully randomized nucleic acid position can differ from equimolar ratios. For example, in some embodiments, one or more nucleic acids in a fully randomized nucleic acid position can be more abundant than one or more other nucleic acids in the fully randomized nucleic acid position (e.g., 2:1:1:1 ratios for A, G, C and T).
[0036] As used herein, "quality control sequence 2" or "QCS2" refers to a nucleic acid sequence in which one or more nucleic acid positions are partially randomized. A partially randomized nucleic acid position can include a subset of nucleic acids found in a fully randomized position, such as a fully randomized position in QCS1. In some embodiments, a partially randomized position includes nucleic acids including two or three of the nucleobases A, G, C, T. For example, a TS linked to a 5-mer QCS2 in which one position is partially randomized and includes for example A or G, and in which the remaining four positions are fully randomized to any one of 2*4^4=512 possible QCS2 sequences. When one position is only partially random, where the partially random bases takes on one of two possibilities (instead of four): 2 * 4^4 = 2 * 4 * 4 * 4 * 4 = 512.
[0037] In some embodiments, a partially randomized position can be A or G, A or C, A or T, G or C, G or T, or C or T. In some embodiments, a partially randomized position can be A, G, or C; A, G, or T; A, C or T; or G, C or T. In some embodiments, two or more (but not all) nucleic acid positions in QCS2 are partially randomized. The two or more partially randomized nucleic acid positions in QCS2 can include the same combinations of nucleic acids, or different combinations of nucleic acids. In some embodiments, different nucleic acids in a partially randomized nucleic acid position can be present in approximately equimolar ratios (e.g., 1:1:1 ratios for A, G, and C). In some embodiments, the ratios of different nucleic acids in a partially randomized nucleic acid position can differ from equimolar ratios. For example, in some embodiments, one or more nucleic acids in a partially randomized nucleic acid position can be more abundant than one or more other nucleic acids in the partially randomized nucleic acid position (e.g., 2:1:1 ratios for A, G, and C).
[0038] As used herein, "quality control sequence 3" or "QCS3" refers to a nucleic acid sequence in which one or more, but less than all, nucleic acid positions are fixed. A fixed nucleic acid position can include one of A, C, T and G. For example, a TS linked to a 5-mer QCS3, in which one position is fixed and in which the remaining four positions are fully randomized canbe linked to any one of 1*4^4 = 256 possible QCS3 sequences. That is, when one position is completely fixed, where the non-random base takes a single predefined possibility: 1 * 4^4 = 1 * 4 * 4 * 4 * 4 = 256.
[0039] As used herein, "quality control sequence 4" or "QCS4" refers to a nucleic acid sequence in which all nucleic acid positions are fixed (e.g., as A, G, C, or T). For example, a TS linked to a QCS4 is linked to only one possible sequence.
[0040] As used herein, "quality control sequence 5" or "QCS5" refers to a nucleic acid sequence in which one or more nucleic acid positions are fully randomized and one or more nucleic acid positions are partially randomized. Different fully randomized positions in QCS5 can include the same sets of nucleic acids (e.g., all positions include A, G, C or T), or different sets of nucleic acids (e.g., one position includes A, G, C, or T and another position includes A, G, C, or U). Different partially randomized positions in QCS5 can include the same sets of nucleic acids (e.g., all positions include A, G, or C), or different sets of nucleic acids (e.g., one position includes A, G, and C and another position includes A, C, or T).
[0041] As used herein, "quality control sequence 6" or "QCS6" refers to a nucleic acid sequence in which one or more nucleic acid positions are fully randomized and one or more nucleic acid positions are fixed. Different fully randomized positions in QCS6 can include the same sets of nucleic acids (e.g., all positions include A, G, C or T), or different sets of nucleic acids (e.g., one position includes A, G, C, or T and another position includes A, G, C, or U). Different fixed nucleic acid positions in QCS6 can include the same nucleic acid (e.g., all positions are "A"), or different nucleic acids (e.g., one position is "A" and another position is "G").
[0042] As used herein, "quality control sequence 7" or "QCS7" refers to a nucleic acid sequence in which one or more nucleic acid positions are partially randomized and one or more nucleic acid position are fixed. Different partially randomized positions in QCS7 can include the same sets of nucleic acids (e.g., all positions include A, G, or C), or different sets of nucleic acids (e.g., one position includes A, G, or C and another position includes A, G, or T). Different fixed nucleic acid positions in QCS7 can include the same nucleic acid (e.g., all positions are "A"), or different nucleic acids (e.g., one position is "A" and another position is "G").
[0043] As used herein, "quality control sequence 8" or "QCS8" refers to a nucleic acid sequence in which one or more nucleic acid positions are fully randomized, one or more nucleic acid positions are partially randomized, and one or more nucleic acid positions are fixed. Different fully randomized positions in QCS8 can include the same sets of nucleic acids (e.g., all positions include A, G, C or T), or different sets of nucleic acids (e.g., one position includes A, G, C, or T and another position includes A, G, C, or U). Different partially randomized positions in QCS8 can include the same sets of nucleic acids (e.g., all positions include A, G, or C), or different sets of nucleic acids (e.g., one position includes A, G, or C and another position includes A, G, or T). Different fixed nucleic acid positions in QCS7 can include the same nucleic acid (e.g., all positions are "A"), or different nucleic acids (e.g., one position is "A" and another position is "G").
[0044] The following Table 1 compares the different potential sequences for a QCS. Table 1-Quality Control SequencesQuality Control Sequence Content QCS1All nucleotides are fully randomizedQCS2One or more nucleotides are partially randomizedQCS3One or more, but less than all, nucleotides are fixedQCS4All nucleotides are fixedQCS5One or more nucleotides are fully randomized, one or more are partially randomizedQCS6One or more nucleotides are fully randomized, one or more are fixedQCS7One or more nucleotides are partially randomized, one or more nucleotides are fixedQCS8One or more nucleotides are fully randomized, one or more are partially randomized, and one or more are fixed
[0045] As used herein, "detectable amplification," refers to a level of amplification of a target polynucleotide that is detectable by a method for nucleic acid detection known in the art, such as (quantitative) PCR gel electrophoresis, LC-MS, HPLC, microarray, or the like. In some embodiments, detectable expression includes a level of expression resulting in an assay signal intensity (e.g., in a qPCR assay) that is at least two standard deviations (2 □ □ or at least three standard deviations (3 □ □ □ above a background or negative control signal of the assay (e.g., an assay signal observed in the absence of a nucleic acid).
[0046] As used herein, "no detectable amplification" refers to a level of amplification of a target polynucleotide that is either not detectable by a method for nucleic acid detection known in the art, such as (quantitative) PCR, gel electrophoresis, LC-MS, HPLC, microarray, or the like. In some embodiments, "low-level amplification" refers to a level of expression resulting in an assay signal intensity (e.g., in a qPCR assay) that is within or close to the background noise of an assay, e.g., an assay signal intensity of less than two standard deviations (2 □ □ from an average, median or mean background or negative control signal of the assay (e.g., an assay signal observed in the absence of a nucleic acid).
[0047] In some embodiments, the disclosure relates generally to human identification methods using one or more target specific primers disclosed herein or one or more target specific primers designed using the primer design criteria outlined herein. In one embodiment, a forensic or human identification sample containing at least one target sequence can be amplified using any one or more of the target-specific primers disclosed herein or using the primer criteria outlined herein.Target polynucleotides
[0048] In another aspect, provided herein are methods for amplifying or sequencing a plurality of target polynucleotides in a sample including using an oligonucleotide composition provided herein.
[0049] In some embodiments, the method includes providing a sample. As defined herein, "sample" and its derivatives, is used in its broadest sense and includes any specimen, culture and the like that is suspected of including a target nucleic acid. The sample can include any biological, clinical, surgical, agricultural, atmospheric or aquatic-based specimen containing one or more nucleic acids. The term also includes any isolated nucleic acid sample such as genomic DNA (gDNA), cell free DNA (cfDNA), circulating tumor DNA (ctDNA), complementary DNA (cDNA), mitochondrial DNA (mtDNA), or DNA from a single cell, formalin-fixed paraffin-embedded DNA (FFPE DNA), complementary DNA (cDNA), mitochondrial DNA (mtDNA) or DNA from a single cell. In some embodiments, the sample includes cell debris. In some embodiments, the sample includes a cell lysate.
[0050] In another embodiment, low molecular weight nucleic acid includes enzymatically or mechanically fragmented DNA. It is also envisioned that the sample can be from a single individual, a collection of nucleic acid samples from genetically related members, nucleic acid samples from genetically unrelated members, nucleic acid samples (matched) from a single individual such as a tumor sample and normal tissue sample, or sample from a single source that contains two distinct forms of genetic material such as maternal and fetal DNA obtained from a maternal subject, or the presence of contaminating bacterial DNA in a sample that contains plant or animal DNA. In some embodiments, the source of nucleic acid material can include nucleic acids obtained from a newborn, for example as typically used for newborn screening.
[0051] In some embodiments, the sample can include nucleic acid molecules obtained from biopsies, tumors, scrapings, swabs, blood, mucus, urine, plasma, semen, hair, laser capture micro-dissections, surgical resections, and other clinical or laboratory obtained samples. In some embodiments, the sample can be an epidemiological, agricultural, forensic or pathogenic sample.
[0052] In some embodiments, the sample is a mammalian sample. In some embodiments, the sample is a human or ape (e.g., chimpanzee, gorilla, orangutan, gibbon, and the like) sample. In some embodiments, the sample is from a farm animal (e.g., pig, sheep, cow, horse, chicken, turkey, fish, and the like), pet (e.g., cat, dog, hamster, mouse, rat, and the like), or animal model (e.g., transgenic mouse or knock-out mouse). In another embodiment, the sample can include nucleic acid molecules obtained from a non-mammalian source such as a plant, bacteria, virus or fungus. In some embodiments, the source of the nucleic acid molecules may be an archived or extinct sample or species.
[0053] In some embodiments, the sample is a bodily fluid. In some embodiments, the bodily fluid includes, e.g., without limitation, amniotic fluid, aqueous humour and vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chime, endolymph and perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), serous fluid, semen, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretion and vomit.
[0054] In some embodiments, the sample is a forensic sample. In some embodiments, the forensic sample includes a hair, a fingernail, a scraping, a swab (e.g., friction swab, pillbox swab), a rope, dirt, a fabric or fiber, and the like. In some embodiments, the forensic sample was collected at a crime scene. In some embodiments, the forensic sample was collected from a witness, a victim, or a suspect. In one embodiment, forensic samples can include nucleic acids obtained from a laboratory associated with a forensic investigation or include forensic samples obtained by law enforcement agencies, one or more military services or any such personnel.
[0055] In some embodiments, the sample is a plant sample. In some embodiments, the plant sample is derived from a vegetable. In some embodiments, the plant sample is derived from a fruit.
[0056] In some embodiments, the method includes contacting the sample with an oligonucleotide composition provided herein.
[0057] In some embodiments, the method includes amplifying one or more target polynucleotides of interest from the sample, e.g., by PCR, using an oligonucleotide composition provided herein. In some embodiments, one or more of the target polynucleotides include an autosomal, Y- or X-chromosome STR. In some embodiments, one or more of the target polynucleotides include an identity-informative SNP. In some embodiments, one or more of the target polynucleotides include an ancestry-informative or a phenotype-informative SNP. In some embodiments, one or more of the target polynucleotides include an autosomal, Y- or X-chromosome STR, an identity-informative SNP, an ancestry-informative SNP or a phenotype-informative SNP.Amplification bias
[0058] Without wishing to be bound by theory, the present application is based, in part, on the observation that when performing multiplexed PCR to amplify a plurality of target polynucleotides of interest in a single reaction, e.g., from a genomic DNA sample, the amplification of at least some target polynucleotides can be biased such that target polynucleotide ratios are distorted in the PCR product relative to the ratios in the original sample. For example, it was observed that target polynucleotides containing certain STR alleles are frequently over-amplified in multiplexed PCR. Overamplification of some STR alleles in a sample can result in "inaccurate allele ratio" estimation. For example, an allele comprising a region containing a repeated sequence wherein that repeated sequence is repeated only a few times (a short STR) is amplified more during a multiplexed PCR than an allele comprising a region containing a repeated sequence wherein that repeated sequence is repeated a large number of times (a long STR). Such biased PCR amplification results in inaccurate STR allelic ratios in the amplification product (e.g., 90% short STRs to 10% long STRs, as determined by counts of sequencing reads) relative to "accurate STR allelic ratios" present in a normal non-amplified genomic DNA sample (e.g., 66.7% short STR alleles to 33.3% long STR alleles).
[0059] The present application is further based, in part, on the observation that incorporation of random (not-predefined) nucleotide sequences into the primers of a multiplexed PCR reaction can enable correct allele ratio evaluation even in cases where the PCR reaction is biased. Such random nucleotide sequences incorporated into PCR primers provide one example of "quality control sequences" (QCSs) provided herein. FIG. 1 illustrates an example in which random 5-mer nucleotide sequences (QCS) are incorporated into each primer of a PCR primer pair. The QCS-labeled primers are incorporated into target nucleotide amplification products during theearly cycles of a multiplexed PCR reaction, such that each target nucleotide in a sample can be identified by its specific QCS combination. An accurate STR allele ratio can be determined for target polynucleotides of interest in the original sample by counting QCS labels in the PCR product, rather than sequencing reads. An accurate STR allele ratio can be determined by counting QCS sequence instances, even though target polynucleotides with short STR sequences are overamplified in the PCR reaction.
[0060] If a QCS is sufficiently long it can uniquely label individual primer molecules. In practice a QCS can be designed to be of such a length that the probability of encountering two primer-molecules with the same QCS is small. In practice, DNA input for PCR frequently consists of only a few hundred copies of the genomic sample. Therefore, the probability of labeling copies of the same target polynucleotide with the same QCS is less than 1 in about 1,000. The number of QCS sequences, nQCS, per original target molecule depends on the experimental protocol, however generally if both the forward and reverse primers each comprise a 5nt random QCS then approximately 1,048,576 different possible QCS could be generated and the chance for any two random molecules having the same QCS is approximately 1 / 1,000,000. If we assume there are 300 target molecules then we might expect that (1-1 / nQCSn-1)=99.97% of the targets molecules should have a unique QCS.Primer-dimer events
[0061] The present application is further based, in part, on the observation that QCSs in PCR primers can promote primer dimerization. FIG. 2 illustrates examples for primer dimer formation in primers that do have a QCS. As known in the art, in the absence of a QCS in a PCR primer, primer-dimers can form, for example if a sequence of one primer and a sequence in another primer are partly complementary. In primers that include a QCS, the QCS itself can form part of a nucleotide sequence that is complementarity to a sequence in another primer ("complementary sequence stretch"), and thereby promote primer dimerization in a QCS-mediated fashion.
[0062] Primer dimers formed during a multiplex PCR can be extended to form sequenceable products. This can reduce the quality and quantity of sequencing data obtained from the PCR products of interest. For example, an abundance of sequenceable primer dimers can use up valuable surface area on the flowcell in a next-generation sequencing system and thereby reduce the capacity available to sequence target polynucleotides of interest in a sample. In addition, a flow cell surface that a large percentage of off target reads or reads of lower quality and quantity can lower the availability of pooling multiple samples in a sequencing reaction because a certain percentage of the sequencing data is expected to be of no interest, thereby increasingoverall sequencing costs. Under certain PCR conditions primer dimers can become so abundant, or even dominant a PCR reaction especially in late PCR cycles, that the capacity of a DNA polymerase to amplify target polynucleotides of interest is negatively affected. Reduced efficiency of the PCR reaction can reduce the yield of correct on-target reads for target-polynucleotides.
[0063] The present application is further based on the observation that dimerization of PCR primers that include a randomized QCS can be reduced by introducing certain modifications in the QCS to disrupt complementarity stretches in primer dimers and prevent or reduce primer dimer formation. Shown in FIG. 3A is an example of a completely randomized, un-modified QCS sequence. To disrupt complementarity stretches in primer dimers, rather than incorporating a randomized QCS into a PCR primer as shown in FIG 3A, the QCS sequence can be modified to be only partially randomized or to have defined nucleic acids in one or more positions in the sequence (FIG. 3B). A QCS can also be modified to add an extension sequence (ES), e.g., on the 5'-end (also called aSpacer on FIG 3C), the 3'-end (also called gSpacer on FIG 3C), or both ends of the QCS, and the extension sequence can disrupt complementarity stretches (FIG. 3C). In another embodiment, a QCS can be both modified to be only partially randomized or to have defined nucleic acids in one or more positions in its sequence and include an ES, e.g., on the 5'-end, the 3'-end, or both ends of the QCS to disrupt a complementarity stretch (FIG. 3D).
[0064] The present application is further based on the observation that primer pools including primers with or without a QCS, or including primers with different types of QCSs, such as a fully randomized QCS, a partially randomized QCS, a fully defined QCS, an extended QCS (QCS-ES), or combinations thereof can be used to amplify (e.g., in a multiplex PCR) and to sequence (e.g., by next-generation sequencing) target polynucleotides of interest from a sample. Target polynucleotide amplification and sequencing using the oligonucleotide compositions provided herein can yield improved sequencing data (e.g., in terms of % aligned reads) relative to data obtained, e.g., with primers that do not include a QCS or that only include one type of QCS (e.g., a fully randomized QCS).
[0065] Primer dimer formation in an oligonucleotide composition provided herein can be determined using any method known in the art, such as HPLC or LC-MS. In some embodiments, primer dimer yields are determined by size-exclusion chromatography, capillary electrophoresis, gel electrophoresis, bioanalyzer, HPLC, LC-MS or sequencing.Quality control sequences
[0066] In one aspect, provided herein is an oligonucleotide composition, including a plurality of primers, each primer including a target nucleic acid specific sequence (TS) and a quality control sequence (QCS), wherein the plurality of primers includes two or more QCSs selected from the group consisting of a first QCS (QCS1), wherein each nucleic acid position is fully randomized, a second QCS (QCS2), wherein one or more nucleic acid positions are partially randomized, a third QCS (QCS3), wherein one or more nucleic acid positions are fixed, a fourth QCS (QCS4), wherein all nucleic acid positions are fixed, a fifth QCS (QCS5), wherein one or more nucleic acid positions are fully randomized and one or more nucleic acid positions are partially randomized, a sixth QCS (QCS6), wherein one or more nucleic acid positions are fully randomized and one or more nucleic acid positions are fixed, a seventh QCS (QCS7), wherein one or more nucleic acid positions are partially randomized and one or more nucleic acid position are fixed, and an eighth QCS (QCS8), wherein one or more nucleic acid positions are fully randomized, one or more nucleic acid positions are partially randomized, and one or more nucleic acid positions are fixed, wherein each of the two or more QCSs is located on a different primer of the plurality of primers.
[0067] In some embodiments, the oligonucleotide composition includes one or more primers including a TS and not including a QCS. In some embodiments, the plurality of primers include one or more primers including a TS and not including a QCS or an ES. The final determination of which primers are in need of a QCS and / or and ES sequence(s) is dependent on the degree of primer-dimer interations and which primers are engaging in primer-dimerization.
[0068] In some embodiments, the primers of a plurality of primers including the same TS also include the same QCS. For example, each primer in a plurality of primers including a first TS (TS1), can include the same QCS2 (QCS2(1)).
[0069] In some embodiments, primers of different pluralities of primers include different QCSs. In some embodiments, the different QCSs can be of different QCS categories (e.g., QCS1, QCS2, QCS3, QCS4, QCS5, QCS6, QCS7, or QCS8). For example, primers of a first plurality of primers can include a QCS2, and primers of a second plurality of primers can include a QSC3. In some embodiments, the different QCSs can be of the same QCS category. For example, primers of a first plurality of primers include a QCS2(1) in which one nucleic acid position is partially randomized and primers of a second plurality of primers include a QCS2(2) in which two nucleic acid positions are partially randomized.
[0070] In some embodiments, primers of different pluralities of primers include different TSs and the same QCS. For example, the primers of a first plurality of primers can include a TS1 and a QCS2(1), and the primers of a second plurality of primers can include a TS2 and the same QCS2(1).Extension sequences
[0071] In some instances the inclusion of a QCS in a primer can lead to the QCS participating in primer-dimer formation. In this instance, the inclusion of extension sequences or ES can additionally be included in a primer to minimize or eliminate the created primer-dimer (FIG. 2). In some embodiments of the compositions provided herein, the QCS of one or more primers in the plurality of primers is further flanked by an extension sequence (ES), on one or both sides of the QCS. In some embodiments, the QCS flanked by an extension sequence is a QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, or QCS8. In some embodiments, the QCS is flanked by one ES. In some embodiments, the QCS is flanked by the ES on the 5'-end of the QCS, also called the "aSpacer". In some embodiments, the QCS is flanked by the ES on the 3'-end of the QCS, also called the "gSpacer". In some embodiments, the QCS is flanked by an ES at the 5'-end and at the 3'-end, thereby having the configuration of "aSpacer-QCS-gSpacer".
[0072] In some embodiments, the ES on the 5'-end of the QCS is the same as the ES on the 3'-end of the QCS. In some embodiments, the ES on the 5'-end of the QCS is different from the ES on the 3'-end of the QCS. In some embodiments, two or more ESs linked to different QCSs in a plurality of primers have different nucleic acid sequences. In some embodiments, two or more ESs linked to different QCSs in a plurality of primers have the same nucleic acid sequences.
[0073] In some embodiments, the QCS of one or more primers in the plurality of primers is not flanked by an ES and the QCS of one or more different primers is flanked by an ES. In some embodiments, the QCS is flanked by the ES on the 5'-end of the QCS. In some embodiments, the QCS is flanked by the ES on the 3'-end of the QCS. In some embodiments, the QCS is flanked by an ES on the 5'-end of the QCS and on the 3'-end of the QCS.
[0074] In some embodiments, the QCS of one or more primers in the plurality of primers is not flanked by an ES, the QCS of one or more primers is flanked by one ES (e.g., on the 5'-end or the 3'-end of the QCS), and the QCS of one or more primers is flanked by two ES (e.g., on the 5'-end and the 3'-end of the QCS).
[0075] In some embodiments, the QCS of one or more primers is flanked by one ES (e.g., on the 5'-end or the 3'-end of the QCS), and the QCS of one or more primers is flanked by two ES (e.g., on the 5'-end and the 3'-end of the QCS).
[0076] In some embodiments, one or more primers of the plurality of primers includes an ES that is located between the AS and the QCS (AES). In some embodiments, one or more primers of the plurality of primers includes an ES that is located between the QCS and the TS (TES). In some embodiments, one or more primers of the plurality of primers includes an AES and a TES. In some embodiments, one or more primers of the plurality of primers includes an AES or a TES, and one or more primers of the plurality of primers includes an AES and a TES.
[0077] In some embodiments, the ES is a fixed sequence. In some embodiments, the ES includes between 2 and 10 nucleotides. In a preferred embodiment, the ES sequence is 3 to 5 nucleotides long.
[0078] In some embodiments, the oligonucleotide compositions provided herein include only a decreased amount, if any, primer dimers, e.g., when the compositions are dissolved in an aqueous buffer (e.g., PCR reaction buffer). In some embodiments, an oligonucleotide composition including one or more QCS primers or one or more QCS-ES primers, in which the QCS or QCS-ES primers include two or more QCS of QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, or QCS8, include less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 1%, or less than 0.1% of primer dimers compared to an oligonucleotide composition including primers that lack the QCS or QCS-ES of the QCS primers or QCS-ES primers, and that otherwise have the same nucleotide sequences, (e.g., same ADs, same TSs).
[0079] In some embodiments, the oligonucleotide compositions provided herein include only a decreased amount, if any, primer dimers, e.g., when the compositions are dissolved in an aqueous buffer (e.g., PCR reaction buffer). In some embodiments, an oligonucleotide composition including one or more QCS primers or one or more QCS-ES primers, in which the QCS or QCS-ES primers include two or more QCS of QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, or QCS8, include less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 1%, or less than 0.1% of primer dimers compared to an oligonucleotide composition including QCS or QCS-ES primers including only one type of QCS (e.g., QCS1), and which otherwise have the same nucleotide sequences (e.g., same ADs, same TSs).Target sequences
[0080] The plurality of primers in the oligonucleotide compositions provided herein can include a plurality of different TSs. In some embodiments, the plurality of different TSs includes between about 20 and about 1000 TSs. In some embodiments, the plurality of different TSs includes between 100 and 400 TSs. In some embodiments, the plurality of different TSs includes between 200-300 TSs. In some embodiments, the different TSs are specific for different STRs in a genome. In some embodiments, the different TSs are specific for different single nucleotide polymorphisms (SNPs) in a genome. In some embodiments, the different TSs are specific for one or more STRs and one or more SNPs in a genome.
[0081] In some embodiments, the TSs of one or more primers are complementary to a region flanking a STR region. In some embodiments, the plurality of primers includes a primer including the nucleotide sequence of one or more primers, (FIG. 5) which includes primers for amplifiying the STRs D16S359, D61043, DYS570, D19S433, PentaD, DYS576, AmelPP, DXS10135, D13S317, DYS389, D20S482, DXS10074 and SNPs rs1805009, rs10776839, rs2831700, rs1042602, and rs1058083. In some embodiments, the plurality of primers includes a primer including the nucleotide sequence of one or more primers, (FIG. 5) which includes primers for amplifying the STRs DYS392, D22S1045, DYS19, DYS456, DYS439, and DYS635.
[0082] In some embodiments, the plurality of primers includes a primer including the nucleotide sequence of one or more STR or ITR-targeted primers of WO 2015 / 126766, which is incorporated below. Table 2-STR targeted primer sequences without tags and the corresponding amplicon sizesSEQ ID NO STR LOCUS PRIMER EXAMPLES OF STR PRIMERS WITHOUT TAGS AMPLICON SIZE 1AmeIPP_F_TCCCTGGGCTCTGTAAAGAA106, 1122AmeIPP_R_SmATCAGAGCTTAAACTGGGAAGCTG3CSF1PO_F1_TACAGTAACTGCCTTCATAGATAG1174CSF1PO_R1_SmGTGTCAGACCCTGTTCTAAGTA5D5S818_F2_TTGATTTTCCTCTTTGGTATCCTTATGTAAT1126D5S818_R2_SmACAACATTTGTATCTTTATCTGTATCCT7D8S1179_F1_TTTTGTATTTCATGTGTACATTCGTATC1108D8S1179_R1_SmACCTATCCTGTAGATTATTTTCACTGTG9D18S51_F1 TCTCTGAGTGACAAATTGAGACCTT18410D18SS1_R1_TTTAACTTCTCTGGTGTGTGGAGATG11D19S433_F1_TTTTGGTGCACCCATTACCCG18812D19S433_R1_SmAGGAGGTTGAGGCTGCAAAA13D7S820_F2_TCACCAAATATTGGTAATTAAATGTTTACTATAGAC16714D7S820_R2_SmTAAAGGGTATGATAGAACACTTGTC15D16S539_F2_TCAAAGGCAGATCCCAAGCTCT16016D16S539_R2_SmTGTGTGTGCATCTGTAAGCAT17D3S1358_F2_TTGGTGTGTATTCCCTGTGCC17018D3S1358 R2 SmGCAGTCCAATCTGGGTGACA19D10S1248_F1_TCCAATCTGGTCACAAACATATTAATGAA14820D10S1248_R1_SmTTTCCCTTGTCTTGTTATTAAAGGAAC21TH01_F1_TTTCCCATTGGCCTGTTCCTC11222TH01_R1_SmCTGTACACAGGGCTTCCGAG23FGA F2 TGCTGAGTGATTTGTCTGTAATTG18824FGA_R2_SmGAACTCACAGATTAAACTGTAACCAAAATAAAATTAG25D61043_F1_TCAATAGTGTGCAAGGATGGGTG17526D61043_R1_SmTCTGTGGTTCTCCAGCTTAC27TPOX_F1_TCTTAGGGAACCCTCACTGAATG7728TPOX_R1_SmGTCCTTGTCAGCGTTTATTTGC29D13S317_F2_TTTGGGTTGAGCCATAGGCAG16230D13S317_R2_SmGCATCCGTGACTCTCTGGAC31D21S11_F1_TGTTATGGGACTTTTCTCAGTCTCCAT22632D21S11_R3_SmGAGACTAATAGGAGGTAGATAGACTGG33D12S391_F1_TGAGACTGTATTAGTAAGGCTTCTC25334D12S391_R2_SmCCTGGACTGAGCCATGCTCC35D1S1656_F2_TCAGTCCTGTGTTAGTCAGGATTC17336D1S1656_R1_SmTCAAGGGTCAACTGTGTGATGT37D9S1122_F3_TCTTCTGAAAGCTTCTAGTTTACCT12038D9S1122_R2_SmTTGCTTATTTGTGGGGGTATTTCA39PentaE_F1_TAAGAATTCTCTTATTTGGGTTATTAATTG36240PentaE_R1_SmAAATTGTGGACAGGTGCGGT41D17S1301_F2_TCCATGTAAAAATACATGCATGTGTTTATTTATAC14242D17S1301_R2_SmTGATTAAAAAGAATGAAGGTAAAAATGTGTATAAC43D2S441_F2_TCCAAATGTTTATGATTAATCTTTTAAATTGGAGC16044D2S441 R3 SmGTAACAAGGGCTACAGGAATCATGAG45D4S2408_F3_TTCATCCACTGAAATGACTGAAAAATAG10246D452408_R9_SmAGGTACATAACAGTTCAATAGAAAG47D2S1338_F2_TGAGTTATTCAGTAAGTTAAAGGATTGCAG16248D2S1338_R2_SmGGGAGCCAGTGGATTTGGAAACAG49PentaD_F3_TGCATGGTGAGGCTGAAGTAG26850PentaD_R1_SmCTAACCTATGGTCATAACGATTTTT51vWA_F3_TGATGATAAGAATAATCAGTATGTGACTTGG16052vWA_R3_SmATAGGTTAGATAGAGATAGGACAGATGATA53SE33_F1_TCCCTACCGCTATAGTAACTTGC38054SE33_R2_SmCACGTCTGTAATTCCAGCTCCTA55D205482_F3_TGGAAGCGTGTACTAGAGTTCTTCAG14556D20S482_R2_SmGGACAGCCTCCATATCCACATG57DXS10074_F1_TTTCCTACTGCCCCACCTTTATTG21258DXS10074_R1_smTTTATGGTCTCAGTGCCCCTCAGA59DXS10103_F1_smTCATAATCACATATCACATGAGC17760DXS10103_R1_TAAACAGAACCAGGGGAATGAA61DXS10135_F1_TTGAAACTAAAGTCAAATGGGGCTAC26862DXS10135_R1_smTAAGGGGTGACACCTCTCTGGATA63DXS8377_F2_smCCCAGCCTACATCTACCACTTCATG27664DX58377_R2_TCTAATGTTCGTATGGACCTTTGGAAAGC65DXS7423_F1_smGTCTCCAGTACCCAGCTAGCTTAG19166DXS7423_R1_TTCTCCCAACCTGCCCTTTATCA67DXS8378_F1_smTTTGGGCTGACACAGTGGCT44268DXS8378_R1_TTTGATCAACACAGGAGGTTTGACC69HPRTB_F1_smTATACCACTTTGATGTTGACACTAGTTTAC21370HPRTB_R1_TCCTGTCTATGGTCTCGATTCAAT71DXS10148_F3_smTGCATGACAGAGGGAGATTCT25672DXS10148_R3_TAGAGGGGAAATAGTAGAATGAGGATG73DXS7132_F3_smGCCAAACTCTATTAGTCAACGTTC20474DXS7132_R4_TCTGGTTCTCTAGCTCACATACAGT75DYF387S1ab_F2_TTTTACCCCTAACAAGAAAAAAAGAAGAA227,23176DYF387S1ab_R2_SmCAGTGTGAGAAGTGTGAGAAGTGC77DYS385a_b_F1_TGACACCATGCCAAACAACAAC260,24878DYS385a_b_R1_SmATCTATCTATTCCAATTACATAGTCC79DYS389I_II_F3_TTCATTATACCTACTTCTGTATCCAACTCTC183,30380DYS389I_II_R3_SmGGAACACAATTATCCCTGAGTAGCAG81DYS390_F2_TGGTAGCATAATAGAAATTTTATGAGTGGG31882DYS390_R2_SmGAAGACAGACTTCAATATCACAGAACATCG83DYS391_F1_TGTGTATCTATTCATTCAATCATACACCC14384DYS391_R1_SmCTCCCTGGTTGCAAGCAATTGCC85DYS438_F1_TCCAAAATTAGTGGGGAATAGTTGAAC14986DYS438_R2_SmGTCGAGATCACACCATTGCATTTC87DYS439_F1_TGCCTGGCTTGGAATTCTTTTACCC19588DYS439_R1_SmTTTAAGTCTTTAATCTATCTTGAATTAATAGATTC89DYS481_F1_TCTTTAAGAGGAGTCTGCTAAAAGGAATG14490DYS481_R3_SmTCACCAGAAGGTTGCAAGAC91DYS505_F1_TTCTGGCGAAGTAACCCAAAC17492DYS505_R1_SmTCGAGTCAGTTCACCAGAAGG93DYS522_F2_TGGAACCAGTGAGAGCCG30694DYS522_R2_SmCTCAGAGTGCTGAACCCAG95DYS533_F2_TGTATTTATTCATGATCAGTTCTTAACTCAACC20696DYS533_R2_SmCTACCTAATATTTATCTATATCATTCTAATTATGTCTCTTC97DYS549_F1_TCTCTAAAGGTTTTTTTGGTGGCATAAG22298DYS549_R1_SmGATTAATACAACAAAAATTTGGTAATCTGAAA99DYS570_F1_TCAACCTAAGCTGAAATGCAGATATTC170100DYS570_R1_SmGTTATGAAACGTAAAATGAATGATGACTAG101DYS576_F2_TGCAGTCTCATTTCCTGGAGATGAAGG191102DYS576_R1_SmCTTGGGCTGAGGAGTTCAATC103DYS612_F2_TGCCAGTAAGAATAAAATTACAGCATGAAG287104DYS612_R2_SmGAATAATCTACCAGCAACAATGGCT105DYS635_F4_TTGCCCAATGGAATGCTCTCT274106DYS635_R2_SmGCTCCATCTCAAACAACAAAAACACAAAAAATG107DYS643_F2_TGGGTCATTGAACCTCATGCTCTG170108DYS643_R1_SmCCCCCCAAAATTCTACTGAAGTAAA109Y_GATAH4_F2_TTAACAGGATAAATCACCTATCTATGTAT175110Y_GATAH4_R2_5mGCTGAGGAGAATTTCCAAATTTA
[0083] In some embodiments, the plurality of primers includes a primer including the nucleotide sequence of one or more SNP-targeted primers of of WO 2015 / 126766, incorporated below. Table 3-SNP targeted primer sequencesSEQ ID NO SNP PRIMER EXAMPLES OF SNP PRIMERS WITHOUT TAGS 111rs10092491_iSNPI_T_F2CCCGCAAACTAACTAGGATAAATCTCTA112rs1015250_iSNPI_T_FCGACATGGGAAATGTCAGATCATAAGAC113rs1024116_iSNPI_T_F2CCAGGGAGTGAAAAATCCTTTTATCATC114rs1028528_iSNPI_T_F2GAGGATGAAGGTTAGAGCCAGACCT115rs1029047_iSNPI_T_F2TGTGGAATAAACTGAAGGCTAAAGAAAA116rs1031825_iSNPI_T_F2CAAGCCCTATGCCAAGGATATAACAATG117rs10488710_iSNPI_T_FGAGGTTTTACTGTATTAGGAGTTCCCAC118rs10495407_iSNPI_T_FCAGATGTGAGATGATAATTTCGTTCTCC119rs1058083_iSNPI_T_FTTGTTCTTCTCCATCCCATTTCACCC120rs10773760_iSNPI_T_FCTTGTACATTCCCTTATCTGCTATGTGG121rs1294331_iSNPI_T_F2CTCTCTTTGGAGTTTTATGTGTTGCTAC122rs12997453_iSNPI_T_FCTCTGATGATGTGCAAGAAAGGTAGGTA123rs13182883_iSNPI_T_FTCAGACTATGTTTTAAGGAGACTATGAGG124rs13218440_iSNPI_T_FCTAAGTATCTACCAATGTGCTACGTACC125rs1335873_iSNPI_T_FCACGTGGATGATATGGTTTCTCAAGG126rs1336071_iSNPI_T_F2AGCACCTATATATTATACCTGAAAGCAT127rs1355366_iSNPI_T_FCCCATGATTTTCTTGTGGTGAGAATTTC128rs1357617_iSNPI_T_FCACCCTCTGTACTTTAATTTGACTTCCC129rs1382387_i5NPI_T_FGTTTTTCTTCATTCCCATGTTGTGTAC130rs1413212_iSNPI_T_FCACTCTTCTGAATCCTGGTCAACAAC131rs1454361_iSNPI_T_FCAAGTTATATCATAGAGTCTACGACCCC132rs1463729_iSNPI_T_FCTGCAACTATCAGTCTCTGCCCTTATTC133rs1493232_iSNPI_T_FGATGTGTCTCAAACTGTTTATTGTGAGG134rs1498553_iSNPI_T_FGAACTCATTTATCCAGAGACCTGTTCTC135rs1523537_iSNPI_T_FCATAATACAACCTGTCTTTGGAGTTACT136rs1528460_iSNPI_T_FGTGACCAGTAGTTCTATGAGCAAGTATG137rs159606_iSNPI_T_FCCACATTGTATGGTTTTTAGGCACCATG138rs1736442_iSNPI_T_FCTAATAAGTGGGACAGTTAAGAGAAGGC139rs1821380_iSNPI_T_FCAAGACAAGCGATTGAAAGAAGTGGAT140rs1886s10_iSNPI_T_FCCTTGTCAATCTTTCTACCAGAGGGTAA141rs1979255_iSNPI_T_FGAATCATAGCTTGTGTTGGTCAGGG142rs2016276_iSNPI_T_FGAATTACAAGTATTTGCATCCCAGCCT143rs2040411_iSNPI_T_FGACCAACTTGGCTTTAACAGATGCAAAT144rs2046361_iSNPI_T_F2TCCTTACCTTTAAGACTTTTCCTATTTG145rs2056277_iSNPI_T_F2CATTATCTCGTCATACTTCCCTGTCTTG146rs2076848_iSNPI_T_FGCATCAAATTCACCAGTGAAATTATTGA147rs2107612_iSNPl_T_FATGAGTACATTATTCAACTGTTTTGGAG148rs2111980_iSNPI_T_FCAGCCATGTTGTAAACATTTTFACGGTC149rs214955_iSNPI_T_FGCACATTCTAAGAACTGGTGATTCTATC150rs221956_iSNPI_T_FGCTAGAAAAAGCTGAGATAGCTGTGAAG151rs2342747_iSNPI_T_FCCTTGAAGCTCATTCTTTGTTGTCCC152rs2399332_iSNPI_T_FCTGGACACCAGACCAAAAACAAATAACC153rs251934_iSNPI_T_FGTAATTAGAGGGCAGTGAGGCTTTTAA154rs279844_iSNPI_T_FCTCCAGAAGCTACTGGGATATTAATTAG155rs2830795_iSNPI_T_FTGAGCCAAATCAGCAATATAATAGGACT156rs2831700_iSNPI_T_FCCTAGAACCACAATTATCTGTCTTTGGC157rs2920816_iSNPI_T_F2CCATTGATTCTCTACAGTTCTGCAGGTA158rs321198_iSNPI_T_FCTCCACACTTTATACAGGTGAAATCTGA159rs338882_iSNPI_T_FCATTTTTCTCTCCTTCTGTCTCACCTTC160rs354439_iSNPI_T_FGCTTCTCTTTCCCTTATGTATCTCTCTC161rs3780962_iSNPI_T_FGGCTTTTGAAGAAAAACACTAACCTGTC162rs430046_i5NPI_T_FCACCTATGGGCTCTTCTTATTTCTCC163rs4364205_iSNPI_T_FCATTTGATAGCCATTTGGGTTGTTTCCA164rs445251_iSNPI_T_FCCATCACACTATCCTGACATGAACAAAT165rs4606077_iSNPI_T_FGAAGATTTGCATCCCAGTGAAAGCAC166rs560681_iSNPI_T_FGCACTTCATAAAGAATCAGTCAGGATGC167rs6444724_iSNPI_T_FGGAGAATCAGGAAATAGTCACTTCCTAC168rs6811238_iSNPI_T_FCATTTGACCTTCTAGCCAAATGAAGTAC169rs7041158_iSNPI_T_FGGAATTTCTGAGAATAACATTGCCTCTC170rs717302_iSNPI_T_FCATATGTTGGGGGAGCTAAACCTAATGA171rs719366_iSNPI_T_FCACTGTGACCACAGCATCTTTTAACTC172rs722098_iSNPI_T_F2GGGTAAAGAAATATTCAGCACATCCAAA173rs722290_iSNPI_T_FGAGTATCCCTTATCTAAAATGCTGGTCC174rs727811_iSNPI_T_FCTTTTTCTCTTACCGGAACTTCAACGAC175rs729172_iSNPI_T_FCCTCATTAATATGACCAAGGCTCCTCTG176rs733164_iSNPI_T_FTGACTCTAATTGGGGATGTGGTAATTAG177rs735155_iSNPI_T_FGACCTAACCTGGAGAAAACCGGAGA178rs740598_iSNPI_T_FGTTTCTCTTCTCTGAACCTTTGTCTCAG179rs740910_i5NPI_T_FGCAAACACACAAAGATAGGTTCGAGTTT180rs763869_iSNPI_T_FCATATCAAGTGCTTTCTGTTGACATTTG181rs8037429_iSNPI_T_FCTGAAAAGTGCTACGTAAGAGGTCATTG182rs8078417_iSNPI_T_FCATCTGAGTGTGAGAAGAGCCTCAA183rs826472_iSNPI_T_F2CCCAGCAAAAACTTCTTTTCTCCAGTAA184rs873196_iSNPI_T_FGCTAGGAAAGTTTTCTGGTTCACA185rs876724_iSNPI_T_FGAATATCTATGAGCAGGCAGTTAGCAG186rs891700_iSNPI_T_F2CTAATCAGTGTCACTATGTGTGAGCTAT187rs901398_iSNPI_T_FCATCATACAGACTCAAGGAGCTTAGCTG188rs907100_iSNPI_T_FCTTTCCAAGCCTTGGAAAACACAGAAAA189rs914165_ISNPI_T_FGTACCTTATAAATCACGGAGTGCAGAC190rs917118_iSNPl_T_FCAAGTGGTAAGAGATGACTGAGGTCAA191rs938283_iSNPI_T_FCTTCTTCTCTTAGAAGGACACTGGTCAG192rs964681_iSNPl_T_FGTTATGGAGGATTGGTAAGAACCAGAG193rs987640_iSNPI_T_FGAGCTGTTTAAGGGTAAAGGGGTAGTTA194rs9905977_iSNPI_T_FGCAGACAAAACCATGACAATGATCTTAG195rs993934_iSNPI_T_FCCCATGATGAAACAGTTTGCACTAAATG196rs9951171_iSNPI_T_FCTCAATTTTCTTGTCCCTGCTTTCATG197rs10092491_iSNPI_S_R2TTAGAAATTCCAGATAGAGCTAAAACTG198rs1015250_iSNPI_S_RGTTAGGAAAAGAACCCAGGTGTTTT199rs1024116_iSNPI_S_R2GCAAAAGTAAATACAAAGGCATACTTT200rs1028s28_iSNPI_S_R2CAATGCAAAAGAAAGGTCCTTACTCGAC201rs1029047_iSNPI_S_R2CATTTCTAAACTCTAAAACAAACATTTG202rs1031825_iSNPI_S_R2GGTCCTTAACCTATTAAATTTTAATGAG203rs10488710_iSNPI_S_RGACTTTCAATTTATGTCAGCATTTAAAA204rs10495407_iSNPI_S_RCCTCTTGGTTGCATTGGATTCTCATTG205rs1058083_iSNPI_S_RTCTCCATGAAACTTGGGTTAATTTTGC206rs10773760_iSNPIS_RTGTCTGGAAGTTCGTCAAATTGCAG207rs1294331_iSNPI_S_R2GTAGCATAAAACATTCCAAAAATTCAAT208rs12997453_iSNPI_S_RTGCTTTAAAGATACAGGTTATCTGTATTAC209rs13182883_iSNPI_S_RCTCTCCGTTACTTTCTTCCTGCCTTT210rs13218440_ISNPI_S_RGATCCTGAGATTCACCTCTAGTCCCT211rs1335873_iSNPI_S_RCCGTACCAGGTACCTAGCTATGTACT212rs1336071_iSNPI_S_R2CTTTCTGTTTTGTCCATCTGAAATTCT213rs1355366_iSNPI_S_RCAAAGTTAAGTATCACCATCCAGCTGG214rs1357617_iSNPI_S_RATAGGGATAGCTGATAAGAAACATGACC215rs1382387_iSNPI_S_RCTTAATAAGACGCTGCATCTGCCCA216rs1413212_iSNPI_S_RTCCAGGAGACATTTGTTCATATAAGTGA217rs1454361_iSNPI_S_RAGACACTTTTCAGTATCCATTTAGAAAC218rs1463729_isNPI_S_RGTTTCACATGTGCATGCTTTTGGGT219rs1493232_iSNPI_S_RCCAAAGCTATTCTCTCTTTTGGGTGC220rs1498553_iSNPI_S_RGAAAGTTCACTTCAGATGTTCAAAGCC221rs1523537_iSNPI_S_RGGGTTTCAGTCTGCAACAAGATCTTG222rs1528460_iSNPI_S_RTGGAGATCAATATTTAGCCTTAACATAT223rs159606_iSNPI_S_RGACTGTTTCTCATCCTGTTATTATTTGT224rs1736442_iSNPI_S_RAACACACAGAAACATCAAGCTGAGC225rs1821380_iSNPI_S_RTTCCTGACATTCTCCTTCTTCTATCTG226rs1886510_iSNPI_S_RTATGACGCCTGGATTTTCACAACAAC227rs1979255_iSNPI_S_RCAGAGACTATGGATGGTATTTAGGTCAA228rs2016276_i5NPI_S_RACTTTGTGTGGCTGAGAGAGAGAAA229rs2040411_iSNPI_S_RTGAGTGTTCTCTGTATTTTCTTACTCTAAG230rs2046361_iSNPI_S_R2ATTTTTGGTCATTGTTGACACTTCACC231rs2056277_iSNPI_S_R2GGTGTTAGGGAGACAGGCATGAATG232rs2076848_iSNPI_S_RTGAAACTTTTCAACTCTCCTACCGCC233rs2107612_iSNPI_S_RGTTAAAATTGCCACTAATTATGTGTTTT234rs2111980_iSNPI_S_RAACTGATCCTATGCAGCAAGATCTTTG235rs214955_iSNPI_S_RGATGCTTGCAAACAAAGACTGAAAAGG236rs221956_iSNPI_S_RGTCTGTGTGTCCTCTGAGATGATGAATG237rs2342747_iSNPI_S_RGGGAGGAAGAAAACAGAGAGTCTTGA238rs2399332_iSNPI_S_RAGTTTGTTGGCTTCTTTTGAGAAGTATC239rs251934_iSNPI_S_RGGCAGATGAAGTAGTAGATATCTGGCTG240rs279844_iSNPI_S_RGTTCAGTGTCAATTTTGACCAGATATT241rs2830795_iSNPI_S_RAGACATAGGACACACCATTTTATTGTCT242rs2831700_iSNPI_S_RTCAAAATATTTGGCTAAACTATTGCCGG243rs2920816_iSNPI_S_R2CTGGAGTTATTAATAAATTGGATTATATAGC244rs321198_iSNPI_S_RTTACCTGTTTTCCTTTTGTGATTCCAC245rs338882_i5NPI_S_RACCAAGTCAAGAGCTCTGAGAGACAT246rs354439_iSNPI_S_RACAGTGAATGATATTCAGAATATTGTGC247rs3780962_iSNPI_S_RGAACAAGGTCAAGATATCAGCTTTCACC248rs430046_iSNPI_S_RAGGTCATACAATGAATGGTGTGATGT249rs4364205_iSNPI_S_RATCCACCCATGAGAAATATATCCACAA250rs445251_iSNPI_S_RACAATTCAAATTAATGTAAAAACTGCAAGTG251rs4606077_iSNPI_S_RTAGTTCTAGTGTGGGATCTGACTCC252rs560681_iSNPI_S_RGAACATCTGTTCAGGTTTCTCTCCATC253rs6444724_iSNPI_S_RGAAAGGACTAAATTGTTGAACACTGGT254rs6811238_iSNPI_S_RTGTGTGTTTTAAAGCCAGGTTTGTT255rs7041158_iSNPI_S_RGATGGACTGGAACTGAGGATTTTCA256rs717302_iSNPI_S_RAGCTTTAGAAAGGCATATCGTATTAACTG257rs719366_iSNPI_S_RTTATAGTGAGTAAAGGACAGGCCCC258rs722098_iSNPI_S_R2ACACATCTGTTGACAGTAATGAAATATCC259rs722290_iSNPI_S_RGTTTAAACTTGGATACCATCCCCAAGAC260rs727811_iSNPI_S_RATGAGATTGCTGGGAGATGCAGATG261rs729172_iSNPI_S_RCACATTTCCCTCTTGCGGTTACATAC262rs733164_ISNPI_S_RGACAAGCCTCGCTTGAGTTTTCTTT263rs735155_iSNPI_S_RTGTGAGAGTGTCACCGAATTCAACG264rs740598_iSNPI_S_RAAATAGCAATGGCTCGTCTATGGTTAG265rs740910_iSNPI_S_RTGCTAAGTAAGGTGAGTGGTATAATCA266rs763869_i5NPI_S_RATAAATATGATGTGGCTACTCCCTCAT267rs8037429_iSNPI_S_RGCTACACCTCCATAGTAATAATGTAAGAG268rs8078417_iSNPI_S_RTGAAGCAGCTAGAGAACTCTGTACGT269rs826472_iSNPI_S_R2TTTTGTCTCTGTTATATTAGTCACCTATCTC270rs873196_iSNPI_S_RATAGCCCTGCATTCAAATCCCAAGTG271rs876724_iSNPI_S_RTCCATTTTTATACCACTGCACTGAAG272rs891700_iSNPI_S_R2GCAGTAAAACATTTTCATCAAATTTCCA273rs901398_iSNPI_S_RTCTGGGTGCAAACTAGCTGAATATCAG274rs907100_iSNPI_S_RGAAAATCTGGAGGCAATTCATGATGCC275rs914165_iSNPI_S_RATACAATGATGATCACACGGGACCCT276rs917118_iSNPI_S_RCCATGAAGATGGAGTCAACATTTTACA277rs938283_iSNPI_S_RTCCTAACCCCTAGTACGTTAGATGTG278rs964681_iSNPI_S_RGAGGTGATTTCTGTGAGGAACGTCG279rs987640_iSNPI_S_RGTACATTCACTTAACAGGCTCTCTTTCC280rs9905977_iSNPI_S_RAATTCATGAG CΓGGTGTCCAAGGAG281rs993934_iSNPI_S_RATAACAGTCTCCAGAGTATATTAGCTTAG282rs99s1171_iSNPI_S_RGTTCCTCTGGGATGCAACATGAGAG283rs10497191_aSNPI_T_FGAAAGGATGAAGAGGGTGGATATTGGAG284rs1079597_aSNPI_T_FCCAAACCTCATCATCTCTTACCTGGATT285rs11652805_aSNPI_T_FGTCCAAAGTCAAGTGCAAGTATAGTTGG286rs1229984_aSNPI_T_FACAATCTTTTCTGAATCTGAACAGCTTC287rs12439433_aSNPI_T_FCAAAGGAAGGCATTTCCTAATGATCTTC288rs12498138_aSNPI_T_FCTTTGCTTTG CTTTTCTTCTTCAGGGAA289rs12913832_pSNPI_NU_T_FCTGCTTCAAGTGTATATAAACTCACAGT290rs1426654_aSNPI_T_FCCTAGGAAAGCAGTAACTAATTCAGGAG291rs1462906_aSNPI_T_FGCAATTTGTTCACTTTTAGTTTCGTAGC292rs1572018_aSNPI_T_FGGCCTAATATGCATGTGTTCATGTCTCT293rs16891982_aSNPI_T_FCAGAGTTTCTCATCTACGAAAGAGGAGT294rs174s70_aSNPI_T_FATCCTAGACCTCCAGGTGGAATGATC295rs17642714_aSNPI_T_FCTTGGCTGTCTCAATATTTTGGAGTAAG296rs1800414_aSNPI_T_FGAGTAAATGAGCTGTGGTTTCTCTCTTA297rs1834619_aSNPI_T_FCTTTCCATGTGGACCCTTTAACATTCAG298rs1876482_aSNPI_T_FGCATAGTGAGCFGTTGATAGAGCTTTFG299rs1919550_aSNPI_T_FCTAGAACAAAATCATTGGCTCTCCTAGT300rs192655_aSNPI_T_FGTCTGGTGAGTACTGGCTGAATGTAAA301rs200354_aSNPI_T_FCCAGAGGATGCTGCTAAACATTCTACAA302rs2024566_aSNPI_T_FG CTCATGCCTGGAATTCACCTTTATTTT303rs2042762_aSNPI_T_FCTAACTAGACATTTGGGCCACCTTACTT304rs2166624_aSNPI_T_FGTCTATGGTGCCTATAGAATGTACAGGT305rs2196051_aSNPI_T_FCCCTCTCAAGTTTGTGAGCAAATATCAC306rs2238151_aSNPI_T_FCTCTATCTTGCTGCAATGGACTTTCC307rs260690_aSNPI_T_FCCTAGAAACAGATTTTGAAGGGCTCTTG308rs2814778_aSNPI_T_FAAATGAGGGGCATAGGGATAAGGGA309rs310644_aSNPI_T_FCCTAGAAATCTGATACGTTATCCTATGA310rs3737576_aSNPI_T_FAGGAGAGATATATTCAACATGAACCCAA311rs3811801_aSNPI_T_FGAACATCTCTGACCAGAAATTTCCAGTA312rs3823159_aSNI_T_FGTGTAGTGAAATCCTTAGACTTAGGTAA313rs3916235_aSNPI_T_FAATACATGAAAAAGTAATACATGGGGCA314rs4471745_aSNPI_T_FATTAAATGTTTACTTCTATCTACAAGGA315rs4833103_aSNPI_T_FCATTTTGTGAAATGCAAAGGGCAAATCT316rs4891825_aSNPI NU_T_FGCTGAGAGGCTTAATTCCATCAAGATGA317rs4918664_aSNPI NU_T_FCCCATCCTAAACTTAGTTTTATGGGCAG318rs6754311_aSNPI_T_FGTAACACATTCTCTTTGGGAAGCTAGC319rs6990312_aSNPI_NU_T_FCTTAGCTTCAGTGAAAATGGTTCCTCTC320rs7226659_aSNPI_NU_T_FCTTTCTTAGCTCCTCTCCATTTCTCTTC321rs7326934_aSNPI_NU_T_FGTCTATGCAGTGCTTCACTGAGGATTAT322rs735480_aSNPI_NU_T_FCTCTATCTGCTCAGAGCCTGCTTAAAAG323rs7554936_aSNPI_NU_T_FGGAAAGGATACAGTGTTGAGCAAGATAG324rs7657799_aSNPI_NU_T_FGCCAACTTGATTCTCTTTCAAATGCTTG325rs7722456_aSNPI_T_FAGATGGGGTTTACCATGTTTCCCAG326rs798443_aSNPI_T_FGTACAGTAGTTAGTTTCCAGACTGATGA327rs7997709_aSNPI_T_FGTAAATATCTAACTGTGTTTCCCTCAGT328rs870347_aSNPI_T_FGAACCAAAAGGAATTAAGAGACTAGGGG329rs917115_aSNPI_T_FCTGCTTTTACGGCTTCTTCCTTTCTTC330rs10497191_aSNPI_S_RCCCACATCCTTCCCATTTATAGGCAA331rs1079597_aSNPI_S_RTACATGATCCTAAGGGCAGCAGGAA332rs116s280s_aSNPI_S_RGTTTGGTGCATCCTCTTTCTCTCTC333rs1229984_aSNPI_S_RGACTGTAGTCACCCCTTCTCCAACA334rs12439433_aSNPI_S_RAGAGTGAAATACATAGAAAAGAAACTTAAAG335rs12498138_aSNPI_S_RATTTGCGAGAAACAGATAAATATTGAAG336rs12913832_pSNPI_NU_S_RACAGGAACAAAGAATTTGTTCTTCATGG337rs1426654_aSNPI_S_RCCTTGGATTGTCTCAGGATGTTGCA338rs1462906_aSNPI_S_RCTGGGATGTTTGTTTTGG CTTTGTG339rs1572018_aSNPI_S_RATTGGTAGTACACTAATGGATATATGTGAG340rs16891982_aSNPI_S_RGAATAAAGTGAGGAAAACACGGAGTTG341rs174s70_aSNPI_S_RGAGAGAGGCAGAAAGGAGGGATGAA342rs17642714_aSNPI_S_RTACTCTGTCTTCAGTAGCTGTTTCTTGG343rs1800414_aSNPI_S_RTTAGACTCACCAAGATCAAGATGAATGC344rs1834619_aSNPI_S_RATCTCAATAAAGCTGTTCAAAACAGAAAG345rs1876482_aSNPI_S_RTAAAGAAAATGCCATGGGCTGTACCC346rs1919550_aSNPI_S_RATTGTGCAGCAGAACAGAGTGTAGTG347rs192655_aSNPI_S_RATTCTTTGCATAGCTCACGAAATTTCCC348rs200354_aSNPI_S_RAAAATGAGACCTCGTATCTTTGCAGC349rs2024s66_aSNPI_S_RAAATGCAGAACTGCCAAAAGAAACCC350rs2042762_aSNPI_S_RGAGAATCTGTGAATGCCAGGGTCTG351rs2166624_aSNPI_S_RATGGATTCATGTTTCAGACATCTAATT352rs21960s1_aSNPI_S_RATCACTAGAAAGAAAAGAGTTCCTATTC353rs2238151_aSNPI_S_RGAAGTTTAAAAGAGTGGGAACATGGGG354rs260690_aSNPI_S_RCTACGTAAGCAAAAATGATCACGCAC355rs2814778_aSNPI_S_RAACCTGATGGCCCTCATTAGTCCTT356rs310644_aSNPI_S_RCACCAGATTTCTAGGAATAGCATGTGAG357rs3737576_aSNPI_S_RAAGAGCATAGTGAGGGGTTAGACCT358rs3811801_aSNPI_S_RCTTTATATTTAGTGTAGAGATCAGTCTCC359rs3823159_aSNPI_S_RTGAGTCCTTTACCTAATCTTGGTTGTC360rs3916235_aSNPI_S_RAATCCAAAGCAACTCTCTTTTCACCAC361rs4471745_aSNPI_S_RTTTACFGGAACCCFGATTTTGTFGGA362rs4833103_aSNPI_S_RTGCCACTGATATATCAGTACCTGAGT363rs4891825_aSNPI_NU_S_RACAATCTCAATCCCCCTTAATGTTTTC364rs4918664_aSNPI_NU_S_RGTGGGCAGAGAGAGTAAGAGAACCT365rs6754311_aSNPI S_RCAAACCAGATTCTGGCAGAATAGTTAGC366rs6990312_aSNPI_NU_S_RCTTCTCTCCCATCCTCCTTCTCCAC367rs7226659_aSNPI_NU_S_RAGATCAAGGGATCTGTGGGACAATAAC368rs7326934_aSNPI_NU_S_RGGGGAGTGATTTCAAGCATCCTGATT369rs735480_aSNPI_NU_S_RCATGAGTTTGAGGTAAGATGAAGGAGA370rs7554936_aSNPI_NU_S_RTCTCTCTCATCCTAGTGAATGCCATC371rs7657799_aSNPI_NU_S_RGGGTGATGATCTACCTTGCAGGTATA372rs7722456_aSNPI_S_RCTCAAGGCCCTGGGTCTGAAATTAC373rs798443_aSNPI_S_RACATCTCCAGTTAATAATTTCCACTAAC374rs7997709_aSNPI_S_RTGGATTGCTCAACAAATAGTGCTAAAA375rs870347_aSNPI_S_RCATGCGACATCCAGGTAGCTAAAATAC376rs917115_aSNPI_S_RATGGATAAAAATGGAACTTTCAAGAGAA377rs12203592_pSNPI_T_FGTTTTATGTAAAGCTTCGTCATATGGCT378rs12821256_pSNPI_T_FGTTCCAACTTAGTCATAAAGTTCCCTGG379rs12896399_pSNPI_T_FGGGTCTTGATGTTGTATTGATGAGGAAG380rs1393350_pSNPI_T_FCCTAACAGAAAGTCACTGTTTGTATCTG381rs1800407_pSNPI_T_FTCACTCTGGCTTGTACTCTCTCTGTG382rs2378249_pSNPI_T_FGGCTGGTTTCAGTCTGGAGACTTTATTT383rs2402130_pSNPI_T_FCTTCACCTCGATGACGATGATGATGAT384rs4959270_pSNPI_T_FGACAATAACAGCACAAAGGATGGAAAAG385rs1805009_pSNPI_T_FGAACCAGACCACACAATATCACCAC386rs28777_pSNPI_T_FTCTACCTCTTTGATGTCCCCTTCGATAG387rs16891982_pSNPI_T_FCAGAGTTTCTCATCTACGAAAGAGGAGT388rs683_pSNPI_T_FCCCAGCTTTGAAAAGTATGCCTAGAACT389rs12913832_pSNPI_T_FCTGCTTCAAGTGTATATAAACTCACAGT390rs12203592_pSNPI_S_RTTGTTTCATCCACTTTGGTGGGTAAAAG391rs12821256_pSNPI_S_RTAATTAAGC -< FC -< FGTGTT -< FAGGGTTTTT392rs12896399_pSNPI_S_RCAATTCTTTGTTCTTTAGGTCAGTATAT393rs1393350_pSNPI_S_RTACTCTTCCTCAGTCCCTTCTCTGC394rs1800407_pSNPI_S_RTGAGACAGAGCATGATGATCATGGC395rs2378249_pSNPI_S_RGCACAAGTCTAGGAACTACTTTGCAC396rs2402130_pSNPI_S_RGAAGTATTTGAACCATACGGAGCCC397rs4959270_pSNPI_S_RTGAGGAACACATCCAAACTATGACAC398rs1805009_pSNPI_S_RTTTCTCGCCCTCATCATCTGCAATG399rs28777_pSNPI_S_RTCAGTTGATTTCATGTGATCCTCACAG400rs16891982_pSNPI_S_RGAATAAAGTGAGGAAAACACGGAGTTG401rs683_pSNPI_S_RATTACCTTCTTTCTAATACAAGCATATG402rs12913832_pSNPI_S_RACAGGAACAAAGAATTTGTTCTTCATGG
[0084] In some embodiments, the plurality of primers includes one or more primers including the nucleotide sequence of one or more identity informative SNPs and STRs of WO 2015 / 126766, which is incorporated below. Table 4-Identity informative SNPs and STRsIdentity informative SNPsrs1005533rs1357617rs2076848rs4530059rs763869rs10092491rs1360288rs2107612rs4606077rs8037429rs1015250rs1382387rs2111980rs560681rs8078417rs1024116rs1413212rs214955rs576261rs826472rs1028528rs1454361rs221956rs6444724rs873196rs1029047rs1463729rs2269355rs6811238rs876724rs1031825rs1490413rs2342747rs6955448rs891700rs10488710rs1493232rs2399332rs7041158rs901398rs10495407rs1498553rs251934rs717302rs907100rs1058083rs1523537rs279844rs719366rs914165rs10773760rs1528460rs2830795rs722098rs917118rs10776839rs159606rs2831700rs722290rs938283rs1109037rs1736442rs2920816rs727811rs964681rs1294331rs1821380rs321198rs729172rs987640rs12997453rs1886510rs338882rs733164rs9905977rs13182883rs1979255rs354439rs735155rs993934rs13218440rs2016276rs3780962rs737681rs9951171rs1335873rs2040411rs430046rs740598rs1336071rs2046361rs4364205rs740910rs1355366rs2056277rs445251rs7520386 Autosomal STRs
[0085] D1S1656CSF1POvWAD21S11D4S2408D2S441D7S820D13S317TPOXD17S1301D2S1338D8S1179Penta ESE33D9S1122D3S1358D10S1248D16S539Penta DD6S1043FGATH01D18S51D22S1045AmelogeninD5S818D12S391D19S433D20S482X STRsDXS8378DXS8377DXS10101DXS10148DXS10146DXS7132DXS10135DXS10134DXS10079HPRTBDXS10074DXS7423DXS10103Y STRsDYS456DYS393DYS437DYS533DYS449DYS389I / IIDYS391DYS438DYS518DYS522DYS390DYS439DYS448DYS570DYS505DYS458DYS635DYS576DYS643DYS627DYS19DYS392DYS481DYS460DYF387S1a / bDYS385a / bYGATAH4DYS549DYS612
[0086] In some embodiments, the plurality of primers includes one or more primers including the nucleotide sequence of one or more additional STRs and SNPs for multiplexing as listed in WO 2015 / 126766, which is incorporated below. Table 5-Examples of additional STRs and SNPs for mulitplexingIdentity informative SNPsrs1004357rs1554472rs2567608rs521861rs9606186rs1019029rs1872575rs2811231rs5746846rs985492rs1027895rs2073383rs2833736rs590162rs9866013rs10500617rs2175957rs315791rs6591147rs10768550rs2255301rs3744163rs689512rs12480506rs2270529rs4288409rs7205345rs13134862rs2272998rs464663rs7229946rs1358856rs2291395rs4789798rs7704770rs1410059rs2292972rs4796362rs8070085rs1478829rs2503107rs4847034rs9546538Autosomal STRsD1S1677D3S4529D18S853D10S1435D1154463D6S1017D14S1434D5S2500D1S1627D1GATA113D2S1776
[0087] In some embodiments, the plurality of primers includes one or more primers including the nucleotide sequence of STRs and SNPs listed in WO 2015 / 126766, which is incorporated below. Table 6- STRs and SNPs for databanking and case workIdentity informative SNPsrs1005533rs1357617rs2076848rs4530059rs763869rs10092491rs1360288rs2107612rs4606077rs8037429rs1015250rs1382387rs2111980rs560681rs8078417rs1024116rs1413212rs214955rs576261rs826472rs1028528rs1454361rs221956rs6444724rs873196rs1029047rs1463729rs2269355rs6811238rs876724rs1031825rs1490413rs2342747rs6955448rs891700rs10488710rs1493232rs2399332rs7041158rs901398rs10495407rs1498553rs251934rs717302rs907100rs1058083rs1523537rs279844rs719366rs914165rs10773760rs1528460rs2830795rs722098rs917118rs10776839rs159606rs2831700rs722290rs938283rs1109037rs1736442rs2920816rs727811rs964681rs1294331rs1821380rs321198rs729172rs987640rs12997453rs1886510rs338882rs733164rs9905977rs13182883rs1979255rs354439rs735155rs993934rs13218440rs2016276rs3780962rs737681rs9951171rs1335873rs2040411rs430046rs740598rs1336071rs2046361rs4364205rs740910rs1355366rs2056277rs445251rs7520386Autosomal STRsD1S1656CSF1POvWAD21S11D4S2408D2S441D7S820D13S317TPOXD17S1301D2S1338D8S1179Penta ESE33D9S1122D3S1358D10S1248D16S539Penta DD6S1043FGATHO1D18S51D22S1045AmelogeninD5S818D12S391D19S433D20S482X STRsDXS8378DXS8377DXS10101DXS10148DXS10146DXS7132DXS10135DXS10134DXS10079HPRTBDXS10074DXS7423DXS10103Y STRsDYS456DYS393DYS437DYS533DYS449DYS3891 / 11DYS391DYS438DYS518DYS522DYS390DYS439DYS448DYS570DYS505DYS458DYS635DYS576DYS643DYS627DYS19DYS392DYS481DYS460DYF387S1a / bDYS385a / bYGATAH4DYS549DYS612Phenotypic informative SNPsN29insArs1805006rs1110400rs12203592rs2378249rs11547464rs1805007rs28777rs1042602rs12896399rs885479rs1805009rs16891982rs1800407rs1393350rs1805008Y1520CHrs12821256rs2402130rs683rs1805005rs2228479rs4959270rs12913832Ancestry informative SNPsrs10497191rs17642714rs2238151rs4471745rs7554936rs1079597rs1800414rs2593595rs459920rs7657799rs11652805rs1834619rs260690rs4833103rs7722456rs1229984rs1871534rs2814778rs4891825rs798443rs12439433rs1876482rs310644rs4918664rs7997709rs12498138rs1919550rs3737576rs671rs870347rs12913832rs192655rs3811801rs6754311rs917115rs1426654rs200354rs3814134rs6990312rs9522149rs1462906rs2024566rs3823159rs7226659rs1572018rs2042762rs3827760rs7251928rs16891982rs2166624rs3916235rs7326934rs174570rs2196051rs4411548rs735480
[0088] In some embodiments, the plurality of primers which may be subject to incorporation of a QCS and further ES sequences includes one or more primers including the nucleotide sequence of an Identity Informative SNP of ILLUMINA's FORENSEQ DNA Signature Prep kit. Identity informative SNP could be one or more of the group comprising rs10495407, rs1294331, rs1413212, rs1490413, rs560681, rs891700, rs1109037, rs12997453, rs876724, rs907100, rs993934, rs1355366, rs1357617, rs2399332, rs4364205, rs6444724, rs1979255, rs2046361, rs279844, rs6811238, rs13182883, rs159606, rs251934, rs338882, rs717302, rs13218440, rs1336071, rs214955, rs727811, rs321198, rs6955448, rs737681, rs917118, rs10092491, rs2056277, rs4606077, rs763869, rs1015250, rs10776839, rs1360288, rs1463729, rs7041158, rs3780962, rs735155, rs740598, rs826472, rs964681, rs10488710, rs1498553, rs2076848, rs901398, rs10773760, rs2107612, rs2111980, rs2269355, rs2920816, rs1058083, rs1335873, rs1886510, rs354439, rs1454361, rs4530059, rs722290, rs873196, rs1528460, rs1821380, rs8037429, rs1382387, rs2342747, rs430046, rs729172, rs740910, rs8078417, rs938283, rs9905977, rs1024116, rs1493232, rs1736442, 9951171, rs576261, rs719366, rs1005533, rs1031825, rs1523537, rs445251, rs221956, rs2830795, rs2831700, rs722098, rs914165, rs1028528, rs2040411, rs733164, rs987640.
[0089] In some embodiments, the plurality of primers which may be subject to incorporation of a QCS and further ES sequences includes one or more primers including the nucleotide sequence of an autosomal STR or ITR of ILLUMINA's FORENSEQ DNA Signature Prep kit. Autosomal STRs could be one or more of the group comprising D1S1656, TPOX, D2S441, D2S1338, D3S1358, D4S2408, FGA, D5S818, CSF1PO, D6S1043, D7S820, D8S1179, D9S1122, D10S1248, TH01, vWA, D12S391, D13S317, Penta D, Penta E, D16S539, D17S1301, D18S51, D19S433, D20S482, D21S11, D221045.
[0090] In some embodiments, the plurality of primers which may be subject to incorporation of a QCS and further ES sequences includes one or more primers including the nucleotide sequence of a Y Haplotype Marker of ILLUMINA's FORENSEQ DNA Signature Prep kit. Y haplotype markers could be one or more of the group comprising DYF387S1, DYS19, DYS385a-b, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS437, DYS438, DYS439, DYS448, DYS460, DYS481, DYS505, DYS522, DYS533, DYS549, DYS570, DYS576, DYS612, DYS635, DYS643, Y-GATA-H4.
[0091] In some embodiments, the plurality of primers which may be subject to incorporation of a QCS and further ES sequences includes one or more primers including the nucleotide sequence of an X Haplotype Marker of ILLUMINA's FORENSEQ DNA Signature Prep kit. X haplotype markers could be one or more of the group comprising DXS10074, DXS10103, DXS10135, DXS7132, DXS7423, DXS8378, HPRTB.
[0092] In some embodiments, the plurality of primers which may be subject to incorporation of a QCS and further ES sequences includes one or more primers including the nucleotide sequence of a Phenotype Informative SNP of ILLUMINA's FORENSEQ DNA Signature Prep kit. Phenotypic informative SNPs could be one or more of the group comprising rs28777, rs12203592, rs4959270, rs683, rs1042602, rs1393350, rs12821256, rs12896399, rs2402130, rs1800407, N29insA, rs1110400, rs11547464, rs1805005, rs1805006, rs1805007, rs1805008, rs1805009, rs201326893_Y152OCH, rs2228479, rs885479, rs2378249, rs2814778, rs3737576, rs7554936, rs10497191, rs1834619, rs1876482, rs260690, rs3827760, rs6754311, rs798443, rs12498138, rs1919550, rs1229984, rs3811801, rs4833103, rs7722456, rs870347, rs16891982, rs192655, rs3823159, rs917115, rs1462906, rs1871534, rs2196051, rs6990312, rs3814134, rs4918664, rs1079597, rs174570, rs2238151, rs671, rs1572018, rs2166624, rs7326934, rs7997709, rs9522149, rs200354, rs12439433, rs1426654, rs1800414, rs735480, rs12913832, rs459920, rs11652805, rs17642714, rs2593595, rs4411548, rs4471745, rs2042762, rs3916235, rs4891825, rs7226659, rs7251928, rs310644, rs2024566.
[0093] In some embodiments, the plurality of primers which may be subject to incorporation of a QCS and further ES sequences includes one or more primers including the nucleotide sequence of an Ancestry Informative SNP of ILLUMINA's FORENSEQ DNA Signature Prep kit.
[0094] Ancestry information SNPs could be one or more of the group comprising rs2814778, rs3737576, rs7554936, rs10497191, rs1834619, rs1876482, rs260690, rs3827760, rs6754311, rs798443, rs12498138, rs1919550, rs1229984, rs3811801, rs4833103, rs7657799, rs7722456, rs870347, rs16891982, rs192655, rs3823159, rs917115, rs1462906, rs1871534, rs2196051, rs6990312, rs3814134, rs4918664, rs1079597, rs174570, rs2238151, rs671, rs1572018, rs2166624, rs7326934, rs7997709, rs9522149, rs200354, rs12439433, rs1426654, rs1800414, rs735480, rs12913832, rs459920, rs11652805, rs17642714, rs2593595, rs4411548, rs4471745, rs2042762, rs3916235, rs4891825, rs7226659, rs7251928, rs310644, rs2024566.Correction of amplification bias
[0095] In some embodiments, each pair of a plurality of primer pairs directed toward a particular target includes one of the forward or reverse primers or both including a QCS selected from the group consisting of QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, and QCS8, and the other primer, either forward or reverse, including a QCS selected from the group consisting of QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, and QCS8. In other embodiments, for a primer pair of a plurality of primer pairs, the forward primer could have no QCS while the reverse primer could include one of eight QCS or the reverse primer could have no QCS while the forward primer could have one of eight QCS. The QCS sequences could be the same or different. Table 6 lists the possible QCS options, whereas a forward primer could include one of eight differernt QCS options and the reverse primer could include one of eight different QCS options depending on what should be implemented to reduce amplification bias and correct distorted polynucleotide ratios which can occur when amplifying a STR that is repeated oa few number of times vs a STR that repeats itself a large number of time. For example, CSF1PO has observed alleles with AGAT repeated from 5 to 16 times. Implementing a QCS on one or both of the primers in the pair for amplification of CSFIPO can help correct bias observed when trying to amplify a smaller allele (5 repeats) and a larger allele (13) simultaneously, for example. The same can also be done for inter-reaction primers such as, for example, a biased amplification that might be the result of a STR repeat for one STR target and a different STR target, one having a smaller number of STR repeats and the other a larger number of repeats of a particular STR (FIG. 1). Table 7-QCS sequence options for a primer pairForward primerReverse primerNo QCSNo QCSQCS1QCS1QCS2QCS2QCS3QCS3QCS4QCS4QCS5QCS5QCS6QCS6QCS7QCS7QCS8QCS8 Minimize or eliminate primer-dimers
[0096] In some embodiments, one or more primers from the plurality of primers includes one or more QCSs. In some embodiments, one or more primers from the plurality of primers includes a QCS sequence selected from QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7 and QCS8 a second or more different primers from the plurality of primers also includes a QCS sequence selected from QCS1, QCS2, QCS3, QCS4, QCS5, QCS6, QCS7 and QCS8. Table 7 lists the different options for QCS combination of an exemplary first and second primer from a plurality of primers. In essence, one primer could have one of eight different QCS choices, a second primer could have a choice of one to eight different QCS choices, a third, fourth, fifth, etc. primer of a plurality of primers which could also include any of the eight QCS sequences. As such, if primer-dimers are observed one or both of the primers that is contributing to the primer dimer could include from one to eight different QCS in order to diminish or eliminate the observed primer-dimer. Table 8-QCS sequence options for two primers in a plurality of primersPrimer 1Primer 2No QCS sequenceNo QCS sequenceQCS1QCS1QCS2QCS2QCS3QCS3QCS4QCS4QCS5QCS5QCS6QCS6QCS7QCS7QCS8QCS8 Kits and systems
[0097] In another aspect, provided herein is a kit including an oligonucleotide composition provided herein. In some embodiments, the kit is for use in a DNA profiling method, such as a forensic DNA profiling method, a paternity testing method, or an ancestry analysis method.
[0098] In some embodiments, the kit includes an oligonucleotide composition that includes a plurality of primers, each primer including a TS and wherein the plurality of primers includes two or more QCS selected from QCS1, QCS2, QCS3, QCS4, QCS5, QCS6, QCS7, and QCS8. In some embodiments, one or more of the plurality of primers includes an ES.
[0099] In some embodiments, two or more primers of the plurality of primers are stored as a primer pool, e.g., in a single tube, or a single well of a multiwell plate. In some embodiments, all primers of the plurality of primers are stored in a single primer pool. In other embodiments, primers are stored in more than one primer pool, for example, two, three or four primers pools.
[0100] In some embodiments, two of more of the plurality of primers are stored separately, e.g., a primer is stored in a separate tube or a separate well of a multiwell plate.
[0101] In some embodiments, the kit includes instructions for using the components of the kit. In some embodiments, the instructions describe a method provided herein, e.g., a forensic DNA profiling method.Sequencing methodologies
[0102] In some embodiments, the method includes preparing a DNA sequencing library using the amplified target polynucleotides from the sample.
[0103] In some embodiments, the method includes sequencing the DNA sequencing library, e.g., by next generation sequencing.
[0104] In some embodiments, the methods for amplifying or sequencing target polynucleotides of interest provided herein, using the oligonucleotide compositions provided herein, yield higher quality sequencing data for one or more target polynucleotides of interest compared to a method using other oligonucleotide compositions, such as oligonucleotide compositions in which all primers lack a QCS or ES sequence, or oligonucleotide compositions including different pluralities of primers (e.g., each plurality of primers having a different TS), in which all primers share the same QCS (e.g., a fully randomized QCS).
[0105] In some embodiments, using an oligonucleotide composition provided herein, in a sequencing method provided herein increases the sequencing information obtained for one or more target polynucleotides of interest (e.g., in % of aligned reads, limit of detection and quantitative accuracy for target polynucleotide) by 1.5-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, or 5.0-fold relative to a comparable method using another oligonucleotide composition, such as an such as oligonucleotide compositions in which all primers lack a QCS or ES sequence, or oligonucleotide compositions including different pluralities of primers (e.g., each plurality of primers having a different TS), in which all primers share the same QCS (e.g., a fully randomized QCS).
[0106] In some embodiments, using an oligonucleotide composition provided herein in a sequencing method provided herein can increase the sequencing information obtained for one or more target polynucleotides of interest to 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more % of aligned reads, whereas using another oligonucleotide composition in which all primers lack a QCS or ES sequence or in which different pluralities of primers (e.g., with different TS) all share the same QCS (e.g., a fully randomized QCS) yields less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5 % of aligned reads for the one or more target polynucleotides of interest.
[0107] In some embodiments, using an oligonucleotide composition provided herein in a sequencing method provided herein can increase the sequencing information obtained for one or more target polynucleotides of interest to 80% or more (e.g., % of aligned read from a sequencing library), whereas using another oligonucleotide composition in which different pluralities of primers (e.g., with different TS) all have a fully randomized QCS yields less than 50% (e.g., about 40%) of aligned reads for the one or more target polynucleotides of interest.
[0108] In another aspect, provided herein are methods for amplifying or sequencing a plurality of target polynucleotides in a sample including assembling an oligonucleotide composition provided herein. In some embodiments, the methods include sequencing the plurality of amplified target polynucleotides. In some embodiments, the oligonucleotide composition includes a plurality of primers, wherein each primer includes a target nucleic acid specific sequence (TS) and a quality control sequence (QCS), wherein the plurality of primers includes two or more QCS of QCS1, QCS2, QCS3, QCS4, QCS5, QCS6, QCS7, and QCS8. In some embodiments, the oligonucleotide composition includes one or more primers including a TS, a QCS, and an ES. In some embodiments, the oligonucleotide composition includes one or more primers including a TS and not including a QCS or an ES. In some embodiments, the oligonucleotide composition includes a plurality of primers including a TS and a QCS, wherein each primer includes a target nucleic acid specific sequence (TS) and a quality control sequence (QCS), wherein the plurality of primers includes two or more QCS of QCS1, QCS2, QCS3, QCS4, QCS5, QCS6, QCS7, and QCS8, and the composition includes one or more primers including a TS, a QCS, and an ES. In some embodiments, the oligonucleotide composition includes a plurality of primers including a TS and a QCS, wherein each primer includes a target nucleic acid specific sequence (TS) and a quality control sequence (QCS), wherein the plurality of primers includes two or more QCS of QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, and QCS8, the composition includes one or more primers including a TS, a QCS, and an ES, and the composition includes one or more primers including a TS and not including a QCS and an ES.
[0109] In some embodiments, sequencing a library including a plurality of target polynucleotides of interest that was produced by amplifying the target polynucleotides using an optimized primer pool or an oligonucleotide composition provided herein yields more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, or more than 99% of aligned reads (% library output) for the target polynucleotides, whereas sequencing a library including the plurality of target polynucleotides of interest that was produced by amplifying the target polynucleotides using the initial primer pool (e.g., a primer pool of P-TS-QCS1 primers alone) yields less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 1%, or less than 0.1% of aligned reads (% library output) for the target polynucleotides.
[0110] In some embodiments, sequencing a library including a plurality of target polynucleotides of interst that was produced by amplifying the target polynucleotides using an optimized primer pool or an oligonucleotide composition provided herein yields more than 80% of aligned reads (% library output) for the target polynucleotides, whereas sequencing a library including the plurality of target polynucleotides of interest that was produced by amplifying the target polynucleotides using the initial primer pool (e.g., a primer pool of P-TS-QCS1 primers alone) yields less than 0.1% of aligned reads (% library output) for the target polynucleotides.
[0111] The present methods are not limited to any particular sequencing platform and are exemplified here in regards to SBS, or sequence by synthesis, type of parallel sequencing. Particularly applicable techniques are those wherein nucleic acids are attached at fixed locations in an array such that their relative positions do not change and wherein the array is repeatedly imaged. Examples in which images are obtained in different color channels, for example, coinciding with different labels used to distinguish one nucleotide base type from another are particularly applicable.
[0112] SBS techniques generally involve the enzymatic extension of a nascent nucleic acid strand through the iterative addition of nucleotides against a template strand. In traditional methods of SBS, a single nucleotide monomer may be provided to a target polynucleotide in the presence of a polymerase in each delivery. However, in the methods described herein, more than one type of nucleotide monomer can be provided to a target nucleic acid in the presence of a polymerase in a delivery.
[0113] SBS techniques can utilize nucleotide monomers that have a label moiety or those that lack a label moiety. Accordingly, incorporation events can be detected based on a characteristic of the label, such as fluorescence of the label; a characteristic of the nucleotide monomer such as molecular weight or charge; a byproduct of incorporation of the nucleotide, such as release of pyrophosphate, or the like. In some examples where two or more different nucleotides are present in a sequencing reagent, the different nucleotides can be distinguishable from each other, or alternatively, the two or more different labels can be the indistinguishable under the detection techniques being used. For example, the different nucleotides present in a sequencing reagent can have different labels and they can be distinguished using appropriate optics as exemplified by the sequencing methods developed by Solexa (now Illumina, Inc.).
[0114] Some examples include pyrosequencing techniques. Pyrosequencing detects the release of inorganic pyrophosphate (PPi) as particular nucleotides are incorporated into the nascent strand (Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M. and Nyren, P. (1996) "Real-time DNA sequencing using detection of pyrophosphate release." Analytical Biochemistry 242(1), 84-9; Ronaghi, M. (2001) "Pyrosequencing sheds light on DNA sequencing." Genome Res. 11 (1), 3-11; Ronaghi, M, Uhlen, M. and Nyren, P. (1998) "A sequencing method based on real-time pyrophosphate." Science 281(5375), 363; U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568 and U.S. Pat. No. 6,274,320). In pyrosequencing, released PPi can be detected by being immediately converted to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP generated is detected via luciferase-produced photons. The nucleic acids to be sequenced can be attached to features in an array and the array can be imaged to capture the chemiluminscent signals that are produced due to incorporation of a nucleotides at the features of the array. An image can be obtained after the array is treated with a particular nucleotide type (e.g. A, T, C or G). Images obtained after addition of each nucleotide type will differ with regard to which features in the array are detected. These differences in the image reflect the different sequence content of the features on the array. However, the relative locations of each feature will remain unchanged in the images. The images can be stored, processed and analyzed using the methods set forth herein. For example, images obtained after treatment of the array with each different nucleotide type can be handled in the same way as exemplified herein for images obtained from different detection channels for reversible terminator-based sequencing methods.
[0115] In another example of SBS, cycle sequencing is accomplished by stepwise addition of reversible terminator nucleotides containing, for example, a cleavable or photobleachable dye label as described, for example, in WO 04 / 018497 and U.S. Pat. No. 7,057,026. This approach is being commercialized by Solexa (now Illumina Inc.), and is also described in WO 91 / 06678 and W 07 / 123,744. The availability of fluorescently-labeled terminators in which both the termination can be reversed and the fluorescent label cleaved facilitates efficient cyclic reversible termination (CRT) sequencing. Polymerases can also be co-engineered to efficiently incorporate and extend from these modified nucleotides. Additional exemplary SBS systems and methods which can be utilized with the methods and systems described herein are described in U.S. Patent Application Publication No. 2007 / 0166705, U.S. Patent Application Publication No. 2006 / 0188901, U.S. Pat. No. 7,057,026, U.S. Patent Application Publication No. 2006 / 0240439, U.S. Patent Application Publication No. 2006 / 0281109, PCT Publication No. WO 05 / 065814, U.S. Patent Application Publication No. 2005 / 0100900, PCT Publication No. WO 06 / 064199, PCT Publication No. WO 07 / 010,251, U.S. Patent Application Publication No. 2012 / 0270305 and U.S. Patent Application Publication No. 2013 / 0260372.
[0116] Some examples can utilize detection of four different nucleotides using fewer than four different labels. For example, SBS can be performed utilizing methods and systems described in U.S. Patent Application Publication No. 2013 / 0079232. As a first example, a pair of nucleotide types can be detected at the same wavelength, but distinguished based on a difference in intensity for one member of the pair compared to the other, or based on a change to one member of the pair (e.g. via chemical modification, photochemical modification or physical modification) that causes apparent signal to appear or disappear compared to the signal detected for the other member of the pair. As a second example, three of four different nucleotide types can be detected under particular conditions while a fourth nucleotide type lacks a label that is detectable under those conditions, or is minimally detected under those conditions (e.g., minimal detection due to background fluorescence, etc). Incorporation of the first three nucleotide types into a nucleic acid can be determined based on presence of their respective signals and incorporation of the fourth nucleotide type into the nucleic acid can be determined based on absence or minimal detection of any signal. As a third example, one nucleotide type can include label(s) that are detected in two different channels, whereas other nucleotide types are detected in no more than one of the channels. The aforementioned three exemplary configurations are not considered mutually exclusive and can be used in various combinations. An exemplary embodiment that combines all three examples, is a fluorescent-based SBS method that uses a first nucleotide type that is detected in a first channel (e.g. dATP having a label that is detected in the first channel when excited by a first excitation wavelength), a. second nucleotide type that is detected in a second channel (e.g. dCTP having a label that is detected in the second channel when excited by a second excitation wavelength), a third nucleotide type that is detected in both the first and the second channel (e.g. dTTP having at least one label that is detected in both channels when excited by the first and / or second excitation wavelength) and a fourth nucleotide type that lacks a label that is not, or minimally, detected in either channel (e.g. dGTP having no label).
[0117] Further, as described in U.S. Patent Application Publication No. 2013 / 0079232, sequencing data can be obtained using a single channel. In such so-called one-dye sequencing approaches, the first nucleotide type is labeled but the label is removed after the first image is generated, and the second nucleotide type is labeled only after a first image is generated. The third nucleotide type retains its label in both the first and second images, and the fourth nucleotide type remains unlabeled in both images.
[0118] Some examples can utilize sequencing by ligation techniques. Such techniques utilize DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides. The oligonucleotides typically have different labels that are correlated with the identity of a particular nucleotide in a sequence to which the oligonucleotides hybridize. As with other SBS methods, images can be obtained following treatment, of an array of nucleic acid features with the labeled sequencing reagents. Each image will show nucleic acid features that have incorporated labels of a particular type. Different features will be present or absent in the different images due the different sequence content of each feature, but the relative position of the features will remain unchanged in the images. Images obtained from ligation-based sequencing methods can be stored, processed and analyzed as set forth herein. Exemplary SBS systems and methods which can be utilized with the methods and systems described herein are described in U.S. Pat. No. 6,969,488, U.S. Pat. No. 6,172,218, and U.S. Pat. No. 6,306,597.
[0119] Some examples can utilize nanopore sequencing (Deamer, D. W. & Akeson, M. "Nanopores and nucleic acids: prospects for ultrarapid sequencing." Trends Biotechnol. 18, 147-151 (2000); Deamer, D. and D. Branton, "Characterization of nucleic acids by nanopore analysis". Acc. Chem. Res. 35:817-825 (2002); Li, J., M. Gershow, D. Stein, E. Brandin, and J. A. Golovchenko, "DNA molecules and configurations in a solid-state nanopore microscope" Nat. Mater. 2:61 1 -615 (2003)). In such embodiments, the target nucleic acid passes through a nanopore. The nanopore can be a synthetic pore or biological membrane protein, such as □ - hemolysin. As the target nucleic acid passes through the nanopore, each base-pair can be identified by measuring fluctuations in the electrical conductance of the pore. (U.S. Pat. No. 7,001,792; Soni, G. V. & Meller, "A. Progress toward ultrafast DNA sequencing using solid-state nanopores." Clin. Chem. 53, 1996-2001 (2007); Healy, K. "Nanopore -based single-molecule DNA analysis." Nanomed. 2, 459-481 (2007); Cockroft, S. L., Chu, J., Amorin, M. & Ghadiri, M. R. "A single-molecule nanopore device detects DNA polymerase activity with single-nueleotide resolution." J. Am. Chem. Soc. 130, 818-820 (2008)). Data obtained from nanopore sequencing can be stored, processed and analyzed as set forth herein. In particular, the data can be treated as an image in accordance with the exemplary treatment of optical images and other images that is set forth herein.
[0120] Some examples can utilize methods involving the real-time monitoring of DNA polymerase activity. Nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore -bearing polymerase and γ-phosphate-labeled nucleotides as described, for example, in U.S. Pat. No. 7,329,492 and U.S. Pat. No. 7,211,414 or nucleotide incorporations can be detected with zero-mode waveguides as described, for example, in U.S. Pat. No. 7,315,019 and using fluorescent nucleotide analogs and engineered polymerases as described, for example, in U.S. Pat. No. 7,405,281 and U.S. Patent Application Publication No. 2008 / 0108082. The illumination can be restricted to a zeptoliter-scale volume around a surface-tethered polymerase such that incorporation of fluorescently labeled nucleotides can be observed with low background (Levene, M. j. et al. "Zero-mode waveguides for single-molecule analysis at high concentrations." Science 299, 682-686 (2003); Lundquist, P. M. et al. "Parallel confocal detection of single molecules in real time." Opt. Lett. 33, 1026-1028 (2008); Korlach, J. et al. "Selective aluminum passivation for targeted immobilization of single DNA polymerase molecules in zero-mode waveguide nanostructures." Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008)). Images obtained from such methods can be stored, processed and analyzed as set forth herein.
[0121] Some SBS embodiments include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are commercially available from Ion Torrent (Guilford, CT, a Life Technologies subsidiary) or sequencing methods and systems described in US 2009 / 0026082 Al; US 2009 / 0127589 A1; US 201 0 / 0137143 A1; or US 2010 / 0282617 A1. Methods set forth herein for amplifying target nucleic acids using kinetic exclusion can be readily applied to substrates used for detecting protons. More specifically, methods set forth herein can be used to produce clonal populations of amplicons that are used to detect protons.
[0122] The above SBS methods can be advantageously carried out in multiplex formats such that multiple different target nucleic acids are manipulated simultaneously. In particular embodiments, different target nucleic acids can be treated in a common reaction vessel or on a surface of a particular substrate. This allows convenient delivery of sequencing reagents, removal of unreacted reagents and detection of incorporation events in a multiplex manner. In embodiments using surface-bound target nucleic acids, the target nucleic acids can be in an array format. In an array format, the target nucleic acids can be typically bound to a surface in a spatially distinguishable manner. The target nucleic acids can be bound by direct covalent attachment, attachment to a bead or other particle or binding to a polymerase or other molecule that is attached to the surface. The array can include a single copy of a target nucleic acid at each site (also referred to as a feature) or multiple copies having the same sequence can be present at each site or feature. Multiple copies can be produced by amplification methods such as, bridge amplification or emulsion PGR as described in further detail below.Primer assembly and optimization
[0123] The oligonucleotide compositions provided herein can be assembled in an iterative process.
[0124] In some embodiments, an oligonucleotide composition provided herein is assembled in an iterative process. Generally, in the iterative process, an initial pool of primers is designed, e.g., computationally, to amplify a plurality of target polynucleotides of interest. The primers in the initial pool can, e.g., each include a TS and a QCS. The QCS in the primers of the initial pool can be of the same type (e.g., QCS1, QCS2, QCS3, QCS4, QCSS, QCS6, QCS7, or QCS8) for each primer in the initial pool, or different primers in the initial pool can have different QCSs. In some embodiments, all primers of the initial pool comprise a QCS1, which is a fully randomized sequence. An oligonucleotide composition provided herein can be assembled, e.g., as an optimized pool of primers, using an iterative process provided herein, e.g., by a) testing the initial pool of primers for the ability of each primer (or primer pair) to amplify a target polynucleotide of interests from a sample; b) identifying separate subgroups of primers that are capable or not capable of amplifying a target polynucleotide; c) independently modifying each primer not capable of amplifying a target polynucleotide; d) retesting the modified primers, e.g., either alone or in a pool with other primers that were previously identified as being capable of amplifying a target polynucleotide, and e) identifying separate subgroups of modified primers that are capable or not capable of amplifying a target polynucleotide. An optimized primer pool can, e.g., be produced by combining unmodified and modified primers that were identified as being capable of amplifying a target polynucleotide.
[0125] Any modified primers that remain incapable of amplifying a target polynucleotide can, optionally, be further modified and retested in one or more additional rounds of primer optimization. Any further modified primers that are capable of amplifying a target polynucleotide can also be added to an optimized primer pool.
[0126] Independent primer optimization can be continued, e.g., until the optimized primer pool includes primers capable of amplifying each target polynucleotide of interest. Primer modification at each step of the iterative process can include, e.g., modifying a primer's QCS, adding an ES, or modifying a primer's TS. Each primer can be modified independently of any other primer. For example, one primer in a plurality or subgroup of primers can be modified by modifying the primer's QCS, and another primer in the plurality or subgroup of primers can be modified by adding an ES. In some embodiments, in a given step in the iterative process, all primers selected for modification are modified by modifying the primer's QCS. In some embodiments, in a given step in the iterative process all primers selected for modification are modified by modifying the primer's ES. The iterative processes provided herein can optionally include sequencing of the amplified target polynucleotides.
[0127] In another aspect, provided herein is a method for assembling an oligonucleotide composition provided herein, including a) providing an initial primer pool including a plurality of primers (P), wherein each primer includes a TS and a QCS (P-TS-QCS primer); b) amplifying target polynucleotides from a sample using the initial primer pool; c) identifying a subgroup of primers (e.g., first subgroup) in the initial primer pool capable of detectably amplifying the target polynucleotides or identifying a subgroup of primers (e.g., second subgroup) in the initial primer pool not capable of detectably amplifying the target polynucleotides or only capable of low-level amplification of the target polynucleotides; d) independently modifying one or more primers in the subgroup of primers (e.g., second subgroup) capable of no or only low-level amplification of the target polynucleotides, whereby modifying includes i) modifying a primers' TS to TS' (P-TS'-QCS); ii) modifying a primers' QCS to QCS' (P-TS-QCS'), or iii) adding an ES to a primer (P-TS-QCS-ES); e) optionally identifying a subgroup of modified primers (e.g., third subgroup) capable of detectably amplifying a target polynucleotide or identifying a subgroup of modified primers (e.g., fourth subgroup) capable of no or only low-level amplification of a target polynucleotide, and f) optionally, combining primers and modified primers capable of detectably amplifying a target polynucleotide to produce an optimized primer pool.
[0128] In some embodiments, the QCS in each primer of the initial primer pool is a QCS 1 (each position in the QCS 1 is fully randomized).
[0129] In some embodiments, a primer of a first subgroup of primers is a P-TS-QCS primer capable of amplifying the primer's target polynucleotide to detectable levels.
[0130] In some embodiments, a primer of a second subgroup of primers is a P-TS-QCS primer not capable of amplifying the primer's target polynucleotide to detectable levels, or only capable of amplifying the primer's target polynucleotide to low-levels.
[0131] In some embodiments, a primer of a third subgroup of primers is a modified P-TS-QCS primer (e.g., a modified primer of the second subgroup of primers) that is capable of amplifying the primer's target polynucleotide to detectable levels. The primer of the third subgroup can be modified, e.g., to include a modified TS (TS'), a modified QCS (QCS'), or an ES.
[0132] In some embodiments, a primer of a fourth subgroup of primers is a modified P-TS-QCS primer (e.g., a modified primer of the second subgroup of primers) that is not capable of amplifying the primer's target polynucleotide to detectable levels, or only capable of amplifying the primer's target polynucleotide to low-levels. The primer of the fourth subgroup can be modified, e.g., to include a modified TS (TS'), a modified QCS (QCS'), or an ES.
[0133] In some embodiments, a primer of a fifth subgroup of primers is a modified P-TS-QCS primer or a modified P-TS-QCS-ES primer (e.g., a further modified primer of the fourth subgroup of primers) that is capable of amplifying the primer's target polynucleotide to detectable levels. The primer of the fourth subgroup can be further modified, e.g., to include a modified TS (e.g., TS'), a further modified TS (e.g., TS"), a modified QCS (e.g., QCS'), a further modified QCS (e.g., QCS"), an ES or a modified ES (e.g., ES'), or a combination thereof.
[0134] In some embodiments, a primer of a sixth subgroup of primers is a modified P-TS-QCS primer or a modified P-TS-QCS-ES primer (e.g., a further modified primer of the fourth subgroup of primers) that is not capable of amplifying the primer's target polynucleotide to detectable levels, or only capable of amplifying the primer's target polynucleotide to low-levels. The primer of the fourth subgroup can be further modified, e.g., to include a modified TS (e.g., TS') a further modified TS (e.g., TS"), a modified QCS (e.g., QCS'), a further modified QCS (e.g., QCS"), an ES or a modified ES (e.g., ES'), or a combination thereof.
[0135] In some embodiments, steps d) and e) are repeated two or more times (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 times or more) to further modify the primers of a subgroup of primers, e.g., primers of a subgroup that are not capable of amplifying the primers' target polynucleotide from a sample or that are only capable of amplifying the primers' target polynucleotide to low levels. Further modifications can, e.g., be made to the primers TS (e.g., to yield a TS', TS", TS''', or the like), the primers' QCS (e.g., to yield a QCS', QCS", QCS‴, or the like), or the primers' ES (e.g., to yield an ES', ES", ES‴, or the like). Further modified primers can subsequently be used to amplify target polynucleotides to characterize additional subgroups of primers with respect to their ability to amplify the primers' target polynucleotides from a sample.
[0136] In some embodiments, independently modifying the one or more primers in d) includes modifying the one or more primers in the same manner.
[0137] In some embodiments, independently modifying the one or more primers in d) includes introducing a first modification to one or more primers and introducing a second modification to one or more different primers. In some embodiments, the first and second modifications are the same. In some embodiments, the first and second modifications are different.
[0138] In some embodiments, independently modifying the one or more primers in d) includes modifying each of the one or more primer by either i) modifying the primers' TS to TS' (P-TS'-QCS); ii) modifying the primers' QCS to QCS' (P-TS-QCS'), or iii) adding an ES to the primers (P-TS-QCS-ES).
[0139] In some embodiments, independently modifying the one or more primers in d) includes modifying one or more primers by modifying the primers' TS to TS' (P-TS'-QCS) and modifying one or more other primers by modifying the primers' QCS to QCS' (P-TS-QCS'), or by adding an ES to the primers (P-TS-QCS-ES).
[0140] In some embodiments, independently modifying the one or more primers in d) includes modifying one or more primers by modifying the primers' QCS to QCS' (P-TS-QCS') and modifying one or more other primers by modifying the primers' TS to TS' (P-TS'-QCS) or by adding an ES to the primers (P-TS-QCS-ES).
[0141] In some embodiments, independently modifying the one or more primers in d) includes modifying one or more primers by adding an ES to the primers (P-TS-QCS-ES) and modifying one or more other primers by modifying the primers' TS to TS' (P-TS'-QCS) or by modifying the primers' QCS to QCS' (P-TS-QCS').
[0142] In some embodiments, modifying a primer's QCS to QCS' includes replacing the primer's QCS with a QCS of a different type, e.g., replacing a QCS1 with a QCS2. In some embodiments, modifying a primer's QCS includes replacing the primer's QCS with a different QCS of the same type, e.g., replacing a QCS2 (e.g., QCS2(1) including one partially randomized position) with a different QCS2 (e.g., QCS2(2) including two partially randomized positions).
[0143] In some embodiments, adding an ES to a primer includes adding an ES to the 5'-end or the 3'-end of the QCS. In some embodiments, adding an ES to a primer includes adding an ES to both the 5'-end and the 3'-end of the QCS. In some embodiments, the ESs added on the 5'-end and the 3'-end of the QCS are the same ES. In some embodiments, the ESs added on the 5'-end and the 3'-end of the QCS are different ESs.
[0144] In some embodiments, the method includes e) using the modified primers of d) to amplify the modified primers' target polynucleotides of interest from the sample and identifying a subgroup of primers (e.g., third subgroup) resulting in detectable amplification of the primers' target polynucleotide or identifying a subgroup of primers (e.g., fourth subgroup) resulting in no detectable amplification or only low-level amplification of the primers' target polynucleotide from the sample.
[0145] In some embodiments, the method includes repeating d) and e) one or more times using the subgroup of primers of e) (e.g., fourth subgroup), which result in no detectable amplification or only low-level amplification of the primers' target polynucleotides, to obtain further subgroups of primers (e.g., fifth subgroup, sixth subgroup) that include one or more additional modifications, e.g., in a primer's TS or QCS sequence, or with respect to the presence or absence of an ES.
[0146] In some embodiments, the method includes producing an optimized primer pool. In some embodiments, the optimized primer pool includes one or more primers from the first subgroup of primers (P-TS-QCS). In some embodiments, the optimized primer pool includes one or more primers from the third subgroup of primers (e.g., P-TS-QCS', P-TS'-QCS, P-TS-QCS-ES). In some embodiments, the optimized primer pool includes one or more primers from the fifth subgroup of primers (e.g., P-TS'-QCS', P-TS'-QCS-ES, P-TS-QCS'-ES). In some embodiments, the optimized primer pool includes one or more primers from the first subgroup of primers and one or more primers from the third subgroup of primers. In some embodiments, the optimized primer pool includes one or more primers form the first subgroup of primers and one or more primers from the fifth subgroup of primers. In some embodiments, the optimized primer pool includes one or more primers from the third subgroup of primers and one or more primers from the fifth subgroup of primers. In some embodiments, the optimized primer pool includes one or more primers from the first subgroup of primers, one or more primers from the third subgroup of primers, and one or more primers from the fifth subgroup of primers.
[0147] In some embodiments, the methods provided herein comprise sequencing the plurality of target polynucleotides of interest following amplification of the target polynucleotides using an optimized primer pool or an oligonucleotide composition provided herein to produce a DNA sequencing library.
[0148] An exemplary iterative method for assembling an oligonucleotide composition provided herein is illustrated in FIG. 4. In the method of FIG. 4, an initial pool of primers is designed, e.g., computationally to amplify a preselected set of target polynucleotides of interest from a sample. Primer3 software is used to design candidate primers for each target matching the assay PCR conditions. These candidates are scored and filtered based on their predicted interactions (e.g. dimer formation and off-target amplification) with each other in a multiplex PCR. Each primer (P) in the initial pool includes a TS and a QCS (each primer includes a fully randomized QCS, QCS1). The initial primer pool is then tested for the ability of individual primers to amplify a target polynucleic acid of interest from the sample. Primers that can amplify a target polynucleotide of interest from the sample are assigned to a first subgroup of primers (P-TS-QCS). P-TS-QCS primers resulting in no amplification or only low-levels of amplification of a target polynucleotide from the sample are assigned to a second subgroup of primers. Primers of the second subgroup of primers are then modified in their QCS (P-TS-QCS'). For example, a P-TS-QCS primer of subgroup two including a QCS1 can be modified to replace the QCS1 with a QCS2. The modified primers of the second subgroup (P-TS-QCS') are subsequently tested for the ability of individual primers to amplify a target polynucleotide of interest from the sample. Testing of the P-TS-QCS' primers can, e.g., be performed in a primer pool in the presence of the P-TS-QCS primers of the first subgroup. P-TS-QCS' primers that can amplify a target polynucleotide of interest from the sample are assigned to a third subgroup of primers. P-TS-QCS' primers resulting in no amplification or only low-level amplification of a target polynucleotide of interest from the sample are assigned to a fourth subgroup of primers. Primers of the fourth subgroup of primers are subsequently modified to incorporate an ES (on the 5'-end or the 3'-end of the QCS, or on both ends). The modified primers of the fourth subgroup (P-TS-QCS'-ES) are subsequently tested for the ability of individual primers to amplify a target polynucleotide of interest from the sample.
[0149] Testing of the P-TS-QCS'-ES primers can, e.g., be performed in a primer pool in the presence of the P-TS-QCS primers of the first subgroup, or the P-TS-QCS' primers of the third subgroup, or both. P-TS-QCS'-ES primers that can amplify a target polynucleotide of interest from the sample are assigned to a fifth subgroup of primers. P-TS-QCS'-ES primers resulting in no amplification or only low-level amplification of a target polynucleotide of interest from the sample are assigned to a sixth subgroup of primers. Primers of the sixth subgroup of primers can be optionally subjected to further optimization steps, which can, e.g., involve the redesign of the TS-sequence of the primer to a modified TS sequence (TS'). The TS'-primer (e.g., P-TS'-QCS) can be subjected to another iteration of the primer pool optimization method shown in FIG. 1. Alternatively, primers of the sixth subgroup can be added to an optimized primer pool. An exemplary optimized primer pool, e.g., as shown in FIG. 1, can include primers of some or all of the first subgroup of primers (P-TS), the third subgroup of primer (P-TS-QCS), and the fifth subgroup of primers (P-TS-QCS-ES).
[0150] In some embodiments, provided herein is a method for amplifying a plurality of target polynucleotides in a sample, including a) selecting a plurality of target polynucleotides of interest; b) designing an initial primer pool including a plurality of primers to amplify the plurality of polynucleotides, wherein each primer includes a target nucleic acid specific sequence (TS) and a first quality control sequence (QCS1), wherein each nucleic acid position in the QCS1 is fully randomized; c) analyzing the plurality of primers in a first amplification reaction to identify a first subgroup of primers resulting in detectable amplification of target nucleic acids in the sample and to identify a second subgroup of primers resulting in no detectable or minimally detectable amplification of the target nucleic acid in the sample; d) modifying the second subgroup of primers to replace the QCS 1 with a QCS selected from the group consisting of QCS2, wherein one or more nucleic acid positions are partially randomized, QCS3, wherein one or more nucleic acid positions are fixed, QCS4, wherein all nucleic acid positions are fixed, QCS5, wherein one or more nucleic acid positions are fully randomized and one or more nucleic acid positions are partially randomized, QCS6, wherein one or more nucleic acid positions are fully randomized and one or more nucleic acid positions are fixed, QCS7, wherein one or more nucleic acid positions are partially randomized and one or more nucleic acid position are fixed, and QCS8, wherein one or more nucleic acid positions are fully randomized, one or more nucleic acid positions are partially randomized, and one or more nucleic acid positions are fixed; e) analyzing the modified second subgroup of primers in a second amplification reaction to identify a third subgroup of primers resulting in detectable amplification of the target nucleic acid in the sample and to identify a fourth subgroup of primers resulting in no detectable or minimally detectable amplification of the target nucleic acid in the sample; f) modifying a primer from the fourth subgroup of primers to introduce an extension sequence (ES) flanking the 5'-end (5'ES) or the 3'-end (3'ES) of the QCS in the primer; g) analyzing the modified fourth subgroup of primers in an amplification reaction to identify a fifth subgroup of primers resulting in detectable amplification of the target nucleic acid in the sample, and h) amplifying the plurality of target nucleic acids in the sample using an optimized primer pool including a combination of primers from the first, third, or fifth subgroup of primers.
[0151] In some embodiments, the method includes iteratively modifying primers from the first, second, third, or fourth subgroup of primers until primers have been identified that can detectably amplify each of the plurality of target nucleic acids of interest.
[0152] In some embodiments, the method includes modifying a primer from the first, second, or third subgroup of primers to add an extension sequence (ES) flanking the 5'-end (5'ES) or the 3'-end (3'ES) of the QCS in the primer. In primers including an adaptor sequence (AS) the 5'ES is positioned between the AS on the 5'-end of the primer and the QCS. The 3'ES is typically positioned between the QCS and the TS.
[0153] In some embodiments, adding a 5'ES to a primer in a plurality or primers, e.g., of the first, second or third subgroup, includes selecting the 5'ES. In some embodiments, designing the 5'ES includes identifying all primers in the plurality of primers that include a 3'-end which is complementary to a sequencing library adaptor (e.g., an Illumina adapter), and selecting the shortest nucleic acid sequence that is not complementary to a nucleic acid sequence in the identified primers as the ES to be added to the primer in the plurality of primers.
[0154] In some embodiments, adding the 3'ES to a primer in a plurality of primers, e.g., of the first, second or third subgroup, includes, optionally, selecting the length of the ES (e.g., 4 nucleic acids); discarding possible 3'ESs that are at least partly complementary to a nucleic acid sequence upstream of the target polynucleotide sequence recognized by the TS of a primer in the plurality of primers; identifying a primer in the plurality of primers whose 3'-ends at least partly complements the 5'-end of another primer in the plurality of primers; select an ES that complements the least number of potential dimer partners in the plurality of primers as the 3'ES, and add the 3'ES into the identified primer.
[0155] In some embodiments, the method includes sequencing the amplified plurality of target nucleic acids.
[0156] In some embodiments, sequencing a plurality of target nucleic acids using an optimized primer pool yields more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, or more than 99% of aligned sequence reads, and sequencing the plurality of target nucleic acids using the initial primer pool yields less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 1%, or less than 0.1% of aligned sequence reads.
[0157] In some embodiments, the optimized primer pool includes one or more "primers selected from D16S359, D61043, DYS570, D19S433, PentaD, DYS576, AmelPP, DXS10135, D13S317, DYS389, D20S482, DXS10074, rs1805009, rs10776839, rs2831700, rs1042602, and rs1058083, DYS392, D22S1045, DYS19, DYS456, DYS439, and DYS635.
[0158] Examples of modified primer sequences containing QCS are provided in SEQ ID NO: 403-415 in Table 9. The sequences labeled as SEQ ID NO: 403-415 comprise the adapter sequence (shown in lowercase), the QCS (shown as NNNNN) and the gene-specific sequence (shown in uppercase italics). Table 9: Example primer sequences modified with QCSSEQ IDSequencePrimer NameSEQ ID NO:403tacacgacgctcttccgatctNNNNNCAAAGAAGTCAAAACAGAGGGATCADYS392_F4_TSEQ ID NO:404tacacgacgctcttccgatctNNNNNCAAAGGCAGATCCCAAGCTCTD16S539_F2_TSEQ ID NO:405tacacgacgctcttccgatctNNNNNCAATAGTGTGCAAGGATGGGTGD61043_F1_TSEQ ID NO:406tacacgacgctcttccgatctNNNNNCAACCTAAGCTGAAATGCAGATATTCDYS570_F1_TSEQ ID NO:407cttggcacccgagaattccaNNNNNAGGAGGTTGAGGCTGCAAAAD19S433_RSEQ ID NO:408tacacgacgctcttccgatctNNNNNGCATGGTGAGGCTGAAGTAGPentaD_F3_TSEQ ID NO:409tacacgacgctcttccgatctNNNNNGCARCTAGAATATAAGCAGGCAGGADYS456_F4_TSEQ ID NO:410tacacgacgctcttccgatctNNNNNGCAGTCTCATTTCCTGGAGATGAAGGDYS576_F2_TSEQ ID NO:411tacacgacgctcttccgatctNNNNNCCCTGGGCTCTGTAAAGAAAmelPP_F_TSEQ ID NO:412cttggcacccgagaattccaNNNNNGGAACACAATTATCCCTGAGTAGCAGDYS3891_II_R3_SmSEQ ID NO:413cttggcacccgagaattccaNNNNNGGACAGCCTCCATAWCCACATGD20S482 R2-SmSEQ ID NO:414cttggcacccgagaattccaNNNNNGCATCCRTGACTCTCTGGACD13S317 R2 SmSEQ ID NO:415tacacgacgctcttccgatctNNNNNTGAAACTAAAGTCAAATGGGGCTACDXS10135 F
[0159] Examples of modified primer sequences containing QCS-ES are provided in SEQ ID NO: 416-428 in Table 10. The sequences labeled as SEQ ID NO: 416-428 comprise the adapter sequence (shown in lowercase), aSpacer-ES (shown in bold), the QCS (shown as random nucleotides N or non-random nucleotides B, D, or H), the gSpacer-ES (shown in bold underlined) and the gene-specific sequence (shown in uppercase italics). The non random nucleotides in the QCS are according to the IUPAC codes (B denotes a C or G or T; D denotes a A or G or T; H denotes a A or C or T). Table 10: Example primer sequences modified with QCS-ESSEQ IDSEQUENCEPRIMER NAMESEQ ID NO:416tacacgacgctccttcccgatctTACG BNNNDCGCA CAAAGAAGTCAAAACAGAGGGATCADYS392_F4_TSEQ ID NO:417tacacgacgctcttccgatctTACG BNNNDCGCT CAAAGGCAGATCCCAAGCTCTD16S539_F2_TSEQ ID NO:418tacacgacgctcttccgatctTACG BNNNDCGCT CAATAGTGTGCAAGGATGGGTGD61043 F1 TSEQ ID NO:419tacacgacgctcttccgatctTACG BNNNDCGCT CAACCTAAGCTGAAATGCAGATATTCDYS570_F1_TSEQ ID NO:420cttggcacccgagaattccaACG NNNNHCCGG AGGAGGTTGAGGCTGCAAAAD19S433_RSEQ ID NO:421tacacgacgctcttccgatctTACG BNNNDCGCT GCATGGTGAGGCTGAAGTAGPentaD_F3_TSEQ ID NO:422tacacgacgctcttccgatctTACG BNNNDCGCT GCARCTAGAATATAAGCAGGCAGGADYS456 F4 TSEQ ID NO:423tacacgacgctcttccgatctTACG BNNNDCGCT GCAGTCTCATTTCCTGGAGATGAAGGDYS576_F2_TSEQ ID NO:424tacacgacgctcttccgatctTACG BNNNDCGCT CCCTGGGCTCTGTAAAGAAAmelPP_F_TSEQ ID NO:425cttggcacccgagaattccaACG NNNNHCCGC GGAACACAATTATCCCTGAGTAGCAGDYS389I_II_R3_SmSEQ ID NO:426cttggcacccgagaattccaACG NNNNHCCGC GGACAGCCTCCATAWCCACATGD20S482_R2-SmSEQ ID NO:427cttggcacccgagaattccaACG NNNNHCCGC GCATCCRTGACTCTCTGGACD13S317_R2_SmSEQ ID NO:428tacacgacgctcttccgatctTACG BNNNDCGCC TGAAACTAAAGTCAAATGGGGCTACDXS10135_F
[0160] Briefly, optimizing primer pools is an iterative process, for example as shown in the flowchart in FIG. 4. A commercially available primer design software such as Primer3 can be used to design candidate primers for each target in the PCR multiplex reaction. The designed primers can be scoring and filtered by the software based on predicted interactions (e.g., primer dimer formation, off target amplification, etc.) that could occur in an amplification reaction. Primers could be split into subpools for experimental testing and determination of primer dimer formation occurance, for example by aligning sequencing reads, running amplification products on a gel for primer dimer visualization, or any other qualitative or quantitative methodology known in that art. Primers that perform poorly, for example that form primer dimers, could be either replaced with other primer candidates or they could be modified with additional sequences that might reduce primer dimer formation; for example by incorporating the QCS and / or ES sequences described herein. The new designs could be retested, assayed for primer dimer formation, redesigned if needed, reassayed, etc. until a group of primers with optimized characteristics is finished.
[0161] The exemplary embodiments described herein provide detail for illustrative purposes and are subject to many variations in structure and design. It should be emphasized, however, that the present invention is not limited to a particularly disclosed embodiment shown or described. The terms "a," "an," and "the" herein do not denote a limitation of quantity, but rather denote the presence of at least one of the referenced object. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.
[0162] Furthermore, as will be appreciated by one skilled in the art, aspects of the present disclosure may be embodied as a system, method, or computer program product. Accordingly, aspects of the present disclosure may take the form of an entirely hardware embodiment or an embodiment combining software and hardware aspects that may all generally be referred to herein as a "circuit," "module" or "system." In addition, aspects of the present disclosure may take the form of a computer program product embodied in one or more computer readable medium(s) having computer readable program code embodied thereon.
[0163] Any combination of one or more computer readable medium(s) may be utilized. The computer readable medium may be a computer readable storage medium. A computer readable storage medium may be, for example, but not limited to, an electronic, magnetic, optical, electromagnetic, infrared, or semiconductor system, apparatus, or device, or any suitable combination of the foregoing. More specific examples (a non-exhaustive list) of the computer readable storage medium would include the following: an electrical connection having one or more wires, a portable computer diskette, a hard disk, a random access memory (RAM), a read-only memory (ROM), an erasable programmable read-only memory (EPROM or Flash memory), an optical fiber, a portable compact disc read-only memory (CD-ROM) or similar DVD-ROM and BD-ROM, an optical storage device, a magnetic storage device, or any suitable combination of the foregoing. In the context of this document, a computer readable storage medium may be any tangible medium that can contain, or store a program for use by or in connection with an instruction execution system, apparatus, or device.
[0164] Program code embodied on a computer readable medium may be transmitted using any appropriate medium, including but not limited to wireless, wireline, optical fiber cable, RF, etc., or any suitable combination of the foregoing. Computer program code for carrying out operations for aspects of the present disclosure may be written in any combination of one or more programming languages, including an object oriented programming language such as Java, Smalltalk, C++ or the like and conventional procedural programming languages, such as the "C" programming language or similar programming languages. The program code may execute entirely on the user's computer, partly on the user's computer, as a stand-alone software package, partly on the user's computer and partly on a remote computer or entirely on the remote computer or server. In the latter scenario, the remote computer may be connected to the user's computer through any type of network, including a local area network (LAN) or a wide area network (WAN), or the connection may be made to an external computer (for example, through the Internet using an Internet Service Provider).
[0165] At least some of the present disclosure is described below with reference to flowchart illustrations and / or block diagrams of methods, apparatus (systems) and computer program products according to embodiments of the disclosure. It will be understood that each block of the flowchart illustrations and / or block diagrams, and combinations of blocks in the flowchart illustrations and / or block diagrams, can be implemented by computer program instructions. These computer program instructions may be provided to a processor of a general purpose computer, special purpose computer, or other programmable data processing apparatus to produce a machine, such that the instructions, which execute via the processor of the computer or other programmable data processing apparatus, create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks.
[0166] These computer program instructions may also be stored in a computer readable medium that can direct a computer, other programmable data processing apparatus, or other devices to function in a particular manner, such that the instructions stored in the computer readable medium produce an article of manufacture including instructions which implement the function / act specified in the flowchart and / or block diagram block or blocks.
[0167] The computer program instructions may also be loaded onto a computer, other programmable data processing apparatus, or other devices to cause a series of operational steps to be performed on the computer, other programmable apparatus or other devices to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide processes for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks.
[0168] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0169] The following examples are provided by way of illustration, not limitation.EXAMPLES Example 1: QCS-ES modified primers reduce dimers
[0170] A plurality of primers which formed primer dimers when QCS sequences only were incorporated were subjected to further incorporation of an ES sequence. The primers forming a set of seven primer dimers as follows were redesigned using ES sequences. ES Implemented PrimerPrimer Dimer Formation ResolvedDYS392_F4_TDYS392-fwd:rs2831700-revD16S539_F2_TD61043_F1_TDYS570_F1_TD19S433-revDYS576-fwd:D19S433-revPentaD _ F3_TAny primer:DXS10074-revDYS456_F4_TDYS576_F2_TAmelPP_F_TAmelogenin-fwd:rs1805009-revDYS389I_II_R3_Smrs10776839-fwd:anyD20S482_R2_SmD13S317_R2_Smrs1042602-fwd:D13S317-revDXS10135-FAny primer:rs1058083-rev
[0171] FIG. 6A shows primer dimer formation when a QCS labeled forward Amelogenin primer and rs1805009 reverse primer were used in a PCR reaction. FIG. 6B shows that the implementation of ES sequence on forward Amelogenin primer prevented the dimer formation with rs1805009 reverse primer when used in a PCR reaction.
[0172] Three primer mixes were created: 1) core primer mix (unaffected by dimerization), 2) core primer mix plus the primers affected by dimerization in their QCS form and 3) core primer set plus the primers affected by dimerization in their QCS+ES form. The final primer concentration in each primer mix consisted of 4 nM of each STR primer and 1 nM of each SNP primer.
[0173] One ng of control DNA 2800M was used in a 15 µl PCR reaction containing PCR1 buffer and FEM Enzyme Mix from the FORENSEQ DNA Signature Prep kit (Illumina), as well as the appropriate primer mix. PCR amplification was performed as follows: 98°C for 3 min, 3 cycles of 98°C for 2 min, 54°C for 12 min (with a 0.2°C / s ramp down), 72°C for 4 min and a final hold at 10°C. Upon completion of thermocycling, 6 µl of primer removal reagent (5 µl of Single-Stranded Binding protein (SSB, 2 µg / µl, Epicenter, E0160-2), 0.67 µl of RecJ (30 U / µl, NEB, M0264L) and 0.33 µl of storage solution (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 50% glycerol and water) was added to the 15 µl PCR reaction. After thorough mixing by pipetting samples were incubated at 37°C for 60 min, 95°C for 10 min, 10°C for 5 min and a final hold at 10°C.
[0174] A second round of PCR reactions was prepared by adding 26 µl of PCR2 Reaction Mix followed by 2 µl of each index primers (FORENSEQ DNA Signature Prep Kit, Illumina) to a PCR reaction tube. PCR amplification was performed as follows: 95°C for 3 min, 34 cycles of 95°C for 30 s, 66°C for 30 s and 72°C for 1 min, then 72°C for 5 min and a final hold at 10°C. Sequencing libraries were purified as per manufacturer's instructions in the FORENSEQ DNA Signature Prep guide, with the exception of the first incubation at room temperature being performed for 8 min (instead of 5 min).
[0175] The quality and yield of each library was assessed by running the libraries on the FRAGMENT ANALYZER Automated CE System (Advanced Analytical) using High Sensitivity NGS Fragment Analysis Kit as per the manufacturer's recommendation. Libraries were normalized to 1.33 nM each, based on yields obtained by a smear analysis between 5 and 1000 bp. Libraries were pooled and sequenced on a MiSeq instrument (Illumina) according to manufacturer's recommended protocol, using a 351 x 51 bp run.
[0176] FIG. 7A shows the percentage of sequencing libraries showing primer-dimers when QCS primers were used (left column) as compared to the QCS + ES primers were used (right column) for 6 known primer dimer complexes. Primer dimers were calculated by the number of reads assigned to that dimer over the total number of reads in the library (expressed in % on the y-axis). The primer dimer formations resolved were for the primers DYS392-fwd: rs2831700-rev, DYS576-fwd:D19S433-rev, any primer:DXS10074-rev, Amelogenin-fwd:rs1805009-rev, rs10776839-fwd:any primer, rs1042602-fwd:D13S317-rev and any:rs1058083-rev. Addition of ES sequences resulted in reduction of primer-dimerization.
[0177] FIG. 7B shows the percentage of aligned reads when QCS primers were used (left column) as compared to the QCS + ES primers were used (right column). Read alignment was calculated as the number of reads aligned to the reference over the total number of reads in the library. As the number of primer dimers decreases through the use of ES, read alignment increases.Example 2: QCS-ES modified primers reduce primer dimers at low concetrations of input template
[0178] Primer-dimer formation can be an issue even at relatively low primer concentrations. To demonstrate that the QSC+ES primers reduces primer dimers even at low input template concentration, the experiment of Example 1 was repeated using 100pg of control DNA 2800M.
[0179] FIG. 8 shows FRAGMENT ANALYZER Automated CE System (Advanced Analytical) traces of libraries prepared using the three primer mixes described for Example 1 and 100pg of input DNA. FIG. 8A shows an exemplary Fragmant Analyzer trace for the core primer mix, no known primer dimers seen as evidenced by no demonstrable peaks in the black box. FIG. 8B shows the FRAGMENT ANALYZER Automated CE System (Advanced Analytical) trace for the core primer mix plus the primers affected by dimerization in their QCS form showing significant dimers as evidenced by the numerous peaks in the black box. FIG. 8C shows the FRAGMENT ANALYZER Automated CE System (Advanced Analytical) trace for the core primer mix plus the primers affected by dimerization in their QCS+ES form. There are little to no primer dimer peaks visible in the black box when the QCS+ES primer mix is used with the core primers, in contrast to what is seen in FIG. 8B.Example 3: QCS-ES modified primers reduce dimers at reduced primer concentrations
[0180] Primer-dimer formation could be more pronounced when the primer concentration is limited. To demonstrate that the QSC+ES primers reduce primer dimers even at low primer concentration, the experiment of Example 1 was repeated using reduced primers and 1ng of control DNA 2800M. The final primer concentration in each primer mix consist of 2 nM for each STR primer and 0.5 nM for each SNP primer.
[0181] FIG. 9 shows exemplary FRAGMENT ANALYZER Automated CE System (Advanced Analytical) traces of libraries prepared using the three primer mixes described for Example 1 with the exception that each primer mix consists of 2 nM of each STR primer and 0.5 nM of each SNP primer and 1 ng input DNA. FIG. 9A shows a FRAGMENT ANALYZER Automated CE System (Advanced Analytical) trace for the core primer mix with no demonstrable primer dimers in the black box. FIG. 9B shows a FRAGMENT ANALYZER Automated CE System (Advanced Analytical) trace for the core primer mix plus the primers affected by dimerization in their QCS form showing significant amounts of primer dimers in the black box. FIG. 9C shows a FRAGMENT ANALYZER Automated CE System (Advanced Analytical) trace for the core primer mix plus the primers affected by dimerization in their QCS+ES form. There are minimal to no primer dimer peaks in the black box when the QSC+ES primer mix is used with the core primers as compared to FIG. 9B.Example 4: Design of gSpacer and aSpacer
[0182] FIG. 10 shows an exemplarary flow diagram for designing a gSpacer (the ES on the TS side of a QCS). To design an effective gSpacer for a primer of interest in a pool of primers (referred to as primer X in Figure 10), possible stable interactions between the TS sequence of primer X, its QCS, and sequences of other primers in the pool that are conducive to forming primer-dimers are predicted. The gSpacer should disrupt all such stable interactions between primer X, its QCS and other primers in the pool. The gSpacer should not extend the complementarity of the TS sequence of primer X to its intended annealing site and alter the annealing temperature of primer X. In addition, the gSpacer should not in itself provide a sequence that, together with the QCS of primer X, results in new stable interactions with other primers in the pool.
[0183] First, the sequences of primers predicted to form a stable interaction with the TS sequence of primer X and its QCS are examined and those k-mers (all possible oligomers of length k, where k is the intended length of a gSpacer, for example, 4 nucleotides) that do not disrupt such interactions are excluded. Next, the sequence of the genomic flank upstream of the primer X annealing site are examined and any k-mers that extend complementarity of primer X to its annealing site are excluded. The gSpacers that passed the selection of the first two steps of the procedure are ranked according to; (A) their similarity to sequences of primers in the pool capable of forming a stable interaction with primer X; and (B) the number of primers in the pool that complement the gSpacer in question and form a novel dimer. In some embodiments, the randomness of the QCS of primer X is reduced to disrupt interactions conducive to forming new primer-dimers.
[0184] A flow diagram in Fig. 12 shows steps of embodiments of a disclosed method. In step S110, primer sequences can be received. In step S120, taboo seeds are determined from the primer sequences. This includes step 130 determining putative dimer partners. At this step we are looking for primers with orientation opposite to the main primer and also with sequences that can potentially allow formation of sequencable dimers with our main primer. In some embodiments, the main primer is a primer that forms UMI-mediated dmiers at an unnacceptebly high level, so that there is a need to modify the primer by adding spacers in order to reduce abundance of the dimers. Currently to identify partners the three first bases of the main primer (i.e. bases adjacent to UMI of the main primer), called anchor sequences. Primers in the opposite orientation are looked for that have a perfect anchor match. Ordinarily during dimer formation complementarity to bases after the anchor match (called anchor overhang sequence) is provided by the UMI of the main primer (see illustrations below). If anchor match and anchor overhang form a complementarity region of 5 bases or longer (but not extending beyond UMI) then such primer pairs can be considered to be putative dimer partners. For example, these are some of putative partners of DXS10074-rev main primer (SEQ ID NOS 429-436 disclosed below, respectively, in order of appearance):
[0185] On the other hand, these primers are currently not considered to be putative partners of DXS10074-rev (SEQ ID NOS 437-440 disclosed below, respectively, in order of appearance):
[0186] Here annealing with DYS505-fwd forms a complementarity stretch of less than 5 bases, so we do not consider such interaction to be dangerous and / or solvable with the gSpacer approach (also see Restrictions on minimum taboo seed length). While complementarity with RS1800414-fwd is longer than 5 bases, it is not actually completed at the 3'-end, so we also do not consider this to be dangerous and / or solvable with gSpacer. (Note that if the 3'-end of the anchor overhang would actually complement the adaptor part of DXS10074-rev primer, then such interaction is going to be addressing by aSpacer, see below).
[0187] Step S120 can include step S140 of determining taboo seeds from the putative dimer partner determination. Predicting putative dimer partners allows us to compile a list of taboo seeds - the sub-sequences that turn kmers to be inappropriate as spacers. For example, looking at DYS448-fwd:DXS10074-rev putative dimer (see illustration above) we can see that gSpacers of DXS10074-rev should not end with CC, because such spacers would not prevent formation of 5 nt perfect complementarity region with DYS448-fwd (that ends with AAAGG). Therefore, CC subsequence is a taboo seed, and kmers ending with CC are taboo sequences that should be excluded from gSpacer space. As another example, looking at rs12821256-fwd:DYS10074-rev putative dimer we can see that gSpacers should not end with TAA, as attaching such spacer to DXS10074-rev would create a 6 nt complementarity stretch with rs12821256-fwd (that ends with AAATTA). So TAA is also added to the list of taboo seeds. Restrictions on minimum taboo seed length: In principle we could have had 1 nt taboo seeds, as disrupting complementarity with the ending of the gSpacer could be sufficient to reduce dimer formation. From the two examples above (DYS448-fwd:DXS10074-rev and rs12821256-fwd:DXS10074-rev), 'C' and 'A' could be 1 nt taboo seeds. This however would exclude half of all possible gSpacers as any kmer ending with 'C' or 'A' would be considered a taboo sequence. So with 1 nt taboo seeds we very quickly loose gSpacer space and end up with no spacers at all. This is a part of the reason why DYS505-fwd:DXS10074-rev type of interactions are not practically solvable with gSpacer approach.
[0188] Next, step S120 can include step S150 of adding to the list of taboo seeds a sequence based on the genomic flank of the main primer. For example, an adjacent 2 base pairs from the outer genomic flank can be added to taboo seeds. We do not want gSpacer to extend complementarity of gene specific portion of the primer to genomic DNA. Therefore spacers should not include sequence of the genomic flank of the main primer, ideally not even partially. The current approach is to consider a two-nucleotide sequence of genomic flank immediately adjacent to the primer to be a taboo seed. Therefore currently all kmers ending with 2 nt of genomic flank are excluded from gSpacer space.
[0189] Step S160 includes making a list of candidate gSpacers. This can include step S170 completing taboo seeds into taboo sequences. The taboo seed can be as short as 2 bases and the gSpacer length can be as long as desired. In order to facilitate the procedure of filtering out taboo seed containing kmers from gSpacer space (next step) we first complete seeds into sequences that are of the same length as gSpacers that we want to design. For example, if we want to design a four-nt long gSpacer, a 3 nt taboo seed GGG would be completed into AGGG, TGGG, CGGG and GGGG taboo sequences.
[0190] The taboo seed can also have a length as short as 1 base, although in practice, with Forensics primer pool, kmer space could quickly run out if the kmers were filtered based on a match to 1nt taboo seeds. Setting taboo seed of length to 2nt is a practical decision for relatively large multiplex PCR primer pools, but if one deals with a very small primer pool with a handful of primers, then they can consider setting miniumum taboo seed length to 1 base.
[0191] Step S160 can include step S180 determining gSpacer candidates from the gSpacer space. For example, in some embodiments, after obtaining a list of kmers that contain taboo seeds, a gSpacer space (i.e. all possible kmers of length 4 nt) can be generated and can be reduced to candidate gSpacers by removing kmers that contained the seeds.
[0192] In steps described above, candidate gSpacers can be ensured to match neither putative dimer partners nor the genomic flank of the main partner. The addition of a gSpacer can create an opportunity of forming dimers with those primers that happen to match the gSpacer sequence itself. Thus, step S190 includes screening for the candidate gSpacers that minimize the likelihood of such interactions from taking place.
[0193] In step S192, the new interactions are counted with candidate gSpacers and primers in the primer pool. While step S194 is helpful in choosing the best candidate spacers through a different mechanism. By this point the fact that none of the candidate gSpacers match any of taboo sequences (this can be done during step S180) can be verified, such that step S194 can include choosing a spacer that not only does not match taboo sequences precisely, but as far as possible removed (using edit distance as a metric) from taboo sequences.
[0194] In step S192, a primer match counter can be used to count how many oppositely oriented primers match our candidate spacer. Additionally or alternatively, candidate gSpacers can be ranked by the number of primers of the opposite orientation that match its sequence (the smaller number of primers matched - the better). This computation can include tallying counts of primers with orientation opposite to the main primer that have a 3 nucleotide match to the 5' end (i.e., the left end of gSpacer, which can be the same as "the first three bases of gSpacer") of the gSpacer within 8 last nucleotides of these primer's (i.e., at their 3'ends, the same as right ends). A user can select from the list of ranked spacers a spacer that allows for the smallest number of such novel gSpacer-mediated dimers (it will be printed at the top of the list) and then manually adjust randomness in the UMI to allow these predicted dimers. Currently a complementarity to the first three bases of the spacer is required for a primer to be considered a match to gSpacer. The range can be [1,5] that can be checked for possible novel dimer-producing interactions between the candidate spacers and primers with opposite orientation in the pool. In cases of closed ranges (such as here, numbers enclosed in []), it can denote a range where both the start and the end of the range are inclusive, i.e. they are in 0-based counting. In this example, [1,5] can mean that we are looking for the gSpacer anchor matches (the gSpacer anchor is 3nt long) starting anywhere from the 2nd last nucleotide of the possible dimer partner sequence through starting at the 6th last nucleotide (i.e., match starting at the 6th nucleotide means that, the nucleotides 6th, 7th, and 8th last nucleotides of the primer dimer partner complement the gSpacer anchor).
[0195] Step S192 can include checking whether a spacer's [0,2] match oppositely oriented reverse complementary primers beginning in position [1,5]. The addition of gSpacer serves as the gSpacer anchor sequence, which can means three first nucleotides of a gSpacer, i.e. the nucleotides in the range [0,2], which is adjacent to the UMI sequence. That is, for the gSpacer anchor, range [0,2] can mean that the gSpacer anchor comprises 1st, 2nd and 3rd first nucleotides of the main primer (i.e. it's 5' or left end). A range referring to spans checking for anchor matches can mean checking for the beginning of the match. So checking for a match in [2,5] range means that the match can begin at the 3rd nucleotide, and in such case 3rd, 4th and 5th last nucleotides of the dimer partner primer (i.e it's 3' or right end) complement the gSpacer anchor sequence. And the match can begin as far as in the 6th nucleotide, and in such case 6th, 7th, and 8th last nucleotides of the dimer partner would complement the anchor sequence.
[0196] The gSpacers can be computed in step S194 by the sum of distances (edit distance) between its sequence and taboo sequences (the bigger distance - the better). This distance can be an alignment metric for measuring the difference between two sequences, such as a Levenshtein distance. Both steps S192 and S194 can compute metrics that allow for a subsequent ranking of spacers during following step described here. Step S190 can include step S196 outputting the results of the candidate gSpacers. In an embodiment, top 20 candidate gSpacers (using either metric) can be printed to standard output together with such metrics as the number of primers matched (i.e. potential new dimer partners) and the sum of distances between gSpacer length and taboo sequences. The very last line of the output can contain the best candidate gSpacer (as judged by the least number primers matched and the biggest distance from taboo sequences).
[0197] FIG. 11 shows an exemplarary flow diagram for designing an aSpacer (the ES on the adaptor side of a QCS). The type of a primer-dimer disrupted by an aSpacer is shown on the inset pane. For this type of a primer-dimer, a primer Y has a complementarity at its 3'-end to the adaptor sequence of a primer X. Since a primer X contains a QCS, complementarity of the primer Y and the adaptor can be extended by the QCS. In some instances, TS primer designs can have short substrings (e.g. 1-3 nt) at their 3'-end that complement the adaptor of primer X. In such cases, a fully randomized QCS of a primer X can extend this complementarity and lead to a stable interaction between primers Y and X, potentially resulting in a primer-dimer during PCR. In order to design an aSpacer for primer X, a sequence that does not fully complement any primer in the pool that has a complementarity at its 3'-end to the adaptor sequence of primer X is chosen. In other embodiments, an aSpacer can be chosen to disrupt interaction between the adaptor of a primer X, its QCS and a single selected primer or several selected primers from the pool of primers.
[0198] Some gene specific primer sequences have one or more base complementarity to the ending of an adaptor sequence, for example an Illumina adapter sequence. The UMI sequnce can extend this complementarity, as UMIs are adjacent to the adaptor sequnce in UMI primers. aSpacers are meant to disrupt UMI mediated adaptor complementarity extension (SEQ ID NOS 441-444 disclosed below, respectively, in order of appearance). any fwd primer with UMI
[0199] The diagram above shows how incorporation of ACG aSpacer disrupts formation of dimers with DXS10074-rev. Adaptors for forward and reverse primers are highlighted in purple and yellow, respectively. The UMI sequence is highlighted with yellow and aSpacer sequence is marked with '+' characters.Incorporating not-so-randomness into UMI of SUMIs
[0200] Spacer sequences are chosen in such a way that they match as few primers in the multiplex as possible. But it may not be possible to find a spacer that doesn't complement any of the primers in the mix. For example, CGCG sequence is very rare in the genome and can be a good spacer. Yet, the first three bases of such gSpacer anchor would complement PentaE-rev primer sequence and so PentaE-rev primer theoretically can form a dimer with primers carrying CGCG gSpacer. In order to be able to use CGCG spacer and at the same time prevent PentaE-rev primer from forming the dimer, we can reduce randomness of UMI in SUMIs. In the example of PentaE-rev interaction changing last nucleotide in UMI from N to D (which is 'A', "G' or 'T', but not 'C) is going to reduce PentaE-rev dimer with SUMI primers (SEQ ID NOS 445-448 disclosed below, respectively, in order of appearance). any fwd primer with CGCG spacer
[0201] Thus, in some embodiments, in addition to selecting the best-ranked spacers that introduce a level of instability in the interaction between the main primer and putative primer dimer partners, applying a level of not-so-randomness to the molecular tag of the main primer further increases instability of the interaction between the main primer and other primers. If a primer is found that complements the first three nucleotides of the candidate spacer anywhere beginning in the primer's [1,5] last nucleotides (i.e. at it's 3' or right end), then, according to some embodiments, the randomness of the UMI can be adjusted to allow use of such spacer. So the threshold can be a requirement for a perfect match of the Spacer's [0,2] nucleotides within the last eight nucleotides of the primer (in this step, matches that began at the very last nucleotide are less relevant, but being conservative the [0,5] range could be checked for possible interactions, and, conversely, more loose and narrowed checks to just [2,5] range could be checked. Thus, instead of the molecular tag having four possibilities for each of the nucleotides at each of five positions, the molecular tag could be designed to have one or more position with fewer than four possible nucleotides.
[0202] Thus, embodiments of the disclosure can include a computer-implemented method of determining a nucleotide spacer sequence for disrupting primer dimer formation. This method can include receiving a set of primer sequences. The method can also include determining, using at least one microprocessor, a plurality of candidate spacers between an adapter sequence and a gene-specific portion of the primer sequence. The determined plurality of candidate spacers can include sequences that disrupt stable interactions between sequences of the set of primer sequences. The method can include ranking, using at least one microprocessor, candidate spacers that meet a predetermined threshold value of stable interactions in the extension sequences. The method can include outputting a set of the ranked spacers that meet the predetermined threshold.
[0203] In the method, the plurality of spacers can be in between a molecular tag portion and one of the adapter sequence and the gene-specific portion of the primer sequence.
[0204] In the method, the step of determining spacer sequences can include determining a gene-specific side sequence that flanks a first side of the molecular tag.
[0205] The step of determining spacer sequences can also include determining an adapter side sequence that flanks a second side of the molecular tag.
[0206] The step of determining the candidate spacers can include determining, using at least one microprocessor, taboo seeds based on sequences that complement the primer; and removing sequences that include the taboo seeds from the candidate spacers. The step of determining the candidate spacers can include updating the taboo seed flank with adjacent base pair sequences from the outer genomic flank.
[0207] The step of ranking the list of candidate spacers can be based on alignment edit distances between the candidate spacers and the taboo sequences.
[0208] The step of ranking the list of primers can include checking whether a portion of the spacer sequences matches oppositely reversed complimentary primers. The step of ranking can further include designing the molecular tag to be less than completely random depending on the ranking of the set of the ranked spacers.
Claims
1. A method for optimizing a primer pool, the method comprising: a) selecting a plurality of target polynucleotides of interest; b) designing an initial primer pool including a plurality of primers to amplify the plurality of target polynucleotides of interest, wherein each primer includes a target nucleic acid specific sequence (TS) and a first quality control sequence (QCS1), wherein each nucleic acid position in the first QCS is fully randomized; c) amplifying target polynucleotides from a sample in a first amplification reaction using the initial primer pool, and analyzing the plurality of primers in the first amplification reaction to identify a first subgroup of primers resulting in detectable amplification of target polynucleotides in the sample and to identify a second subgroup of primers resulting in no detectable or minimally detectable amplification of target polynucleotides in the sample; d) modifying the second subgroup of primers to replace the first QCS with a second QCS (QCS2-QCS8), wherein one or more nucleic acid positions of the second QCS are partially randomized or fixed; e) amplifying target polynucleotides from a sample in a second amplification reaction using the modified second subgroup of primers, and analyzing the modified second subgroup of primers in the second amplification reaction to identify a third subgroup of primers resulting in detectable amplification of target polynucleotides in the sample and to identify a fourth subgroup of primers resulting in no detectable or minimally detectable amplification of target polynucleotides in the sample; f) modifying the fourth subgroup of primers to introduce an extension sequence (ES) flanking the 5'-end (5'ES) and / or the 3'-end (3'ES) of the QCS in the primers, wherein the ES is a sequence added to reduce primer dimer formation; g) amplifying target polynucleotides from a sample in a third amplification reaction using the modified fourth subgroup of primers, and analyzing the modified fourth subgroup of primers in the third amplification reaction to identify a fifth subgroup of primers resulting in detectable amplification of target polynucleotides in the sample, and h) assembling a primer pool including a combination of primers from all of the first, third, and fifth subgroups of primers.
2. The method of claim 1, wherein modifying the fourth subgroup of primers to introduce an ES comprises modifying the primers to introduce an ES flanking the 5'-end (5'ES) and the 3'-end (3'ES) of the QCS in the primers.
3. The method of claim 2, wherein each primer comprises an adaptor sequence (AS) on the 5'-end of the primer, and wherein a 5'ES is positioned between the AS and the QCS and a 3'ES is positioned between the QCS and the TS.