Non-human primate Alzheimer's disease model animal and method for producing same

Abstract

Provided is an animal model that can reproduce the pathological conditions of human AD. A region associated with the splicing of exon 9 of the PSEN1 gene is deleted in the non-human primate Alzheimer's disease model.

Description

[Technical field]

[0001] The present invention relates to a non-human primate Alzheimer's disease model animal and a method for producing the same. [Background technology]

[0002] Alzheimer's disease (AD) is the main cause of dementia, and the number of patients worldwide is said to reach 50 million, but effective preventive and treatment methods have not been established, and one of the reasons for this is the lack of a useful animal model. Although several mouse models have been established, many aspects of the pathology of human AD cannot be reflected due to biological differences between mouse and primate animals. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Sasaguri H. et al. APP mouse models for Alzheimer's disease preclinical studies. EMBO J 1;36(17):2473-2487, doi: 10.15252 / embj.201797397 (2017). [Non-Patent Document 2] Saito T. et al. Single App knock-in mouse models of Alzheimer's disease. Nat Neurosci. 17(5):661-663. doi:10.1038 / nn.3697 (2014). [Non-Patent Document 3] Oakley H et al. Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation. J Neurosci. 26(40):10129-10140. doi:10.1523 / JNEUROSCI.1202-06. (2006). Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide the world's first non-human primate AD model. [Means for solving the problem]

[0005] The inventors have conducted various studies to solve the above problems, and have found that mutant PSEN1 marmoset individuals obtained by partially or completely deleting the 3'-splice site (3' splice site, acceptor site) of exon 9 of the presenilin 1 (PSEN1) gene using Transcription Activator-Like Effector Nuclease (TALEN) in marmoset embryos and individuals reproduce the pathological pattern seen in human AD patients, thereby completing the present invention. That is, the present invention is as follows.

[0006] [1] A non-human primate model of Alzheimer's disease that includes at least the 5' or 3' splice site of exon 9 of the PSEN1 gene and is missing a site related to the splice of exon 9.

[0007] [2] The primate described in [1], wherein the non-human primate is a marmoset.

[0008] [3] A method for producing an Alzheimer's disease model non-human primate, comprising a step of deleting a site that includes at least the 5' or 3' splice site of exon 9 of the PSEN1 gene and is related to the splice of the exon 9 using genome editing technology.

[0009] [4] The method described in [3], characterized in that it comprises deleting a site in an egg that includes at least the 5' or 3' splice site of exon 9 of the PSEN1 gene and is related to the splice of said exon 9.

[0010] [5] The method according to [3] or [4], wherein the non-human primate is a marmoset.

[0011] In another aspect, the present invention is as follows.

[0012] [6] A non-human primate model of Alzheimer's disease that lacks the acceptor site in exon 9 of the PSEN1 gene.

[0013] [7] The primate described in [6], wherein the non-human primate is a marmoset.

[0014] [8] A method for producing a non-human primate model of Alzheimer's disease, comprising a step of deleting the acceptor site of exon 9 of the PSEN1 gene using genome editing technology.

[0015] [9] The method described in [8], characterized in that the acceptor site of exon 9 of the PSEN1 gene is deleted in an egg. Effect of the Invention

[0016] According to one embodiment of the present invention, the pathology of human AD can be reproduced. [Brief description of the drawings]

[0017] [Figure 1]FIG. 1 is a schematic diagram conceptually showing an example of a highly active TALEN (Platinum TALEN) that targets the 3'-splice site of exon 9 of a marmoset that can be used in the present invention. In the figure, the area surrounded by a square frame is the TALEN target site and an exon of the PSEN1 gene of a marmoset, and the numbers indicate the exon numbers. The 3'-splice site ("AG") of exon 9 is located upstream of exon 9. [Diagram 2] Figure 2(a) shows the results of a surveyor assay of marmoset fertilized eggs after TALEN injection performed in the examples (PC in the three columns on the left and the column on the right indicates positive control, and NC indicates negative control), Figure 2(b) is a schematic diagram showing an outline of TALEN injection and subsequent PSEN1 mRNA analysis performed in the examples, and Figure 2(c) shows the results of RT-PCR of fertilized eggs after TALEN injection performed in the examples. [Diagram 3] Figure 3(a) is a photograph of a newborn marmoset AD model according to the present invention obtained in the Examples, Figure 3(b) shows the results of a surveyor assay performed on genomic DNA extracted from the umbilical cord blood of the newborn, and Figure 3(c) shows the results of PCR performed on RNA extracted from hair roots of the newborn and a wild-type marmoset. [Figure 4] FIG. 4 shows the results of measuring the amounts of two types of amyloid β proteins in fibroblasts collected from the ear tissue of a mutant marmoset (8 months old) obtained in the Example. [Diagram 5] Figure 5(a) is a photograph of a newborn marmoset AD model of the present invention obtained in Example 4, Figure 5(b) shows the results of a Surveyor assay performed on genomic DNA extracted from the umbilical cord blood of the newborn, and Figure 5(c) shows the sequences around the 3'-splice site of exon 9 in the wild-type and mutant newborn genomes. [Figure 6]Panel a of FIG. 6 shows the results of Western blot analysis of fibroblast lysates using antibodies against the PS1 protein (left: N-terminal fragment (PS1 NTF), right: C-terminal fragment (PS1 CTF), and panel b of FIG. 6 shows the results of measuring the amounts of two types of amyloid β proteins in fibroblasts collected from the ear tissue of the mutant marmoset (8 months old) obtained in the example. Both fibroblasts were collected from the ear tissue of the mutant marmoset (8 months old) obtained in Example 4. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] The present invention relates to a non-human primate AD model. The non-human primate is not particularly limited as long as it is a primate that can be affected by Alzheimer's disease. For example, the primate includes, but is not limited to, stenorhines (lemurs, lorises, galagos, etc.) and stracathorhines (tarsiers, spider monkeys, capuchin monkeys, marmosets, long-tailed monkeys, colobus monkeys, apes, etc.). In a preferred embodiment, the non-human primate is a long-tailed monkey (rhesus monkey, cynomolgus monkey, etc.) or a marmoset (common marmoset, black-eared marmoset, etc.). The marmoset AD model of this embodiment is suitable for AD research. The reasons for this include their genetic background and brain structure being similar to humans, their human-like cognitive behaviors related to the prefrontal cortex, their ability to communicate visually and auditorily, their small body size (e.g., 350-500g), their relatively short gestation period (145 days), their ability to reproduce effectively (40 to 80 newborns per female), and their relatively long life span (10-13 years in captivity). In addition, accumulation of amyloid beta protein is observed with aging starting from around the 7th age, and the sequence of amyloid beta protein is identical to that of humans.

[0019] The marmoset AD model according to the present invention is characterized in that the splice site of exon 9 of the PSEN1 gene is disrupted. The disruption may be performed using a genome editing technique known per se, for example, using the CRISPR-Cas9 system or TALEN (Transcription Activator-Like Effector Nuclease). In one embodiment, it is preferable to use a highly active TALEN (Platinum TALEN). It has been reported that a deletion mutation including exon 9 or a point mutation at the splice site of exon 9 of the PSEN1 gene causes the elimination of exon 9 of mRNA by selective splicing, but the present inventors are the first to have succeeded in creating a non-human primate AD model by actually disrupting the site.

[0020] FIG. 1 conceptually shows a highly active TALEN (Platinum TALEN) that targets the 3'-splice site of exon 9 of the marmoset PSEN1 gene. In the figure, TALEN_AS_L shown on the left and TALEN_AS_R shown on the right can each be constructed by a method known per se, for example, using the Platinum Gate TALEN kit. TALEN_AS_L and TALEN_AS_R are TALEN target sites, the sequences enclosed in boxes are exons of the marmoset PSEN1 gene, and the bold "AG" adjacent to the upstream of exon 9 is the 3'-splice site of exon 9. The 5'-splice site is "GT" (not shown) adjacent to the downstream of exon 9.

[0021] In a preferred embodiment, as shown in FIG. 1, the term "3'-splice site of exon 9 of PSEN1 gene" refers to two nucleotides present at the 3' end of intron 8 due to the splicing of exon 8 and exon 9. "Defective 3'-splice site of exon 9 of PSEN1 gene" means functional deficiency of said 3'-splice site. The deficiency is caused by deletion of one or both of said two nucleotides (only nucleotide A, only nucleotide G, or both nucleotides AG) (see FIGS. 2 and 3). In this embodiment, "deletion of a site (related to the splicing of exon 9) including at least the 3'-splice site of exon 9 of PSEN1 gene" is necessarily caused by said deletion.

[0022] The deletions are a partial deletion of the 3' end of intron 8 (including the nucleotides AG) and the 5' end of exon 9; a partial deletion of the 3' end of intron 8 (including the nucleotides AG or A); and a partial deletion of nucleotide G or nucleotide AG and the 5' end of exon 9. The total length of the deletion resulting in the deletion is arbitrary, as long as the deletion includes one or both of the two nucleotides and does not affect the splicing of exons other than exon 9.

[0023] In another embodiment other than the preferred embodiment shown in Figure 1, the deletion may be caused by a deletion of the 5'-splice site of exon 9 of the PSEN1 gene. The meaning of the deletion in this other embodiment can be understood by replacing the following points in the description of the immediately preceding two paragraphs: 1. Replace "3'-splice site" with "5'-splice site". 2. Replace "exon 8 and exon 9" with "exon 9 and exon 10". 3. Replace "3' end of intron 8" with "5' end of intron 9." 4. Replace "5' end of exon 9" with "3' end of exon 9". 5. Replace "nucleotide A" with "nucleotide G," "nucleotide G" with "nucleotide T," and "nucleotides AG" with "nucleotides GT."

[0024] In an embodiment different from the above two embodiments, the "deletion of a site including at least the 5'-splice site or the 3'-splice site of exon 9 of the PSEN1 gene (related to the splicing of the exon 9)" can be caused by the deletion of a branch site present in an intron. The intron can be intron 8, intron 9, or both introns 8 and 9 of the PSEN1 gene. The branch site is often located near the 3' end within the intron, and is known to be followed downstream by a polypyrimidine base region (Py repeats). In one aspect of the present invention, the branch site can be a site including nucleotide A located 20 to 40 nucleotides (said to be 21 to 34 nucleotides) upstream of the 3'-splice site. The deletion of the branch site refers to the deletion of at least the nucleotide A.

[0025] In addition, the genome of the marmoset AD model according to the present invention may simultaneously have the three different deletions described above, or any two of the three deletions may simultaneously be present.

[0026] An example of the method for producing the marmoset AD model according to the present invention is as follows. TALEN mRNA targeting the 3'-splice site of exon 9 of the marmoset PSEN1 gene is introduced into the nucleus of a marmoset fertilized egg. After subcloning, surveyor assay and sequencing analysis may be performed, or only embryos with a defect in the target site including the 3'-splice site may be extracted. For example, a high probability of a defect, such as 2 out of 3, may be generated. After TALEN introduction, RT-PCR and cDNA sequencing may be performed to confirm the elimination of exon 9 in the PSEN1 mRNA. According to this method, the wild-type sequence is not present in the RNA extracted from the 4-cell stage fertilized egg or single blastomere, and a defect in the 3'-splice site may be generated in the allele.

[0027] Preferably, TALEN mRNA is introduced into eggs and allowed to fertilize. After fertilization, the fertilized eggs can be grown to 6-cell stage embryos or higher and transferred to surrogate mothers. The TALEN introduction does not cause obvious side effects during pregnancy or subsequent development. In this way, marmosets with, for example, a 6 bp deletion including a heterozygous 3'-splice site can be obtained. RT-PCR and subsequent cDNA sequencing can be performed on the mRNA of the obtained marmoset AD model (e.g., mRNA extracted from a marmoset hair root sample) to confirm the exclusion of exon 9.

[0028] As shown in the Examples below, the marmoset AD model of the present invention is 42 and Aβ 40 The ratio of abundance of Aβ 42 / Aβ 40 For example, the marmoset AD model of the present invention has a higher Aβ 42 / Aβ 40 is 1.4 times or more, 1.6 times or more, 1.8 times or more, or 2 times or more compared to the wild type. EXAMPLES

[0029] The following examples are given, but the present invention is not limited to these.

[0030] All of the following animal experiments were conducted in accordance with the "Regulations for Animal Experiments, etc." established by the Central Institute for Experimental Animals, a public interest incorporated foundation, based on the "Law for the Protection and Management of Animals," "Standards for the Care and Management of Laboratory Animals and the Relief of Pain," and "Fundamental Guidelines for the Conduct of Animal Experiments, etc. in Research Institutions, etc. (Notification of the Ministry of Education, Culture, Sports, Science and Technology)."

[0031] [material and method] Preparation of TALEN plasmids TALEN plasmids were generated using the Platinum Gate TALEN Kit (Addgene) as described in SCIENTIFIC REPORTS 2013, Nov 29; 3: 3379. Doi:10.1038 / srep03379. Briefly, Platinum TALENs containing homodimeric FokI nuclease domains were constructed by the two-step Golden Gate assembly method using the Platinum Gate TALEN Kit (Addgene; cat#1000000043). The assembled repeat array was subsequently introduced into the final destination vector, ptCMV-153 / 47-VR. TALEN mRNA was generated using the mMESSAGE mMACHINE T7 Ultra Transcription Kit (Thermo Fisher Scientific, AM1345). The transcribed mRNA was purified using the MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific, AM1908). The full-length sequences of the constructed plasmids are shown in SEQ ID NO: 1 (Left_TALEN) and SEQ ID NO: 2 (Right_TALEN) in the sequence listing.

[0032] [TALEN vector sequence] [SEQ ID NO: 1]

[0033] [SEQ ID NO:2]

[0034] Maturation culture and in vitro fertilization The TALEN-injected eggs were cultured for more than 24 hours in POM medium (Functional Peptide Institute / IFP1010P) supplemented with inactivated FBS (final concentration 5%), hFSH (Fuji Pharma, final concentration 0.15 IU / mL), and hCG (ASKA Pharmaceutical, final concentration 10 IU / mL), and eggs that had matured to the MI (Metaphase I) stage or higher were selected. Sperm used for fertilization were collected from wild-type male marmosets, and in vitro fertilization (IVF) was performed using TYH medium (LSI Medience / DR01031). The IVF was terminated the next day (approximately 16 hours after the start of IVF), and the success or failure of fertilization was judged based on the presence or absence of pronuclear cells, and the obtained fertilized eggs were selected.

[0035] Embryo Transfer and Pregnancy Management Fertilized eggs were cultured in vitro using Sequential Cleav. (Origio / 83040010A) for the initial stage, and embryos that had developed to the 4-cell stage or higher were selected 2-3 days after the start of culture. Late-stage in vitro culture was performed using Sequential Blast (Origio / 83060010A) medium supplemented with inactivated FBS (final concentration 10%) and L-glutamine (final concentration 2 mM). One week after TALEN injection, the embryos were transferred to the uterus of the surrogate mother using a non-invasive catheter procedure. After embryo transfer, pregnancy was confirmed by measuring the P4 level in the surrogate mother's blood and observing the uterus with an ultrasound diagnostic device. For individuals that were confirmed to be pregnant, the fetal heart rate and morphological abnormalities were observed at regular weekly checkups. Natural birth was basically adopted for delivery, and if natural birth was deemed difficult in consideration of the condition of the surrogate mother and the child, the baby was obtained by Caesarean section.

[0036] Genomic DNA analysis Genomic DNA was extracted from the hair of the newborns or from umbilical cord blood obtained during cesarean section using the QIAamp DNA micro kit (Qiagen / 56304). PCR reactions to analyze the PSEN1 gene were performed using KOD plus neo (TOYOBO / 401) and two primers, Psen1_Ex9_up1 (ACCCGCGACTCCCTATTATT: sequence number 3) and Psen1_Ex9_dn1 (TGCCTTGACTGTATTGTTGG: sequence number 4). The reaction conditions were heating at 94°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, 60°C for 10 seconds, and 68°C for 30 seconds. After the reaction, a portion of the reaction was electrophoresed on an agarose gel to confirm the presence or absence of amplification. Some of the amplified products were subjected to a surveyor assay that can visually detect gene modifications, while the other was cloned into a sequencing vector using the Zero Blunt PCR Cloning Kit (Thermo Fisher Scientific / K275040) and transformed by introducing the plasmid into E. coli (DH5α strain). Plasmids were recovered from the resulting subclones and sequenced.

[0037] cDNA analysis Total RNA was extracted from the body hair of the offspring or from umbilical cord blood obtained during cesarean section using Nucleospin RNA plus XS (Takara / U0990B), and cDNA was then synthesized using ReverTra Ace-α- (TOYOBO / FSK-101). PCR reactions to confirm the deletion of exon 9 of the PSEN1 gene were performed using KOD plus neo and two primer sets designed on nearby exons: Pn1_on_Ex7_up1 (TACCTCCCTGAATGGACTGC: sequence number 5) and Pn1_on_Ex11_dn2 (TGGTTGTGTTCCAGTCTCCA: sequence number 6); and Pn1_on_Ex8_up1 (GGTCCACTTCGTATGCTGGT: sequence number 7) and Pn1_on_Ex11_dn1 (GGCTGTTGCTGAGGCTTTAC: sequence number 8). The reaction conditions were heating at 94 ° C for 2 minutes, followed by 35 cycles of 98 ° C for 10 seconds, 60 ° C for 10 seconds, and 68 ° C for 30 seconds. The samples that had undergone the reaction were electrophoresed on a 1.5% agarose gel, and the deletion of exon 9 was estimated by capturing the band shift of the amplified product. A portion of the amplified product was cloned into a sequencing vector using the Zero Blunt PCR Cloning Kit, and the plasmid was transformed into Escherichia coli (DH5α strain). Plasmids were recovered from the resulting subclones and sequenced.

[0038] primary culture A small amount of earlobe tissue from the offspring was collected and chopped into pieces. The pieces were attached to cell culture dishes and cultured at 37°C in a 5% CO2 environment using D-MEM (Thermo Fisher Scientific / 10566016) supplemented with 10% inactivated FBS.

[0039] [Example 1] After introducing TALEN mRNA targeting the 3'-splice site of exon 9 of the marmoset PSEN1 gene into the nuclei of marmoset fertilized eggs, surveyor assays and sequencing assays were performed after subcloning. As shown in Figure 2A, two of the three fertilized eggs showed deletions in the target site including the 3'-splice site sequence, as expected. Next, after TALEN injection into marmoset fertilized eggs, RT-PCR and cDNA sequencing were performed to confirm the elimination of exon 9 in PSEN1 mRNA. As shown in Figure 2B, RNA was extracted from fertilized eggs or single blastomeres at the 4-cell stage after TALEN injection. As shown in Figure 2C, complete elimination of exon 9 was observed in two 4-cell fertilized eggs and two single blastomeres. None of these fertilized eggs and single blastomeres with deleted 3'-splice sites had wild-type sequences. This suggests that the deletion of the 3'-splice site occurs in a biallelic manner. The PS1 protein is the catalytic subunit of the γ-secretase complex, a type 1 transmembrane protein whose substrates include the amyloid precursor protein (APP) and Notch. Exclusion of exon 9 results in loss of γ-secretase function, since the region encoded by exon 9 resides at an endoproteolysis site, which is required for γ-secretase maturation. Homozygous deletion of PSEN1 exon 9 in marmosets causes embryonic lethality due to disruption of Notch signaling.

[0040] [Example 2] Based on the results obtained with fertilized eggs, we attempted to introduce TALEN mRNA into eggs as described above and induce fertilization. After fertilization, the fertilized eggs were grown to the morula stage and transferred to surrogate mothers. TALEN injection did not cause any obvious side effects during pregnancy or subsequent development. In this way, an F0 marmoset (PSEN1-ΔE9) with a 6 bp deletion containing the 3'-splice site in the heterozygous state was obtained (a photograph of the newborn is shown in Figure 3A). Surveyor assays were performed on genomic DNA extracted from umbilical cord blood. The results are shown in Figure 3B. In Figure 3B, the left two columns show the results of Surveyor assays (lane 1: mixture of newborn genomic DNA and wild-type control blood (CB) sample in Figure 3A, lane 2: newborn genomic DNA only) using newborn genomic DNA (genomic DNA extracted from newborn umbilical cord blood in Figure 3A) as a template. The right two columns show experimental controls (+ indicates positive control, - indicates negative control). Figure 3c shows the results of PCR performed on RNA extracted from hair roots of mutant and wild-type marmosets. The two right columns show negative PCR data for the same RNA samples, but without RT. As shown in Figure 3c, the band of the PCR product in which exon 9 was excluded appeared at 315 bp, and the band of the wild-type appeared at 402 bp. The fertilized eggs analyzed showed only a single band, suggesting that no heterozygous mutations were generated.

[0041] [Example 3] Aβ in the culture medium of wild-type and PSEN1-ΔE9(I774gmF) marmoset primary fibroblasts was measured by ELISA (Wako, 294-62501, 290-62601). The results are shown in Figure 4. In PSEN1-ΔE9 marmoset fibroblasts, Aβ 40 decrease, Aβ 42 Increase, Aβ 42 / Aβ 40 An increased ratio was observed, indicating that the PSEN1-ΔE9 mutation is pathogenic (causes disease).

[0042] In the two individuals in which PSEN1 gene modification was observed, the occurrence ratios of normal PSEN1 and exon 9 deletion PSEN1 were approximately half and half in the results of genomic DNA analysis and cDNA analysis, strongly suggesting that the heterozygous PSEN1-ΔE9 seen in human patients could be reproduced. In addition, the results of Aβ quantification in fibroblast culture medium reproduced the abnormal Aβ production profile, and it was considered that the generated PSEN1-ΔE9 marmoset reproduced the AD pathology. In addition, the method of causing exon skipping by introducing a mutation into the 3'-splice site in this study is more efficient and useful than the usual method of deleting both ends of an exon by genome editing or the knock-in method, because it can be achieved by inducing a DNA double-strand break at one location on the genome DNA. It is considered that the method of creating a disease model that reproduces the pathology of a disease (Alzheimer's disease) by introducing a mutation into such a splicing-related sequence by genome editing is a useful method. Furthermore, when targeting a genetic mutation that may result in embryonic lethality in the homozygous form, as in the present invention, the method of performing genome editing in eggs and then fertilizing them was considered to be a useful means of avoiding embryonic lethality.

[0043] [Example 4] Two PSEN1-ΔE9 newborns (I943gmM and I949gmM) were further obtained by following the same procedure as in Example 2 (FIG. 5A). Surveyor assay was performed on genomic DNA extracted from umbilical cord blood for the three individuals to which I774gmF was also added. The results are shown in FIG. 5B. The symbols shown at the bottom of FIG. 5B represent: CB: genome extracted from umbilical cord blood of newborns, HR: genome extracted from hair roots of newborns, M: marker, +N: normal genome added, + and -: reagent control, respectively. In addition, as shown in FIG. 5C, I774gmF and I943gmM had a 6 bp deletion including a 3'-splice site in the heterozygous state, and I949gmM had a 9 bp deletion including a 3'-splice site in the heterozygous state in the PSEN1 gene.

[0044] PS1 protein was analyzed by Western blot in membrane fractions obtained from wild-type (I774gmF) and PSEN1-ΔE9 (I943gmM and I949gmM) marmoset fibroblasts. The results are shown in Fig. 6a. The left panel shows the results using an antibody against the N-terminal fragment (NTF) of PS1 protein. The right panel shows the results using an antibody against the C-terminal fragment (CTF) of PS1 protein. The arrowheads indicate the NTF and CTF generated by endoproteolysis of PS1, and the arrows indicate the full-length PS1 protein. Sodium-potassium ATPase was used as a loading control for the membrane fractions.

[0045] In addition, Aβ in the culture medium of the primary fibroblasts was quantified by sandwich ELISA (Wako, 294-62501, 290-62601). The results are shown in Fig. 6c. Fig. 6c shows the mean ± standard error (WT: n = 15, ΔE9: n = 9). **P ≦ 0.01, ****P ≦ 0.0001 in Fig. 6c indicate that there was a significant difference according to Student's two-tailed t-test. As in Example 3, Aβ 40 decrease, Aβ 42 Increase, Aβ 42 / Aβ 40 The ratio increased. 43 Levels were below the limits of detection and are not shown. [Industrial Applicability]

[0046] The non-human primate AD model of the present invention is extremely useful for developing methods for diagnosing and treating Alzheimer's disease.

[0047] [References] 1. Saito, T. et al. Single App knock-in mouse models of Alzheimer's disease. Nat Neurosci 17, 661-663, doi:10.1038 / nn.3697 (2014). 2. Sasaguri, H. et al. APP mouse models for Alzheimer's disease preclinical studies. EMBO J 36, 2473-2487, doi:10.15252 / embj.201797397 (2017). 3. Sasaki, E. et al. Generation of transgenic non-human primates with germline transmission. Nature 459, 523-527, doi:10.1038 / nature08090 (2009). 4. Izpisua Belmonte, J. C. et al. Brains, genes, and primates. Neuron 86, 617-631, doi:10.1016 / j.neuron.2015.03.021 (2015). 5. Miller, C. T. et al. Marmosets: A Neuroscientific Model of Human Social Behavior. Neuron 90, 219-233, doi:10.1016 / j.neuron.2016.03.018 (2016). 6. Crook, R. et al. A variant of Alzheimer's disease with spastic paraparesis and unusual plaques due to deletion of exon 9 of presenilin 1. Nature medicine 4, 452-455 (1998). 7. Prihar, G. et al. Alzheimer disease PS-1 exon 9 deletion defined. Nature medicine 5, 1090, doi:10.1038 / 13383 (1999). 8. Smith, M. J. et al. Variable phenotype of Alzheimer's disease with spastic paraparesis. Annals of neurology 49, 125-129 (2001). 9. Le Guennec, K. et al. Deletion of exons 9 and 10 of the Presenilin 1 gene in a patient with Early-onset Alzheimer Disease generates longer amyloid seeds. Neurobiology of disease 104, 97-103, doi:10.1016 / j.nbd.2017.04.020 (2017). 10. Blauwendraat, C. et al. Pilot whole-exome sequencing of a German early-onset Alzheimer's disease cohort reveals a substantial frequency of PSEN2 variants. Neurobiology of aging 37, 208.e211-208.e217, doi:10.1016 / j.neurobiolaging.2015.09.016 (2016). 11. Hutton, M. et al. Complete analysis of the presenilin 1 gene in early onset Alzheimer's disease. Neuroreport 7, 801-805 (1996). 12. Kwok, J. B. et al. Two novel (M233T and R278T) presenilin-1 mutations in early-onset Alzheimer's disease pedigrees and preliminary evidence for association of presenilin-1 mutations with a novel phenotype. Neuroreport 8, 1537-1542 (1997). 13. Brooks, W. S. et al. Alzheimer's disease with spastic paraparesis and 'cotton wool' plaques: two pedigrees with PS-1 exon 9 deletions. Brain : a journal of neurology 126, 783-791 (2003). 14. Sato, K. et al. Generation of a Nonhuman Primate Model of Severe Combined Immunodeficiency Using Highly Efficient Genome Editing. Cell stem cell 19, 127-138, doi:10.1016 / j.stem.2016.06.003 (2016). 15. Tomita, T. & Iwatsubo, T. Structural biology of presenilins and signal peptide peptidases. The Journal of biological chemistry 288, 14673-14680, doi:10.1074 / jbc.R113.463281 (2013). 16. Shen, J. et al. Skeletal and CNS defects in Presenilin-1-deficient mice. Cell 89, 629-639 (1997). 17. Kumar-Singh, S. et al. Mean age-of-onset of familial Alzheimer disease caused by presenilin mutations correlates with both increased A beta 42 and decreased A beta 40. Human Mutation 27, 686-695, doi:10.1002 / humu.20336 (2006). 18. Sakuma, T. et al. Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Scientific reports 3, 3379, doi:10.1038 / srep03379 (2013). 19. Geula, C., Nagykery, N. & Wu, C. K. Amyloid-beta deposits in the cerebral cortex of the aged common marmoset (Callithrix jacchus): incidence and chemical composition. Acta neuropathologica 103, 48-58 (2002). 20. Ridley, R. M., Baker, H. F., Windle, C. P. & Cummings, R. M. Very long term studies of the seeding of beta-amyloidosis in primates. Journal of neural transmission (Vienna, Austria : 1996) 113, 1243-1251, doi:10.1007 / s00702-005-0385-2 (2006). 21. Rodriguez-Callejas, J. D., Fuchs, E. & Perez-Cruz, C. Evidence of Tau Hyperphosphorylation and Dystrophic Microglia in the Common Marmoset. Frontiers in aging neuroscience 8, 315, doi:10.3389 / fnagi.2016.00315 (2016). 22. t Hart, B. A. & Massacesi, L. Clinical, pathological, and immunologic aspects of the multiple sclerosis model in common marmosets (Callithrix jacchus). Journal of neuropathology and experimental neurology 68, 341-355, doi:10.1097 / NEN.0b013e31819f1d24 (2009). 23. Tardif, S. D., Mansfield, K. G., Ratnam, R., Ross, C. N. & Ziegler, T. E. The marmoset as a model of aging and age-related diseases. ILAR journal 52, 54-65 (2011). 24. Crofts, H. S. et al. Investigation of the sleep electrocorticogram of the common marmoset (Callithrix jacchus) using radiotelemetry. Clinical neurophysiology : official journal of the International Federation of Clinical Neurophysiology 112, 2265-2273 (2001). 25. Hikishima, K. et al. Atlas of the developing brain of the marmoset monkey constructed using magnetic resonance histology. Neuroscience 230, 102-113, doi:10.1016 / j.neuroscience.2012.09.053 (2013). 26. Senoo, A., Tokuno, H. & Watson, C. Mini-atlas of the marmoset brain. Neuroscience research 93, 128-135, doi:10.1016 / j.neures.2014.12.014 (2015). 27. Hashikawa, T., Nakatomi, R. & Iriki, A. Current models of the marmoset brain. Neuroscience research 93, 116-127, doi:10.1016 / j.neures.2015.01.009 (2015).

Claims

1. As a result of a partial or complete deletion of the 3' splice site of exon 9 of the PSEN1 gene, PSEN1 mRNA in which only exon 9 is excluded is expressed, A non-human primate model of Alzheimer's disease, wherein the deletion of said site is a deletion of the site in a heterozygous state.

2. The primate of claim 1, wherein the non-human primate is a marmoset.

3. The method includes a step of deleting a part or all of the 3' splice site of exon 9 of the PSEN1 gene using genome editing technology, thereby expressing PSEN1 mRNA in which only exon 9 is excluded, The deletion of the site is a deletion of the site in a heterozygous state. A method for producing a non-human primate model of Alzheimer's disease.

4. The method according to claim 3, characterized in that a part or all of the 3' splice site of exon 9 of the PSEN1 gene is deleted in an oocyte.

5. 5. The method of claim 3 or 4, wherein the non-human primate is a marmoset.

Images