Production of proteins of interest in a non-sporulating bacterial strain

Abstract

The present invention relates to a novel protein production system composed of a non-spore-forming bacterial strain of the genus Bacillus transformed with a plasmid containing an expression cassette for a protein of interest controlled by a strong, stationary-phase promoter. The proteins of interest thus produced are present in a bacterial sac or anchored to the surface of the bacterium.

Description

Title of the invention: Production of proteins of interest in a non-sporulating bacterial strain

[0001] The present invention relates to a novel protein production system composed of a non-spore-forming bacterial strain of the genus Bacillus transformed with a plasmid containing an expression cassette for a protein of interest controlled by a strong, stationary-phase promoter. The proteins of interest thus produced are contained within a bacterial sac formed from the bacterial membrane or anchored to the surface of the bacterium.

[0002] The use of recombinant bacteria to produce proteins of interest, such as insulin and growth hormone, has been known for a long time and has been widely implemented, but it has also shown its limitations. Indeed, bacteria are unable to produce proteins with a complex structure such as antibodies or blood clotting factors. To be stable and active in vivo, and therefore effective in humans, these proteins must undergo multiple post-translational modifications.

[0003] It also happens that heterologous proteins of interest are toxic to the bacterial cell producing them. Vincent Ecochard et al., in "Techniques and Strategies in Molecular Biology," professional master's thesis, October 2011, http: / / www.m2p-egpr.ups-tlse.fr / Documents%20archives / Cours / Cours%20partie%202.pdf, detail the solutions that can be implemented to produce such proteins in a bacterial system. However, it is not simple to identify the best solution for the protein to be produced. The authors conclude that the last and best solution is to use an in vitro translation system.

[0004] Rosano et al., in "Recombinant protein expression in Escherichia coli: advances and challenges," Front. Microbiol., 17 April 2014, https: / / doi.org / 10.3389 / fmicb.2014.00172, indicate that only a few strains of E. coli are capable of producing toxic proteins, but the level of production of these proteins is low. A solution could be achieved by secreting the protein outside the bacterial cell or into the periplasm, using different promoters.

[0005] A simple to implement and high-yield bacterial system for producing proteins of interest is therefore necessary, particularly for the production of proteins of interest that may be toxic.

[0006] Bacillus thuringiensis (Bt) is a spore-forming Gram-positive bacterium that produces large quantities of insecticidal proteins (Cry and Cyt proteins). When certain Bt sporulation genes are no longer expressed, such as spo0A, sigE, or 5 When igF is inactivated, or when its product is no longer functional due to a mutation, the bacterium is unable to sporulate and remains trapped in the stationary phase. A consequence of sporulation gene inactivation is the cessation of bacterial multiplication; therefore, the bacteria are non-viable.

[0007] The Inventors have shown that a non-sporulating strain of Bt leads to the formation of bacterial sacs. Surprisingly, they have also shown that, in such non-sporulating strains, the production of proteins of interest can be achieved by placing the gene of interest under the control of a promoter specifically activated during the stationary phase. Thus, the protein of interest is produced during the stationary phase and remains encapsulated within the bacterial sacs. The Inventors have also shown that these proteins are produced in large quantities and that their localization within the bacterial sacs protects them from degradation and greatly facilitates their recovery and purification. According to a particular embodiment, it is also possible to express the proteins of interest in such a way that they anchor to the surface of bacterial cells.

[0008] This new system therefore makes it possible to produce proteins of interest, in particular proteins that are unstable or toxic to the producing bacterial cell, the latter being non-sporulating and non-viable.

[0009] Thus, the present invention relates to a non-spore-forming bacterial strain of the genus Bacillus containing a recombinant plasmid comprising an expression cassette composed of:

[0010] (i) of a highly active promoter in the stationary phase and regulated by a regulator chosen from CodY, AbrB, SinR, PlcR and NprR; and

[0011] (ii) of the sequence of a gene encoding a protein of interest.

[0012] Preferably, the bacterial strain is chosen from among the strains of Bacillus thuringiensis, Bacillus cereus, Bacillus weihenstephanensis, and more preferably it is a strain of Bacillus thuringiensis. The strains of Bacillus subtilis, Bacillus megaterium, Bacillus brevis may also be used provided that they are first transformed to express the papR and plcR genes activating the PpapR and PplcR promoters respectively and / or to express the npnR and nprX genes activating the PnprA promoter.

[0013] Preferably, the bacterial strains used are the Bt kurstaki HD-73 or Bt 407 strains.

[0014] According to the invention, the bacterial strain is a non-sporulating strain. Indeed, non-sporulating strains are advantageous in that they do not exhibit cell lysis; thus, the proteins of interest produced are retained in the producing bacterium and protected from degradation by extracellular proteases.

[0015] In order to suppress the sporulation activity of a strain of the genus Bacillus, it is possible to inactivate any gene essential for sporulation, such as the genes involved in the expression of the transcriptional regulator SpoOA responsible for the initiation of sporulation, or in the expression of the sporulation sigma factors SigE, SigF, SigH, and SigK; preferably, the inactivated gene is SpoOA or SigE. The inactivation of these genes can be achieved by interruption or modification of the coding sequence, or by deletion of all or part of the gene. The deletion is achieved by double crossing-over between adjacent regions located upstream and downstream of the gene, using plasmids whose replication is thermosensitive, for example the pRN5101 plasmids (Lereclus et al., Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Biotechnology (NY) 10: 418-421, 1992) or pMAD (Arnaud et al., New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70: 6887-6891, 2004), and using the protocols described in these articles. Deletion of the spoOA gene (designated AspoGA) has a very early effect, as soon as the bacteria enter the stationary phase, preventing the bacteria from engaging in the sporulation process (Lereclus et al., Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Biotechnology (NY) 13: 67-71, 1995). Deletion of the sigE gene (designated A sigE) has a later effect, blocking the progression of the sporulation process (Bravo et al., Analysis of crylAa expression in sigE and sigK mutants of Bacillus thuringiensis. Mol Gen Genet 250: 734-741, 1996). In both cases, the bacterium no longer multiplies, dies, and contains almost exclusively the protein of interest.

[0016] Preferably, the strain used is Bt kurstaki HD-73 AspoOA or Bt 407 A sigE.

[0017] Recombinant plasmids usable according to the invention classically comprise an origin of replication and at least one selection system consisting of one or more genes allowing the selection of transformed bacteria, for example antibiotic resistance genes.

[0018] Any plasmid, preferably with a high copy number, adapted to the bacterial host used can be implemented.

[0019] The appropriate plasmids according to the invention are plasmids allowing expression in bacteria of the genus Bacillus.

[0020] Preferably, the plasmids used are those exhibiting strong segregational and / or structural stability.

[0021] The concept of segregational stability means that the plasmid is not lost over generations; in other words, it is stably maintained in the bacterial cell and is transmitted to daughter cells. Segregational stability The stability of the pHT1030 plasmid has been demonstrated (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7: 35-46). This stability is due to the presence of the spbA gene, which is also present in plasmids derived from pHT1030, such as pHT3101, pHT304, pHT315, and pHT370 (Arantes et al., 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108: 115-119). The segregational stability of the pBC16 plasmid and its derivatives has also been determined (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7: 35-46).

[0022] Structural stability is defined as the absence of intramolecular recombination of the plasmid. The structural stability of the pHT1030 plasmid and its derivatives is demonstrated by the fact that they can carry large exogenous DNA fragments (> 10 kb) without undergoing molecular rearrangements (Lereclus et al., 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 60: 211-217).

[0023] Preferably, these are high-copy-count plasmids, in particular those derived from the pHT1030 plasmid, such as pH3101, pHT304, pHT315 and pHT370, preferably pH315, or derived from the pBC16, pE194 or pC194 plasmids, or low-copy-count plasmids such as pHT73, the resident plasmid of the Bt kurstaki HD-73 strain, or pBMB299, the resident plasmid of the Bt kurstaki HDL strain.

[0024] According to the invention, the expression cassette inserted into said plasmid contains at least one strong promoter and the sequence of a gene encoding a protein of interest.

[0025] A strong promoter is a promoter that allows strong transcription of the gene(s) it controls. The strong promoter may originate from the host cell used for the expression of the protein of interest; it may also be an exogenous promoter. Strong promoters are preferentially those activated at the beginning of the stationary phase and that remain functional for a large part of this physiological state.

[0026] According to a first embodiment of the invention, the strong promoter is regulated by a regulator chosen from PlcR and NprR. The strong promoters are preferably chosen from PpapR (SEQ. ID. No. 1), Pp IcB (SEQ. ID. No. 2), PnprA (SEQ. ID. No. 3) and PnprR (SEQ. ID. No. 4).

[0027] According to a second embodiment of the invention, the strong promoter is regulated by a regulator chosen from CodY, AbrB and SinR and even more preferably the strong promoter is chosen from PoppA (SEQ. ID. No. 5), PnppC (SEQ. ID. No. 6), P inh Al (SEQ. ID. No. 7) and PcalX (SEQ. ID. No. 8).

[0028] Preferably, the regulator is CodY and the strong promoter is PoppA or PnppC.

[0029] The expression cassette according to the invention may further comprise:

[0030] - an mRNA stabilizing sequence positioned downstream of the promoter and in upstream of the gene sequence encoding the heterologous protein; preferably, this is STAB-SD with SEQ ID sequence No. 9; preferably, the STAB-SD sequence is downstream of the +1 transcription point and at a position between approximately 100 and 500 nucleotides upstream of the ribosome binding site (RBS), preferably between 100 and 300 nucleotides and more preferably between 100 and 150 nucleotides; and / or

[0031] - a terminating sequence of the crylAc gene, designated TcrylAc, for example of sequence showing at least 90% identity with SEQ ID No. 10, preferably it is SEQ ID No. 10; this sequence is cloned downstream of the gene encoding the protein of interest.

[0032] The choice of these sequences should not, however, be considered limiting since it is within the reach of a person skilled in the art to substitute these sequences with sequences having equivalent functions.

[0033] The term "protein of interest" refers to an endogenous protein or a protein that is not naturally expressed by the bacterial strain according to the invention, also referred to as a heterologous protein. Preferably, the protein of interest is a cytotoxic protein naturally expressed by a strain of the genus Bacillus or a protein of industrial interest such as enzymes, such as proteases, lipases, amylases; hormones; antigens, for example, usable as immunogens, peptides, or proteins for therapeutic use; the protein of interest can thus find applications in the fields of crop protection, vector control, commercial enzyme production, and the pharmaceutical industry, particularly for vaccine production.

[0034] The expression cassette according to the invention leads to the expression and subsequent accumulation of proteins of interest in bacterial sacs or to their anchoring to the surface of the bacterium. Its use is particularly suitable for the production of proteins that are unstable or toxic to the producing strain.

[0035] The construction of the expression cassette according to the invention and its incorporation into a plasmid are carried out by molecular biology techniques well known to those skilled in the art, as illustrated in the experimental part.

[0036] The plasmid according to the invention can be introduced into the host bacterium using techniques known to those skilled in the art; in particular, the transformation of the host bacterium can be carried out by electroporation (Lereclus et al., 1989) or by heterogram conjugation (Tieu-Cuot et al., 1987). The expression cassette containing the gene of interest can also be introduced onto the bacterial chromosome or onto a resident plasmid by homologous recombination (Lereclus et al., 1992).

[0037] The present invention also relates to a method for producing a protein of interest comprising the steps of:

[0038] a- preparation of the bacterial strain according to the invention;

[0039] b- culture of said bacterial strain in stationary phase; and

[0040] c- Optionally, purification of said protein of interest.

[0041] The bacterial strain is cultured on a culture medium containing at least one source of nitrogen and glucose at appropriate concentrations at a temperature preferably between 25 and 35°C, preferably the temperature is around 30°C; for example, the culture medium is LB medium.

[0042] The purification of the protein of interest can be carried out by centrifugation; in addition, methods of exclusion chromatography, ion exchange chromatography or affinity chromatography can be implemented.

[0043] According to a particular embodiment, a gene encoding an export protein domain (such as a signal peptide) or an anchoring domain (such as LysM (SEQ ID No. 11), SLH (SEQ ID No. 12) or LPXTG (Navarre et al., Microbiol Mol Biol Rev 63(1):174-229.DOI: 10.1128, 1999)) of proteins on the surface of bacteria is cloned in cis of the gene encoding the protein of interest.

[0044] Thus, the expression cassette according to the invention may comprise:

[0045] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;

[0046] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0047] (iii) the sequence of a gene encoding a protein of interest;

[0048] and optionally an mRNA stabilizing sequence, preferably STAB-SD, and / or the crylAc gene terminator sequence, TcrylAc;

[0049] or

[0050] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;

[0051] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0052] (iii) the sequence of a gene encoding a protein of interest;

[0053] and an mRNA stabilizing sequence, preferably STAB-SD;

[0054] or

[0055] (i) a strongly active promoter in the stationary phase selected from PpapR, PplcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;

[0056] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0057] (iii) the sequence of a gene encoding a protein of interest;

[0058] and the terminating sequence of the crylAc gene, TcrylAc;

[0059] or even

[0060] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferably chosen from PoppA and PnppC;

[0061] (ii) optionally the sequence of a gene encoding an export or anchoring protein;

[0062] (iii) the sequence of a gene encoding a protein of interest;

[0063] and an mRNA stabilizing sequence, preferably STAB-SD, and the sequence terminator of the crylAc gene, TcrylAc.

[0064] According to particular embodiments, the strain used is a bacterium of the genus Bacillus AspoOA, preferably Bt AspoOA, more preferably Bt HD73 AspoOA, and the expression cassette comprises:

[0065] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;

[0066] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0067] (iii) the sequence of a gene encoding a protein of interest;

[0068] and optionally an mRNA stabilizing sequence, preferably STAB-SD, and / or the crylAc gene terminator sequence, TcrylAc;

[0069] or

[0070] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;

[0071] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0072] (iii) the sequence of a gene encoding a protein of interest;

[0073] and an mRNA stabilizing sequence, preferably STAB-SD;

[0074] or

[0075] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;

[0076] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0077] (iii) the sequence of a gene encoding a protein of interest;

[0078] and the terminator sequence of the crylAc gene, TcrylAc;

[0079] or even

[0080] (i) a highly active promoter in the stationary phase selected from PpapR, PplcB, PoppA, PnprR, PnppC and PnprA and preferentially chosen from PoppA and PnppC;

[0081] (ii) optionally the sequence of a gene encoding an export or anchoring protein;

[0082] (iii) the sequence of a gene encoding a protein of interest;

[0083] and an mRNA stabilizing sequence, preferably STAB-SD, and the sequence terminator of the crylAc gene, TcrylAc.

[0084] According to other particular embodiments, the strain used is a bacterium of the genus Bacillus A sigE, preferably Bt A sigE, more preferably Bt 407 A sigE, and the expression cassette comprises:

[0085] (i) a strongly active promoter in the stationary phase selected from PcalY and PinhAl;

[0086] (ii) optionally, the sequence of a gene encoding an export or anchoring protein;

[0087] (iii) the sequence of a gene encoding a protein of interest;

[0088] and optionally an mRNA stabilizing sequence, preferably STAB-SD, and / or the crylAc gene terminator sequence, TcrylAc;

[0089] or

[0090] (i) a strong active promoter in the stationary phase selected from Pcal Y and PinhAl;

[0091] (ii) optionally, the sequence of a gene encoding an export protein or anchoring;

[0092] (iii) the sequence of a gene encoding a protein of interest, preferably STAB-SD;

[0093] and an mRNA stabilizing sequence;

[0094] or

[0095] (i) a strong active promoter in the stationary phase selected from Pcal Y and PinhAl;

[0096] (ii) optionally, the sequence of a gene encoding an export protein or anchoring;

[0097] (iii) the sequence of a gene encoding a protein of interest;

[0098] and the terminator sequence of the crylAc gene, TcrylAc;

[0099] or even

[0100] (i) a strongly active promoter in the stationary phase selected from Pcal Y and PinhAl;

[0101] (ii) optionally the sequence of a gene encoding an export protein or anchoring;

[0102] (iii) the sequence of a gene encoding a protein of interest;

[0103] and an mRNA stabilizing sequence, preferably STAB-SD, and the sequence terminator of the crylAc gene, TcrylAc.

[0104] According to a particular embodiment, the protein of interest produced is an insecticidal protein from B. thuringiensis.

[0105] It is known that such proteins can be used as biopesticides in preparations conventionally containing the free insecticidal protein in crystal form and bacterial spores, to control crop pests as well as disease vectors such as mosquitoes. In particular, these may be proteins of the Cry family (crystal proteins), or proteins of the Cyt family (cytolytic insecticidal toxins), or Vip3 proteins (toxins active against lepidopteran insects), and more preferably proteins of the Cry family.

[0106] After their expression, they are protected from degradation by the bacterial membrane which constitutes the envelope of the bacterial sac. In addition, the non-sporulation of the bacteria gives the invention the advantage of not disseminating spores in the environment.

[0107] According to another embodiment, the protein of interest produced may be an enzyme of industrial (proteases, lipases, amylases, etc.) or medical interest. Encapsulating this protein in the bacterial sac facilitates its recovery and purification, and therefore reduces production costs.

[0108] According to a third embodiment, the protein of interest produced can be an entire protein or a protein fragment that can serve as an antigen, for example proteins from microorganisms (viruses, bacteria, fungi) or parasites.

[0109] In this embodiment, it may be advantageous for the protein or its fragment to be anchored to the surface of the bacterial sac. This embodiment is of significant interest for the preparation of vaccines.

[0110] Thus, the present invention proposes a bacterial platform that can be advantageously used for the production of proteins of interest to multiple fields such as crop protection, vector control, commercial enzyme production, and the pharmaceutical industry. Furthermore, this technology has a low cost and excellent yield, enabling mass production. FIGURES

[0111] [Fig. 1] A, strain HD73 wt; B, strain HD73 AspoOA.

[0112] [Fig.2] strain 407 AsigE

[0113] [Fig.3] Measurement of B-galactosidase activity in HD73 wt bacteria carrying the transcriptional fusion PpZcB-STAB-SD-ZacZ (black curve) or the transcriptional fusion PplcB-lacZ (grey curve).

[0114] [Fig.4] Measurement of B-galactosidase activity in HD73 AspoOA bacteria carrying the transcriptional fusion PpapR-SAAB-SD-lacZ (grey curve) or the transcriptional fusion PoppA-ST AB-SD-lacZ (black curve).

[0115] [Fig.5] Measurement of B-galactosidase activity in 407 AsigE bacteria carrying the transcriptional fusion PcaZT-STAB-SD-ZacZ-TermCrylAc (black curve) or the transcriptional fusion PcalY-SAAB-SD-ZacZ (grey curve).

[0116] [Fig.6] Measurement of fluorescence at different culture times, in HD73 wt (grey) and HD73 AspoOA (black) bacteria carrying the transcriptional fusion PpapR-STAB-SD-g / p-TermCrylAc.

[0117] [Fig.7] Production of toxins of interest under the control of PoppA promoters and PpapR associated with the stabilizing elements STAB-SD and TermCrylAc. Microscopic observation of an HD73 AspoOA strain transformed with a plasmid carrying the transcriptional fusions PoppA-STAB-SD-toxZ-TermCrylAc and PpapR-STAB-SD-tox2-TermCrylAc (A) or of an HD73 AspoOA strain not containing the plasmid described above (B). SDS-PGE of the strain producing the toxins of interest (C). M, molecular weight marker. EXAMPLES

[0118] 1. Effect of creating a non-sporulating phenotype on the formation of sacs bacterial

[0119] The asporulant strains correspond to the Bt HD73 wt strain in which the spoOA gene has been deleted (Bt HD73 AspoOA) or to the Bt 407 wt strain in which the sigE gene has been deleted (Bt 407 AsigE). For both of these strains, the spoOA and sigE genes were deleted by double crossing over using the pMAD plasmid and the protocol described by Arnaud et al. (Arnaud et al., 2004).

[0120] The culture corresponding to the Bt HD73 wt strain consists almost exclusively of spores (Figure IA). In contrast, no spores are visible in the case of the Bt HD73 AspoOA mutant (Figure IB).

[0121] The Bt HD73 AspoOA mutant shows the formation of bacterial sacs (light gray in Figure 1B). Similarly, unlike the Bt 407 wt strain, the Bt 407 AsigE strain does not form any spores and is composed of bacterial sacs ([Fig. 2]). The Bt HD73 wt and AspoOA strains were cultured in HCT YEG liquid medium at 30°C for 72 h before being examined under a microscope. This medium is composed of HCT medium (0.7% casein hydrolysate, 0.5% tryptone, 0.68% KH2PO4, 0.012% MgSO4 7H2O, 0.00022% MnSO4 4H2O, 0.0014% ZnSO4 7H2O, 0.008% ferric ammonium citrate, 0.018% CaC12 4H2O at pH 7.2) supplemented with 0.3% glucose and 0.05% yeast extract.

[0122] The Bt 407 A sigE strain was cultured in HCT YEG liquid medium at room temperature for 96h before being examined under a microscope.

[0123] 2, Effect of the STAB-SD stabilizing sequence on the promoter activity of a gene stationary phase

[0124] The inventors added the STAB-SD RNA stabilizing sequence between the PplcB promoter and the lacZ reporter gene to the pHT304-18Z-PplcB plasmid to generate the pHT304-18-PplcB-STAB-SD-lacZ plasmid. The STAB-SD RNA stabilizing sequence was first cloned between the Xbal and BamHI restriction sites of the pHT304-18 vector. Then, the PplcB promoter was cloned upstream between the PstI and Xbal restriction sites.

[0125] The Bt HD73 wt strain was transformed with the plasmids pHT304-18Z-PplcB and pHT304-18-PplcB-STAB-SD-lacZ and then cultured in LB medium at 30°C.

[0126] LB (Luria Bertani) culture medium is a complex medium classically used for culturing bacterial strains. It is composed of tryptone, 10 g / L; yeast extract, 5 g / L; and NaCl, 10 g / L. The components are dissolved in 800 mL of demineralized water, the pH is then adjusted to 7.0, and the volume is brought up to 1 L. The medium is sterilized by autoclaving at 121°C for 15 minutes.

[0127] tO corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0128] Thus, the activity of PplcB, an active promoter in the stationary phase, was compared in the presence and absence of STAB-SD.

[0129] The results of [Fig.3] show that the PplcB promoter is active in both vector constructs: in the presence and absence of STAB-SD. The presence of STAB-SD increases the expression of [3-galactosidase.

[0130] 3. Stationary phase promoter activity in the A spoOA mutant

[0131] DNA fragments corresponding to the promoter sequences of stationary-phase expressed genes PoppA or PpapR followed by the STAB-SD sequence were synthesized and cloned into the pHT315 vector. The lacZ reporter gene was cloned downstream of these sequences. The vectors were introduced into Bt HD73 AspoOA cells.

[0132] tO corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0133] The bacterial strains were cultured in HCT YEG medium at 30°C.

[0134] The B-galactosidase activity of these strains was measured during their growth and shows a strong activity of these promoters at the times indicated on [Fig.4], and a greater activity for the PoppA promoter from t0.

[0135] 4, Effect of the stabilizing sequence TermCrylAc on the expression of a phase gene stationary

[0136] The sequence corresponding to the terminator of the crylAc gene was cloned downstream of the transcriptional fusion between the promoter of a gene expressed in stationary phase (PcalY) and the reporter gene lacZ on the plasmid pHT304.18Z to generate the plasmid pPcalY-STAB-SD-ZacZ-TermCry 1 Ac. This vector was introduced into Bt 407 AsigE cells.

[0137] tO corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0138] The bacterial strains were cultured in LB medium at 30°C.

[0139] The B-galactosidase activity of this strain was measured and compared to that from a strain carrying the same vector except for the TermCrylAc sequence. The results show that both plasmids allow the expression of B-galactosidase, the fusion carrying the TermCrylAc sequence leads to a stronger expression than the one not carrying it ([Fig.5]).

[0140] 5. Effect of the association of genetic elements on the expression of a reporter gene

[0141] The Bt HD73 wt and Bt HD73 AspoOA strains were transformed with the pHT315 plasmid carrying the PpapR-STAB-SD-g / p-TermCry 1 Ac transcriptional fusion in order to measure the activity of this transcriptional fusion in the AspoOA genetic context and to compare it to the activity of the wt strain ([Fig.6]).

[0142] The plasmid was constructed as follows. The DNA fragment corresponding to the PpapR promoter sequence followed by the STAB-SD and TermCrylAC sequences was synthesized and cloned into the pHT315 vector. The gfp reporter gene was cloned downstream of this sequence.

[0143] tO corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0144] The bacterial strains were cultured in HCT YEG medium at 30°C.

[0145] The results show that the association of the different genetic elements (plasmid, PpapR promoter, STAB-SD sequence, and TermCrylAc sequence) is functional in the HD73 AspoOA strain. Furthermore, the measurement of fluorescence produced by the HD73 AspoOA and HD73 wt strains shows that the expression of the gfp gene is stronger in the AspoOA genetic context than in the wild-type context.

[0146] 6. Effect of the association of genetic elements on protein production insecticides

[0147] An HD73 AspoOA strain was transformed with a plasmid carrying the PoppA-STAB-SD-cry7AZ-TermCrylAc and PpapR-STAB-SD-m7Ca-TcrmCry I Ac transcriptional fusions. The production of the toxins of interest CrylAb and CrylCa, corresponding to the crylAb and crylCa genes, respectively, was verified by phase-contrast microscopy and by SDS-PPE ([Fig. 7]). The bacteria were cultured in PEP YEGx medium at 30°C and harvested 48 h post-inoculation. This medium is composed of 0.7% casein hydrolysate, 0.5% peptone, 0.68% KH2PO4, 0.012% MgSO4 7H2O, 0.00022% MnSO4 4H2O, 0.0014% ZnSO4 7H2O, 0.008% ferric ammonium citrate, 0.018% CaC12 4H2O, at pH 7.2 supplemented with 0.3% glucidex and 0.05% yeast extract.

[0148] The results show the production of toxins in crystal form in HD73 AspoOA bacterial sacs bearing Pop / M-STAB-SD-crvMATcnnCr^^ 1 Ac and PpapR-STAB-SD-cry7Ca-TermCrylAc ([Fig. 7] A), while an HD73 AspoOA strain lacking the plasmid described above exhibits bacterial sacs without crystals ([Fig. 7] B). Furthermore, SDS-PPE shows that the toxins of interest constitute the majority of the proteins in the bacterial sacs ([Fig. 7] C). SEQUENCES

[0149] SEQ ID No. 1 - PpapR Promoter region of the papR gene from Bacillus thuringiensis CTAGAAtXATGAÀTrAAAAGAAWACTTATAAAAAAAATGAAGAAATAA AAAAGACATAAAGAACAAATATGCATAATTGCATAAAGTCTGGATAATTTT TCATGAÏM^

[0150] SEQ ID No. 2 - PplcB Promoter region of the plcB gene from Bacillus thuringiensis AGCATGTGTAlWTrTAaXnTrr^^ AATAG'rnATTAÀAATGA.AUnr / ^™ AGinATAAlXlATATGAACATrîGCATATniAAr™ KkAAAGGTGGGATATK2AGW:ATAGGTTAA(XGGACGACATCATAGGATC CTÀACAAAATGTH'ACAATAÀTTCAATrÀTAAAATGGAGG

[0151] SEQ ID n°3 - PnprA Promoter region of Bacillus thuringiensis nprA gene TrrTTTCAATATTFOTOT^^^ ATTGAATTT'rrAGTATATTATAGTGGAAACATAATŒTAATATGAAACTA CîCTrTi'TCAAAAAAAiTm'ATlAGGGGGAAGGrTÇAlG

[0152] SEQ ID No. 4 - PnprR Promoter region of Bacillus thuringiensis nprR gene GAAGrGAAGTCAAGAGAGAAAAAATOAAATTTŒATATTrnTAGA.A. AATTTATATrTATCAATTOTATræTCCGAATm^ ATG GG GTA ATGAG AATGG A GG

[0153] SEQ ID No. 5 - PoppA Promoter region of Bacillus thuringiensis oppA gene CTAGACCGTCAAAATATrACTA.GAATTATTATACTATAAAÀGCTATAATÀ. AGTAGTAGATTAATTTtrGAAAATTAGGCAATTAAAGGTCTGArrTrA AGATGATGGTAGCAATGTTAATGTATCCCTI'TACGAAAAATTTAAAATAATA AATATÏlTATTTAAAAATTrrAACAAAAAAACAAAACrA'ÎÀTFCAATT GTT <mAATr<mGMACTrGGACM™ ATæXACTTTTFAACAAGTOAGGGTACAGGAAGW^AArFAGGGGAG

[0154] SEQ ID No. 6 - PnppC The promoter region of the nppC gene of Bacillus thuringiensis. ATTOACTTmTATAAAAAAGATrrrmAATAT^^ WEATHERGrAAnWORKAAll WEATHERWEATHERTTAGgiGT TnGAGAAAAGATGGAGGATAGCCATG

[0155] SEQ ID No. 7 - PinhAl The promoter region of the inhAI gene of Bacillus thuringiensis. AATTGTG ATAT AT O «J \TGCTAACTATGAAATmTAÇAAATATTAAA AATATTACAT <MTAÏuAvrAAATATrGAAAAAATATO / UTTrrTÀATAAÀ ATTCAArrrcn’AATACATATTATrFAlTACKKK^^

[0156] SEQ ID No. 8 - PcalY The promoter region of the calY gene of Bacillus thuringiensis. AAGCAAGACTAGTAATANTA'IACGAGTOTCAGGGAACGTFAGCCCTCAC CFCnT<'rn'mCnTnTClTATACnAn\AAATGATnXlAGTGTGAAAAAA ROADAAATFATCATlXiTOTrrTCTGAAAAClTC'rAAATGATATrGAGAAT AAAAATAACTGAAAATAI'TAAEAAAATCTGTOTClTrATATAGGTFGT TGGTTATATGACATAAGGTrrrTAAAAAGAACATTAATTAAGTAAGTAAGTA AATATACrnTrCTHAGATCTCTÎATCAAAAATAGTGATAAAATAO AAAAAAGCFAGGGGGATTGATr

[0157] The + 1 of transcription is indicated in bold. The -10 boxes of the promoters are highlighted with a thin line. The -35 boxes are highlighted with 2 dashes. The DNA sequence recognized by PlcR (PlcR box) from the PpapR and PplcB promoters is highlighted with a bold line.

[0158] SEQ ID N°9 - STAB-SD Bacillus thuringiensis gaaaggaggg atgcc

[0159] SEQ ID N°10 - TcrylAc - Bacillus thuringiensis àaactcaggt ttaaafâtcg KUeaaaïc aattgtecaa gagpagcatt açaasiagat ügLuigaj ajjcggaçai çacctccatt gaaacggagî gatgtccgtt «æ-Mgii atntuags auta-. ahng iatagagcaa cttaaicaag eagàgmu ttcacctatc gaigaaa.na ku igm ttctmtit ai

[0160] SEQ ID N°11 Sequence containing 2 LysM domains as described by Shao et al., 2009, Microb Cell Fact 8, 48. doi:10.1186 / 1475-2859-8-48. ATGATTCAAA'n'GTAACGGFTCGTAGCGGTGAFAGCGTATATAGCTTGGC AIGAAAATATGGATCAACACCiGACGAAATAGTAAAAGACAArGGACTAA ATCGCGCTGAAACGCTCGITGTTŒTGAGGCAOTATCGTrAArACGAAAG GAAATAAITArrATGTACAGCCTGGTGACAGGGTCTÀTCGGATrrCTCAÀA CATAAEGTœCCC'æGGTAaFrrAGCTAAAGTAATAATTFATCTnAAA ATCTATOnïXÀ.TOTŒGACAA€^

[0161] SEQ ID N° 12 : Sequence containing 3 SLH domains as described by Fedhila et al., 2006, Mol. Microbiol. 62: 339-355. doi: 10.1111 / j.l365-2958.2006.05362.x. GAAGAIGAGAAAACAGAAGTGGTAGAAÎTTAAAGATGTaCO\AAGGGAC ATFGGTC AGA AGAAGC AATTA ATI' AOTAGCGAAAGA À AA AT 1 NTTFATAG G <n>\TGGAAATGGTOAATTTGGATTFGGTOATAACA™^ TAGCACTrcTAAiÀCAAAGATATi'TAAAATEAGAAAATAATCTAGAACAAA AAACGGCATTTACAGA^FACGAAAGGAAATATGTATGAAACGGCTATTGAT œAGTGGTrCAAGCTGGAATrATGACAGGCTATGGAAATGGTÀTGTrÇCGT CCGFMTGGAGTÀTfAACTaMIATGAAATGTCAGTAGTACTACAAÀGAGTA TTTCAGTTAAAAGAAAATGAAAATAGTGCAGAGAATrTTAAAGATGTACC aaa;iggcçattgggcgaaaggatatctgaaagctti>gtggataataaaa TArcAAAAGGCGACGGGGAAGGGAATTTTTFAGGAGATAATÎTCGTAACA œKUACAATACGCACAG'TTrTTGTATAATGCAATAAAGAAA< / n>

Claims

Demands

1. Non-spore-forming bacterial strain selected from the strains of Bacillus thuringiensis, Bacillus cereus, Bacillus weihenstephanensis, Bacillus subtilis, Bacillus megaterium and Bacillus brevis containing a recombinant plasmid comprising an expression cassette composed of: (i) a strong promoter selected from PoppA (SEQ. ID. No. 5), PnppC (SEQ. ID. No. 6), PinhAl (SEQ. ID. No. 7), PcalY (SEQ. ID. No. 8), PpapR (SEQ. ID. No. 1), PplcB (SEQ. ID. No. 2), PnprR (SEQ. ID. No. 4) and PnprA (SEQ. ID. No. 3) and regulated by a regulator selected from CodY, AbrB, SinR, PlcR and NprR; (ii) of the sequence of a gene encoding a protein of interest.

2. 2. Bacterial strain according to claim 1, characterized in that the sporulation gene selected from spoOA and sigE is inactivated by interruption or modification of the sequence or by deletion of all or part of the gene.

3. 3. Bacterial strain according to any one of claims 1 to 2, characterized in that: (i) said strain is mutated in the spoOA gene; and (ii) said strong promoter is selected from PpapR, PnprA, PnprR, PplcB, PoppA and PnppC.

4. 4. Bacterial strain according to any one of claims 1 to 3, characterized in that: (i) said strain is mutated in the sigE gene; and (ii) said strong promoter is selected from PinhAl and PcaN.

5. 5. Bacterial strain according to any one of claims 1 to 4, characterized in that said expression cassette further comprises an mRNA stabilizing sequence and / or a crylAc gene terminating sequence (SEQ. ID. No. 10).

6. 6. Bacterial strain according to claim 5, characterized in that the stabilizing sequence of the mRNA is the sequence STAB-SD (SEQ. ID. No. 9).

7. 7. Bacterial strain according to claims 1 to 6, characterized in that said plasmid is a plasmid selected from pHT304, pHT315 and pHT370, pHT73, pBC16, pE194, pC194 and pBM299.

8. 8. Bacterial strain according to any one of claims 1 to 7, characterized in that said expression cassette comprises in in addition to sequences coding for a protein anchoring or export sequence.

9. 9. Bacterial strain according to claim 1, characterized in that it is a strain of Bacillus thuringiensis.

10. 10. A method for producing a protein of interest comprising the steps of: a- preparing the bacterial strain according to any one of claims 1 to 9; b- culturing said bacterial strain in stationary phase; and c- optionally, purifying said protein of interest.

Images