Method for preparing spider and bombyx mori composite silk fibers on the basis of gene targeting bombyx mori

Abstract

Provided is a method for preparing spider and Bombyx mori composite silk fibers on the basis of gene targeting Bombyx mori, particularly a method for preparing composite silk fibers of spider major ampullate spidroin and Bombyx mori fibroin on the basis of gene targeting Bombyx mori. The method comprises injecting pUC-target-Heavy-g and plasmid piggyCPF1 expressing Cas12a nuclease into the primary eggs of Bombyx mori, and performing primary fluorescent screening, molecular biological identification and subculture screening to obtain a gene targeting Bombyx mori in which the Bombyx mori fibroin heavy chain gene expression cassette is replaced by the spider major ampullate spidroin gene sequence expression cassette. The gene targeting Bombyx mori is conventionally fed, matured Bombyx mori are moved to a cocooning frame and make cocoons, the cocoons are harvested, and silk reeling is performed to obtain the composite silk containing Nephila clavipes major ampullate spidroin.

Description

A method for preparing spider silkworm composite silk fibers based on gene targeting of silkworms Technical Field

[0001] The present invention relates to the field of genome editing, and in particular to a method for preparing composite silk fibers of spider ampullate silk protein and silkworm silk protein based on gene targeting of silkworms. Background Art

[0002] In recent years, researchers have successfully expressed spider silk protein repeat sequences in bacteria, yeast, cultured mammalian cells, and insect cells using genetic engineering techniques, and even in transgenic animals and plants. However, these expressed spider silk protein sequences are not complete, and the recombinant spider silk protein sequences cannot assemble into silk fibers autonomously. They must be further processed into silk fibers through artificial spinning techniques. Currently, this technology is difficult to obtain large quantities of spider silk fibers with excellent mechanical properties. Therefore, these recombinant spider silk proteins are mostly used in laboratory research on biomaterials. Furthermore, spiders synthesize and secrete different spider silks in different glands. Because the molecular weight of the main ampullate gland silk protein is large and its core sequence is a simple, highly repetitive sequence, the molecular weight of the expressed recombinant spider silk protein is often lower than the theoretical molecular weight, and the expression level is very low. The mechanical properties of silk obtained by artificial spinning from regenerated or recombinant silk proteins are related to multiple factors. Improving the expression level and increasing the molecular weight of the expressed spider silk protein have long been the goals pursued in the field.

[0003] For thousands of years, raising silkworms to produce cocoons has been the foundation of the silk industry. Bombyx mori is the only insect that can be reared indoors to produce large quantities of silk fibers. Silk protein is primarily composed of sericin and fibroin, and silk fibers are primarily composed of the water-insoluble fibroin heavy chain (350 kDa), fibroin light chain (25.8 kDa), and P25 protein (25.7 kDa) assembled in a molar ratio of 6:6:1. The mechanical properties of silk protein are primarily determined by the high molecular weight and highly repetitive amino acid sequence of the fibroin heavy chain. For a long time, the desire to utilize the silkworm's efficient silk protein synthesis and natural spinning ability to produce spider silk has been high. At present, after multiple tandem duplications of the repetitive motifs of the major ampullate gland silk protein genes of the Nephila clavipes and Araneus ventricosus, the expression of non-complete spider silk protein genes in silkworms has been achieved through piggyBac-mediated transgenesis. The natural spinning ability of the silkworm has been used to obtain chimeric silk containing spider silk protein components, which has improved the mechanical properties of the silk fibers to a certain extent. However, the content of spider silk protein in the silk fibers is very limited.

[0004] The prior art discloses an application of a spider botryoidal silk protein gene sequence and a method for improving the silk properties of silkworms. The spider botryoidal silk protein gene is a gene sequence composed of 1-8 times continuous repeating units of black widow spider botryoidal silk or orbicularis spider botryoidal silk. The method first constructs a plasmid pBac-ACSP that can secrete and express botryoidal silk protein in the silk gland of the silkworm. The plasmid is introduced into fertilized silkworm eggs together with a helper plasmid expressing a transposase. Through transposon mediation, a fluorescent protein gene and the botryoidal silk protein gene are introduced into the silkworm genome, where they are stably inherited and expressed, thereby breeding transgenic silkworms that secrete spider botryoidal silk protein. The method discovers a use of the spider botryoidal silk protein gene and develops a method for producing a novel silkworm spider bionic silk with improved silk properties. However, this technique uses the piggyBac transposon technology to introduce a spidroin gene expression cassette into the silkworm genome. The cassette's integration into the silkworm genome tends to occur at TTAA sites, resulting in a high degree of randomness. The silkworm's native silk protein genes are not replaced by the spidroin gene, resulting in low expression levels. Furthermore, the spidroin protein sequence expressed in this technique is incomplete. Overall, this technique has been eliminated.

[0005] With the development and improvement of gene editing technology, TALEN-mediated homologous end recombination has enabled the replacement of the silkworm's heavy chain silk protein gene with the spider major ampullate gland silk protein gene. However, the breaking stress (breaking stress) is 371.3 MPa, 17.4% lower than the 449.5 MPa of wild silkworms, indicating a significant decrease in strength. The CRISPR / Cas9-mediated integration of a synthetic spider gene repeat region of similar size to the natural spider silk protein gene into the intron region of the silkworm's heavy chain gene has not been able to replace the silkworm's heavy chain gene with a spider silk gene. Technical issues

[0006] The purpose of the present invention is to provide a method for preparing spider silkworm composite silk fibers based on gene-targeted silkworms, specifically a method for preparing spider ampullate silk protein and silkworm silk protein composite silk fibers based on gene-targeted silkworms. Technical Solutions

[0007] The purpose of the present invention is to provide a method for preparing spider silkworm composite silk fibers based on gene-targeted silkworms, specifically a method for preparing spider ampullate silk protein and silkworm silk protein composite silk fibers based on gene-targeted silkworms.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] A method for preparing spider silkworm composite silk fibers based on gene-targeted silkworms comprises the following steps:

[0010] (1) Construction of gene targeting vector pUC-target-Heavy-g;

[0011] (2) mixing the gene targeting vector pUC-target-Heavy-g with a plasmid expressing Cas12a nuclease, and then introducing the mixture into newly laid eggs of silkworms, followed by hatching; preferably, the plasmid expressing Cas12a nuclease is piggyCPF1, a plasmid expressing Cas12a nuclease;

[0012] (3) After the silkworm's first eggs hatch, they are raised until they become moths, and the male and female mate to obtain the moth-shaped silkworm eggs;

[0013] (4) using specific primers to amplify the DNA of the parent moth in the moth circle silkworm eggs and screen the eggs produced by the gene-targeted silkworm moths;

[0014] (5) Eggs produced by mating of gene-targeted silkworm moths whose parents are gene-targeted are incubated and then reared normally until they become moths, and then mate and lay eggs in the same moth area; then, specific primers are used to amplify the moth's DNA, and the amplified products are sequenced and verified, and eggs produced by mating of gene-targeted silkworm moths whose male and female parents are pure lines are selected for succession;

[0015] (6) After the eggs obtained in step (5) are hatched, they are reared in a conventional manner until they are cocooned, thereby obtaining spider silkworm composite silk fibers.

[0016] The present invention prepares spider and silkworm composite silk fibers, preferably composite silk fibers of spider ampullate gland silk protein and silkworm silk protein.

[0017]

[0018] In SEQ ID NO: 1, 1-431 nt is the pUC vector backbone sequence; 432-2221 nt is the homologous left arm sequence, which contains the silk fibroin heavy chain gene promoter; 2222-2284 nt is the signal peptide sequence of the silk fibroin heavy chain gene, which is preferably a sequence optimized according to the Bombyx mori codon; 2285-9604 nt is the golden silk weaving spider major ampullate gland silk protein (MaSP-g) gene sequence, which is preferably a sequence optimized according to the Bombyx mori codon, wherein the 9311-9604 nt region is the MaSP-g C-terminal non-repeat region; 9605-9941nt is the sericin gene tailing signal; 9942-10192nt is the 3×P3 promoter sequence; 10228-10908nt is the dsRed gene coding sequence; 10917-11149nt is the SV40 tailing signal; 11150-13009nt is the homologous right arm sequence; 13010-13492nt is the U6 promoter sequence; 13493-13799nt is the sequence encoding gRNA, among which CGATATCTGTGCGTTTTGGCG and CGACGAGAATAGTCGTAACTG are the template chains targeting the fib-H gene, CATAATTAGAATGTTGTTCAA, CGGAGCTGGCAGGGGATACGG and AATTCAGAGCACTGCCTTGTG are the sense chain sequences targeting fib-H; 13800-16078nt is the pUC vector backbone sequence. The sequence of SEQ ID NO:1 can be fully artificially chemically synthesized, or a combination of artificial chemical synthesis and PCR amplification, specifically conventional techniques. Preferably, the length of the left and right homologous arms is greater than 1 kb, and the left and right homologous arms can be the length indicated in SEQ ID NO:1. The 3×P3 promoter sequence can also be replaced with other promoters from Bombyx mori, for example, the actin A3 promoter. The red fluorescent protein (DsRed) gene can also be replaced with the green fluorescent protein (GFP) gene. The described tailing signal can also be the tailing signal of other genes. Vectors other than pUC can also be selected as the backbone sequence of the vector pUC-target-Heavy-g, for example, the pBlueScript SK vector.

[0019]

[0020] In the present invention, the first-laid eggs of the silkworm can be the first-laid eggs of the polyvoltine non-diapause silkworm, which are silkworm eggs that have just been laid and protected at room temperature for 2 to 8 hours; or they can be the first-laid eggs of the diapause silkworm species that have been artificially intervened to release diapause.

[0021] In the present invention, in step (4), the specific primers are a primer pair for amplifying the web spider ampullate silk protein gene, a primer pair for amplifying the fluorescent protein gene, a primer pair for detecting the left insertion site of the exogenous DNA, and a primer pair for detecting the right insertion site of the exogenous DNA. Preferably, the specific primers are the primer pair Heavy-gF and Heavy-gR for amplifying a partial sequence of the web spider ampullate silk protein gene, whose sequences correspond to SEQ ID NO: 3 (GTTCATCTAGCATCGGACAGG) and SEQ ID NO: 4 (CGAAATCGATAAGCTTGGATCC); the primer pair for amplifying a partial sequence of the fluorescent protein gene is dsRed-F1 and dsRed-R1, whose sequences correspond to SEQ ID NO: 15 (CCAAGGTGTACGTGAAGCAC), SEQ ID NO: 16 (GCCGATGAACTTCACCTTGT), or the primer pair DsRed-F and DsRed-R, whose sequences correspond to SEQ ID NO: 8 (TCGATTTCGAACCCTCGACC), SEQ ID NO: 9 (GCTCCACGATGGTGTAGTCC); the primer pair for detecting the left insertion site of the exogenous DNA is Left-F1 and Left-R2, and the primer pair Left-F2 and Left-R2, whose sequences correspond to SEQ ID NO: 5 (GCCATATGCTCGTCTGCCTA) and SEQ ID NO: 7 (TCAGGGGTGAAAGCACCAGA) and SEQ ID NO: 6 (CCCGTTCCTCTAGTGGGAGA) and SEQ ID NO: 7, respectively; the primer pair for detecting the right insertion site of the exogenous DNA is Right-F1 and Right-R2, and Right-F2, Righ-R2, whose sequences correspond to SEQ ID NO: 10 (CTACATGGCCAAGAAGCCCGTG) and SEQ ID NO: 11, and SEQ ID NO: 12 (GCGAATTACTCCAACGGGAC) and SEQ ID NO: 11 (TACGTGGGAATGAGGCGTTC). For example, the PCR product of the DsRed-F1 and DsRed-R1 primer pair is 173bp, and the DsRed-F and DsRed-R primer pair can specifically amplify a sequence of 823bp, indicating that a specific band representing the DsRed fragment was detected in the parental DNA of the silkworm eggs; the Heavy-gF and Heavy-gR primer pair can amplify a sequence of 523bp, indicating that there are spider silk genes in the genome of the silk moth.When the PCR product of the Left-F1 and Left-R2 primer pair (2033 bp) was used as a template, followed by PCR with the Left-F2 and Left-R2 primer pairs, a 480 bp specific fragment was amplified, indicating that the left side of the spidroin gene expression cassette had integrated into the silkworm genome as designed. Similarly, when the PCR product of the Right-F1 and Right-R2 primer pair (3210 bp) was used as a template, followed by PCR with the Right-F2 and Right-R2 primer pairs, a 995 bp specific fragment was amplified, indicating that the right side of the DsRed expression cassette had integrated into the silkworm genome as designed. The offspring of the parental silkworm moth whose PCR amplification results met the above characteristics were the moth-hoop silkworm eggs required by the present invention. To further confirm the correctness of the PCR products, the PCR products were cloned into a vector and verified by Sanger sequencing. In addition to the above identification methods, other specific primers can be designed based on the theoretical target region and the theoretical sequence of the exogenous DNA fragment integrated into the silkworm genome, and PCR amplification and Sanger sequencing of the products can be performed. If the DsRed gene in pUC-target-Heavy-g is replaced by the GFP gene, a specific band representing the GFP gene fragment will be screened out. If the 3×P3 promoter in pUC-target-Heavy-g is replaced by the actin A3 promoter, a specific band representing the red fluorescent fragment will be screened out.

[0022] In the present invention, in step (5), the specific primer pair is a primer pair for detecting whether the obtained silkworms are pure-line targeted silkworms, specifically using specific primers for PCR detection of silkworm DNA, and performing Sanger sequencing verification on the PCR products. The eggs produced by mating of the gene-targeted silkworm moths whose parents are pure-lined are retained, and after being accelerated to green, they are raised normally, and after they have emerged as moths, they are mated in the same moth area; then PCR detection is performed, and the PCR products are Sanger sequencing to identify the corresponding silkworm moths, and the eggs produced by mating of the gene-targeted silkworm moths whose male and female parents are pure-lined are selected for succession. Specific primers FibH-F and FibH-R are designed, and their sequences are SEQ ID NO: 13 (CGGAGCAGGATATGGAGCA) and SEQ ID NO: 14 (AAAGTCAGACGACCAAGCGT), respectively. PCR detection and Sanger sequencing are performed on the offspring of the same moth area mating. If a specific band of 187 bp can be amplified, the detected object is a non-pure-line targeted silkworm; if a specific band of 187 bp cannot be amplified, the detected object is a pure-line targeted silkworm. Since pure-line gene-targeted silkworms no longer have the fib-H gene, other primers can be designed based on the fib-H gene sequence for PCR and RT-qPCR verification; verification can also be performed by detecting whether the Fib-H protein is expressed.

[0023] In the present invention, in step (6), after the silkworm eggs obtained in step (5) are hatched, they are conventionally reared until mature, and the mature silkworms are moved to a cocoon maker, cocooned, harvested, and reeled to obtain composite silk containing golden web spider ampullate gland silk protein. Measurements show that the composite silk has a 30% increase in breaking strength and a 28% increase in elasticity.

[0024] The preparation of a composite silk fiber of spider ampullate silk protein and silkworm silk protein based on gene targeting of silkworms according to the present invention can also be achieved by the following scheme:

[0025] (1) First, a transgenic silkworm BmCas12a expressing Cas12a nuclease was prepared, that is, the piggyCPF1 plasmid and the Helper vector expressing piggyBac transposase were injected into the newly laid eggs of the silkworm, and the transgenic silkworm BmCas12a was obtained by green fluorescence screening and PCR identification of the Cas12a gene; (2) pUC-target-Heavy-g was injected into the newly laid eggs of the transgenic silkworm BmCas12a, and then the composite silk fibers of spider ampulla silk protein and silkworm silk protein were obtained based on gene-targeted silkworm through the above steps (3)-(6).

[0026] Pure-line target silkworms can be used as breeding material and hybridized with existing varieties. Through conventional breeding, silk production and / or disease resistance can be further improved.

[0027] The above technical solution can obtain a targeted silkworm in which the MaSp-g gene replaces the fib-H gene, and a composite silk fiber of spider ampullate silk protein and silkworm silk protein prepared based on gene-targeted silkworms. Due to the application of the above technical solution, the present invention has the following advantages over the prior art:

[0028] (1) Directed and substantial improvement in the mechanical properties of silk: Traditional silkworm breeding technology is difficult to significantly improve the mechanical properties of silk fibers. The present invention utilizes novel genome editing technology and homologous repair technology to replace the silk fibroin heavy chain gene with a spider silk protein gene with excellent mechanical properties, thereby achieving directed and substantial improvement in the mechanical properties of silk.

[0029] (2) The content of spider silk protein in the silk fibers is significantly higher than that of the silk fibers obtained by piggyBac transposon-mediated transfection of the spider silk protein gene: The conventional method for improving the mechanical properties of silk is to transfer the spider silk protein gene into the silkworm through piggyBac transposon-mediated transfection of the spider silk protein gene. The silk proteins produced by this technology have a low content of spider silk protein (2-5%), and the improvement in the mechanical properties of the silk fibers is limited. The silk fibers produced by the present invention have a spider silk protein content of more than 30%, and the mechanical properties of the silk fibers are significantly improved.

[0030] (3) Using the novel CRISPR / Cas12a technology to effectively improve genome editing efficiency: There are only two reports on studies on improving the mechanical properties of silk fibers through genome editing, namely homology-directed repair mediated by TALEN and directional insertion based on CRISPR / Cas9 genome editing. The former is an early genome editing technology that is cumbersome and has been eliminated; the latter has a low efficiency in obtaining target genome-edited silkworms due to its high off-target frequency. The present invention uses the novel CRISPR / Cas12a technology, and the designed U6-gDNA array element expresses a gRNA array that can simultaneously target different regions of a genome, effectively reducing the off-target frequency and improving editing efficiency.

[0031] (4) The spider silk protein gene selected is the full-length MaSp-g gene: Since the MaSp gene is large (the molecular weight of the encoded protein exceeds 200 kDa) and the MaSp protein is a highly repetitive sequence of specific amino acids with extremely low expression levels, the DNA sequences of spider silk proteins selected in previous studies are mostly concatemers of multiple repeats of MaSp repeating units, lacking the N- and C-terminal domains of natural spider silk proteins. The molecular weight of recombinant silk proteins is also mostly less than 100 kDa, but the mechanical properties of spider silk are positively correlated with the molecular weight of the recombinant protein. The spider silk protein gene selected in the present invention is the complete full-length MaSp-g gene, and the molecular weight of the protein is as high as 230 kDa. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 is a schematic diagram of the structure and targeting strategy of pUC-target-Heavy-g in Example 1; the flanking sequence of the silkworm fib-H gene is used as a homology arm, and the codon-optimized full-length golden silk spider large ampulla gland silk protein MaSp-g gene and the DsRed gene expression cassette controlled by the Fib-H promoter are inserted in the middle. A gDNA array controlled by the U6 promoter is designed downstream of the homologous right arm, and its transcription product gRNA can target different regions of the Fib-H gene. After the plasmid is introduced into the silkworm egg, the Fib-H locus is cut under the action of Cas12a by the CRISPR-Cas12a genome editing system, and the MaSp-g expression cassette and the DsRed gene expression cassette are further replaced by the fib-H locus by homologous recombination.

[0033] Figure 2 shows the electropherogram of PCR detection of DsRed in G0 generation silkworms, using the primer pair DsRed-F1 and DsRed-R1, as described in Example 1. Lane M, standard molecular weight DNA; Lane Pos, positive control (pUC-target-Heavy-g plasmid); Lane Neg, normal silkworms; and Lanes 1-29, G0 generation silkworm moths.

[0034] Figure 3 shows the results of screening and identification of transgenic silkworms from generations G1-G4 in Example 1. Genomic DNA was extracted from randomly selected G1-G4 moths and amplified using the Heavy-gF and Heavy-gR primer pairs. The PCR products were recovered, cloned into the pMD-19-T vector, and Sanger sequenced. Upper column: Electrophoresis analysis of PCR products; Lane M: Standard molecular weight DNA; Lane PC: Positive control (pUC-target-Heavy-g plasmid); other lanes: DNA from G1-G4 moths. Lower column: Sanger sequencing of representative PCR products.

[0035] Figure 4 is an electrophoretogram of PCR identification of gene-targeted silkworms in Example 1; M, DNA Marker; NC, common silkworm; PC1, pUC-target-Heavy-g DNA was PCR-generated using the Heavy-gF and Heavy-gR primer pairs; MaSp-g, gene-targeted silkworm DNA was PCR-generated using the Heavy-gF and Heavy-gR primer pairs; PC2, pUC-target-Heavy-g DNA was PCR-generated using the dsRed-F and dsRed-R primer pairs; DsRed, gene-targeted silkworm DNA was PCR-generated using the dsRed-F and dsRed-R primer pairs; PC3, pUC-target-Heavy-g was PCR-generated using the Left-F2 and Left-R2 primer pairs; Left, gene-targeted silkworm DNA was amplified using the Left-F1 and Left-R2 primer pairs, and the amplified product was amplified using the Left-F2 / Left-R2 primer pairs; PC4, pUC-target-Heavy-g was amplified using Right-F2 / Right-R2; Right, gene-targeted silkworm DNA was amplified using the Right-F1 and Right-R2 primer pair, and the amplified product was further amplified using the Right-F2 and Right-R2 primer pair; Fib-H, gene-targeted silkworm DNA was amplified using FibH-F / FibH-R primers.

[0036] Figure 5 is a diagram showing the sequencing results of the PCR products in Example 1; C1: Sanger sequencing of the PCR product in the Left lane in Figure 4, with the Left-F2 and Left-R2 primers shown in red. C2: Sanger sequencing of the PCR product in the MaSp-g lane in Figure 4, with the Heavy-gF and Heavy-gR primers shown in red. C3: Sanger sequencing of the PCR product in the dsRed lane in Figure 4, with the dsRed-F and dsRed-R primers shown in red. C4: Sanger sequencing of the PCR product in the Right lane in Figure 4, with the Right–F2 and Right–R2 primers shown in red.

[0037] Figure 6 shows the results of detecting the expression of the MaSp-g gene in the posterior silk gland of gene-targeted silkworms in Example 1; A: qRT-PCR analysis. RNA was extracted from the posterior silk gland of the fifth instar silkworm on day 4, and qRT-PCR was used to detect the expression of the MaSp-g gene in transgenic silkworms. Primers MaSp-gF and MaSp-gR correspond to SEQ ID NO: 17 (TCTTGTGCTGTGCTCTCCAA) and SEQ ID NO: 18 (TCAGGGGTGAAAGCACCAGA). The internal control was TIF4A, and the amplification primer pair was TIF-4A-F and TIF-4A-R, corresponding to SEQ ID NO: 19 (GAATGGACCCTGGGACACTT) and SEQ ID NO: 20 (CTGACTGGGCTTGAGCGATA). A control group of normal Nistari silkworms was also established. CON, normal Nistari silkworm; H-1 and H-2, gene-targeted silkworms. B, Western blotting analysis. Total protein from the posterior silk gland at day 4 of the fifth instar was separated by 10% SDS-PAGE (60 μg protein / lane) and analyzed by Western blotting. The primary antibody was MaSp-g (rabbit anti-IgG, 1:1000), the secondary antibody was HRP-conjugated goat anti-mouse IgG (1:5000), and the internal control was α-tubulin (mouse anti-IgG, 1:5000). A normal Nistari control group was also established. NC, Nistari control; Silk gland, gene-targeted silkworm.

[0038] Figure 7 shows the detection results of MaSp-g in silk protein in Example 1; A, Western blotting analysis. Silk protein solution was separated by 10% SDS-PAGE (80 μg protein / lane) and then analyzed by Western blotting. The primary antibody was a MaSp-g antibody (rabbit anti-MaSp-g, 1:1000), and the secondary antibody was an HRP-labeled goat anti-mouse IgG (1:5000). A normal stock Nistari silkworm cocoon protein sample was also used as a control. M, protein marker; NC, normal silk protein; Silk protein, target silk protein. B, Mass spectrometry analysis of silk protein. Peptides representing spider silk proteins were detected.

[0039] FIG8 is a stress-strain diagram of the silkworm-spider chimeric silk fiber in Example 1; Normal silk, normal silk; Chimeric silk, gene-targeted silkworm silk.

[0040] Figure 9 shows the results of the NQS F1 generation silkworm assay in Example 2; A, RT-PCR analysis of MaSp-g gene expression in NQS. The primer pairs used were MaSp-g-750-F and MaSp-g-750-R, whose sequences correspond to SEQ ID NO: 21 (AACGGTGGATACTTGCCTGG) and SEQ ID NO: 22 (CCAGTCTTGATCTGGCAGCA), respectively. Lane M: DNA marker; Lane NC: Jingsong silkworm; Lane CON: sterile double-distilled water; NQS silk gland tissue: NQS F1 generation silk gland. Total RNA was extracted from the posterior silk gland at day 4 of the fifth instar and analyzed by RT-PCR. B, PCR detection of the DsRed-SV40 fragment in the NQS F1 generation. The primer pairs used were SV40-F and SV40-R, corresponding to SEQ ID NO: 23 (GGCTCCAAGGTGTACGTGAA) and SEQ ID NO: 24 (GGTGTAGTCCTCGTTGTGGG), respectively. Lane M: DNA marker; Lane PC: pUC-target-Heavy-g; other lanes: NQS F1 silkworm genome. C, Sanger sequencing results of the DsRed-SV40 fragment. The boxes indicate the sequences of the SV40-F and SV40-R primers. D, Western blotting analysis of MaSp-g expression in the silk gland. Total protein from the posterior silk gland at day 4 of the fifth instar was separated by 10% SDS-PAGE and analyzed by Western blotting. The primary antibody was MaSp-g (rabbit, 1:1000), the secondary antibody was HRP-conjugated goat anti-mouse IgG (1:5000), and the internal control was α-tubulin (mouse, 1:5000). Lane M, protein marker; Lane CON, Jingsong control; Lane NQS, NQS F1 silk gland. DETAILED DESCRIPTION

[0041] The specific operating methods involved in the present invention are conventional methods, such as the specific operations of cloning, enzyme digestion, silkworm egg injection, and incubation until the moth is born. The testing methods involved are also conventional techniques. Except for the specially designated designed sequences and vectors, the raw materials and reagents involved are all conventional products. The present invention is further described below with reference to the accompanying drawings and examples:

[0042] Example 1 Preparation of gene-targeted silkworms in which the MaSp-g gene replaces the fib-H gene of silkworms and preparation of composite silk fibers of spider ampulla silk protein and silkworm silk protein

[0043] (1) Construction of pUC-target-Heavy-g plasmid: The plasmid was synthesized from scratch by a commercial company according to the sequence of SEQ ID NO: 1. This is a conventional technique. Its structure and targeting principle are shown in Figure 1. That is, the flanking sequence of the silkworm fib-H gene is used as the homologous arm, and the codon-optimized full-length golden silk spider large ampullate gland silk protein MaSp-g gene expression cassette controlled by the Fib-H promoter and the DsRed gene expression cassette controlled by the 3×P3 promoter are inserted in the middle. The gDNA array controlled by the U6 promoter is inserted downstream of the homologous right arm. The transcription product gRNA can target different regions of the Fib-H gene. After the plasmid is introduced into the silkworm egg, the Fib-H locus is cut under the action of Cas12a through the CRISPR-Cas12a genome editing system, and the MaSp-g expression cassette and the DsRed gene expression cassette replace the fib-H locus through homologous recombination.

[0044] (2) Construction of plasmid piggyCPF1 expressing Cas12a nuclease: The plasmid was synthesized from scratch by a commercial company according to SEQ ID NO: 2, which is a conventional technique.

[0045] (3) Microinjection of silkworm eggs: 3 hours after laying, silkworm eggs (variety Nistari) were microinjected with a mixture of pUC-target-Heavy-g (4500 ng / μL) and piggyCPF1 (15000 ng / μL) (V:V = 5:1). 10 nL was injected into each egg, and a total of 1140 silkworm eggs were injected.

[0046] (4) Rearing and seed production: Silkworm eggs were incubated at 25℃, with a hatching rate of 24.9%. The silkworms were reared conventionally until they formed clusters, spun cocoons, became pupae and emerged as moths, and a total of 68 moths were obtained. The male and female were mated, and 29 moth-ring silkworm eggs were obtained.

[0047] (5) Extraction of silkworm moth genomic DNA: Extract the parental DNA of 29 moth circles with phenol and chloroform, and adjust the DNA concentration to 1 μg / μL.

[0048] (6) PCR detection of DsRed: Using the DNA from step (5) as a template, PCR amplification was performed using the primer pair DsRed-F1 and DsRed-R1. The amplification conditions were: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 50 seconds, annealing at 55°C for 50 seconds, and extension at 72°C for 20 seconds, for 35 cycles. The amplification was then incubated at 72°C for 10 minutes. The PCR products were electrophoresed on a 1% agarose gel. The results are shown in Figure 2. A specific band representing the DsRed fragment (173 bp) was detected in the DNA of 14 silkworm moths.

[0049] (7) Preparation of G1 generation and PCR detection: After PCR detection of moths that showed positive DsRed in their parents, they were forced to hatch and then reared normally until they formed cocoons, pupated, and emerged as moths. Male and female moths in the same moth group mated and laid eggs to obtain G1 silkworm eggs, and their parent male and female moths were preserved, i.e., G1 generation silkworms. DNA of G1 generation silkworms was extracted and PCR amplified using the Heavy-gF and Heavy-gR primer pairs. The amplification conditions were pre-denaturation at 95℃ for 5 minutes, denaturation at 95℃ for 50 seconds, annealing at 55℃ for 50 seconds, and extension at 72℃ for 35 seconds, for 35 cycles. Then, the amplification was carried out at 72℃ for 10 minutes. The PCR product was electrophoresed on a 1% agarose gel. The results are shown in Figure 3. After the PCR product (523 bp) was recovered, it was cloned into the pMD-19-T vector and subjected to Sanger sequencing. The results showed that its sequence was that of MaSp-g.

[0050] (8) Preparation and PCR detection of G2-G4 generations: After the G1 generation silkworm eggs corresponding to the G1 generation silkworm moths were hatched, they were raised normally until they formed cocoons, pupated, and emerged as moths. Male and female moths in the same moth area mated and laid eggs to obtain G2 silkworm eggs, and their parent male and female moths, i.e., G2 generation silkworm moths, were preserved. Similarly, G3 and G4 generation silkworm eggs and corresponding G3 and G4 generation silkworm moths were obtained in turn. PCR detection and Sanger sequencing were performed as above, and the results are shown in Figure 3. PCR amplification of DNA from different silkworm moths of G1-G4 generations using the Heavy-gF and Heavy-gR primer pairs amplified a specific band of 523 bp; Sanger sequencing confirmed that the amplified product was the sequence of MaSp-g.

[0051] After the G4 generation silkworm eggs are accelerated to hatch, they are raised normally until they spin cocoons, pupate and emerge as moths. Male and female moths in the same moth area mate and lay eggs to obtain G5 generation silkworm eggs.

[0052] (9) Identification of gene-targeted pure lines: In order to exclude the possibility that the MaSp-g gene was randomly integrated into the silkworm genome, G5 generation silkworm moths were randomly selected, genomic DNA was extracted, and PCR identification was performed using different primer pairs. The PCR products were electrophoresed on 1% agarose gel. The results are shown in Figure 4. The Heavy-gF and Heavy-gR primer pairs can amplify a MaSp-g fragment consistent with the theoretical value (523 bp); the DsRed-F and DsRed-R primer pairs can amplify a DsRed fragment consistent with the theoretical value (838 bp); PCR was performed using the primer Left-F1 targeting the upstream sequence of the fib-H genome and the primer Left-R2 targeting the homologous left arm in pUC-target-Heavy-g, and a product consistent with the theoretical value (2033 bp) was amplified. The product was recovered and further PCR amplified using the primers Left-F2 and Left-R2 targeting the homologous left arm, and a PCR product consistent with the theoretical value (480 bp) was amplified; PCR was performed using the primer Right-F1 targeting the homologous right arm in pUC-target-Heavy-g and the primer Right-R2 targeting the downstream sequence of the fib-H genome, and a product consistent with the theoretical value (3210 bp) was amplified. PCR products matching the target sequence (995 bp) were recovered and further amplified using the homologous right arms Right-F2 and Right-R2 in pUC-target-Heavy-g. A specific band consistent with the theoretical value (995 bp) was amplified. Sequencing results, shown in Figure 5, show that the sequences of these PCR products were completely consistent with the gene targeting design. Furthermore, the FibH-F and FibH-R primer pairs failed to amplify the Fib-H gene fragment from the silkworm genome, indicating that the fib-H gene is no longer present in the silkworm genome tested. These results demonstrate that MaSp-g has replaced the fib-H gene as designed and has been correctly integrated into the silkworm genome, resulting in pure lines of gene-targeted silkworms.

[0053] The sequences of primer pairs Heavy-gF and Heavy-gR correspond to SEQ ID NO: 3 and SEQ ID NO: 4; the sequences of Left-F1, Left-F2, Left-R2 correspond to SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; the sequences of DsRed-F and DsRed-R correspond to SEQ ID NO: 8, SEQ ID NO: 9; the sequences of Right-F1, Right-R2, Right-F2 correspond to SEQ ID NO: 10 and SEQ ID NO: 11, SEQ ID NO: 12; the sequences of FibH-F and FibH-R are SEQ ID NO: 13, SEQ ID NO: 14, respectively; and the sequences of dsRed-F1 and dsRed-R1 correspond to SEQ ID NO: 15, SEQ ID NO: 16.

[0054] The present invention first identifies whether the silkworm is a transgenic silkworm, then identifies whether the transgenic silkworm is a gene-targeted silkworm, that is, whether the spider silk gene replaces the Bombyx mori fibroin heavy chain gene; finally, identifies whether the obtained silkworm is a pure line of targeted silkworm, that is, the Bombyx mori fibroin heavy chain genes on two homologous chromosomes are both replaced by spider silk genes.

[0055] (10) Detection of MaSp-g expression in the posterior silk gland: Total RNA was extracted from the posterior silk gland of G5 generation 5th instar silkworms on the 4th day, and the relative expression level of the MaSp-g gene was detected by qRT-PCR using the primer pair MaSp-gF and MaSp-gR. The internal reference gene selected was the eukaryotic initiation factor 4A (TIF4A) gene, and the quantitative primers were TIF-4A-F and TIF-4A-R. The results are shown in Figure 6. In the non-transgenic control group of silkworms (variety Nistari), the expression of MaSp-g was not detected, while in the targeted silkworms, the expression of MaSp-g was clearly detected (Figure 6A). At the same time, Western blotting was performed on the posterior silk gland of G5 generation 5th instar silkworms on the 4th day using MaSp-g antibody, with α-tubulin as the internal reference protein. The results showed (Fig. 6B) that a specific signal band (225.35 kDa) was observed in the posterior silk gland samples of gene-targeted silkworms, but it was not detected in the non-transgenic control silkworms, indicating that MaSp-g was successfully expressed.

[0056] (11) Detection of MaSp-g in gene-targeted silkworm cocoons: After degumming the gene-targeted silkworm cocoons, the fibroin protein solution was extracted (conventional method). After SDS-PAGE separation, Western blotting detection was performed using MaSp-g antibodies. A specific signal band consistent with the theoretical molecular weight of MaSp-g (225.35 kDa) was detected. However, no specific signal of MaSp-g was detected in the non-gene-targeted control silkworm (variety Nistari), proving that the expressed MaSp-g entered the cocoon (Figure 7A). Furthermore, the specific bands on the PAGE gel were recovered and identified by mass spectrometry. The results showed that specific peptides derived from MaSp-g could be detected (Figure 7B), proving that the MaSp-g expressed in the targeted silkworm was secreted into the cocoon.

[0057] (12) Preparation of spider silk protein-bombyx mori silk protein composite silk fibers: G5 generation silkworms are reared normally until they mature, and then moved to a cocoon maker and cocooned at 25°C. The cocoons are harvested after 7 days. The cocoons are dried and stored. Before reeling, the stored dry cocoons are degummed and then reeled to obtain spider silk protein-bombyx mori silk protein composite silk fibers. In actual production, spider silk protein-bombyx mori silk protein composite silk fibers can be obtained by rearing silkworms after G5 generation normally.

[0058] Mechanical properties of composite silk fibers made from spider silk protein and Bombyx mori silk protein: Eight G5 cocoons were randomly selected and degummed. Silk fibers from two different regions were then subjected to single fiber mechanical property testing. The results showed that the average maximum stress of the silkworm-spider chimeric silk fibers was 449.33 MPa, a 30.03% increase compared to the non-transgenic control group, and the average maximum elastic strain was 13.88%, a 28.60% increase compared to the control group (Figure 8).

[0059] Example 2 Preparation of spider silk protein-bombyx mori silk protein composite silk fibers by hybridizing the gene-targeted pure line with the current variety of Jingsong silkworm

[0060] (1) Obtaining gene-targeted pure lines: Same as steps (1) to (9) in Example 1.

[0061] (2) Preparation of NQS F1 generation silkworm eggs: The gene-targeted pure-line silkworms of step (1) are reared and developed into moths, and then mated with the silkworm variety Jingsong Bombyx mori. The eggs laid by the female moths are NQS F1 generation silkworm eggs.

[0062] (3) Detection of NQS F1 generation silkworms: NQS F1 generation silkworm eggs were incubated and raised normally after hatching. On the 4th day of the 5th instar, silk gland tissue was collected and RNA was extracted. After reverse transcription into cDNA, PCR detection was performed using primers MaSp-g-750-F (SEQ ID NO: 21) and MaSp-g-750-R (SEQ ID NO: 22). A specific band of 750 bp, consistent with the theoretical value, was amplified from the NQS F1 silk gland cDNA (Figure 9A). The genome of NQS F1 generation silkworm was extracted and PCR identification was performed using primers SV40-F (SEQ ID NO: 23) and SV40-R (SEQ ID NO: 24). A target fragment consistent with the theoretical molecular weight (426 bp) was detected (Figure 9B). Sequencing results showed that the sequence of the PCR product was a partial sequence of DsRed with SV40 tailing signal, which was derived from the pUC-target-Heavy-g plasmid (Figure 9C). Western blotting of total protein from the silk glands of the NQS F1 generation of silkworms using MaSp-g antibodies revealed the observation of a specific band representing MaSp-g (Fig. 9D), indicating that MaSp-g is expressed in the NQS F1 system and that the MaSp-g gene can be propagated through hybridization.

[0063] (4) Preparation of spider silk protein-bombyx mori silk protein composite silk fibers: NQS F1 generation silkworms were raised normally until they matured. The mature silkworms were moved to a cocoon maker and cocooned at 25°C. The cocoons were harvested after 7 days. The cocoons were dried and stored. Before reeling, the stored dry cocoons were degummed and then reeled to obtain spider silk protein-bombyx mori silk protein composite silk fibers.

Claims

1. A method for preparing spider silkworm composite silk fibers based on gene targeting silkworms, characterized in that: The following steps are involved: (1) Construction of gene targeting vector pUC-target-Heavy-g; (2) mixing the gene targeting vector pUC-target-Heavy-g with a plasmid expressing Cas12a nuclease, and then introducing it into the newly laid eggs of silkworms, and then hatching them; or preparing a transgenic silkworm BmCas12a expressing Cas12a nuclease, and introducing pUC-target-Heavy-g into the newly laid eggs of transgenic silkworms BmCas12a, and then hatching them; (3) After the silkworms first lay eggs and hatch, they are reared until they become moths, and then the male and female mate to obtain the moth-shaped silkworm eggs; (4) using specific primers to amplify the DNA of the parental moths in the moth circle silkworm eggs and screen the eggs laid by the gene-targeted silkworm moths; (5) After the eggs produced by the mating of gene-targeted silkworm moths are incubated, they are raised normally until they become moths, and the moths mate and lay eggs in the same moth area; then, the moth DNA is amplified using specific primers, and the amplified products are sequenced and verified, and the eggs produced by the mating of gene-targeted silkworm moths whose male and female parents are pure lines are selected for succession; (6) After the eggs obtained in step (5) are hatched, they are raised to cocoons to obtain spider silkworm composite silk fibers.

2. A method for constructing a gene-targeted silkworm of a spider silkworm composite silk fiber, characterized in that: The following steps are involved: (1) Construction of gene targeting vector pUC-target-Heavy-g; (2) mixing the gene targeting vector pUC-target-Heavy-g with a plasmid expressing Cas12a nuclease, and then introducing it into the newly laid eggs of silkworms, and then hatching them; or preparing a transgenic silkworm BmCas12a expressing Cas12a nuclease, and introducing pUC-target-Heavy-g into the newly laid eggs of transgenic silkworms BmCas12a, and then hatching them; (3) After the silkworms first lay eggs and hatch, they are reared until they become moths, and then the male and female mate to obtain the moth-shaped silkworm eggs; (4) using specific primers to amplify the DNA of the parental moths in the moth circle silkworm eggs and screen the eggs laid by the gene-targeted silkworm moths; (5) After the eggs produced by the mating of gene-targeted silkworm moths are incubated, they are raised normally until they become moths, and the moths mate and lay eggs in the same moth area; then, the moth DNA is amplified using specific primers, and the amplified products are sequenced and verified, and the eggs produced by the mating of gene-targeted silkworm moths whose male and female parents are pure lines are selected for succession; (6) After the eggs obtained in step (5) are hatched, gene-targeted silkworms producing spider silkworm composite silk fibers are obtained.

3. A method for constructing gene-targeted silkworm eggs of spider silkworm composite silk fibers, characterized in that: The following steps are involved: (1) Construction of gene targeting vector pUC-target-Heavy-g; (2) mixing the gene targeting vector pUC-target-Heavy-g with a plasmid expressing Cas12a nuclease, and then introducing it into the newly laid eggs of silkworms, and then hatching them; or preparing a transgenic silkworm BmCas12a expressing Cas12a nuclease, and introducing pUC-target-Heavy-g into the newly laid eggs of transgenic silkworms BmCas12a, and then hatching them; (3) After the silkworms first lay eggs and hatch, they are reared until they become moths, and then the male and female mate to obtain the moth-shaped silkworm eggs; (4) using specific primers to amplify the DNA of the parental moths in the moth circle silkworm eggs and screen the eggs laid by the gene-targeted silkworm moths; (5) The eggs produced by the mating of gene-targeted silkworm moths whose parents are gene-targeted are incubated for incubation, and then raised normally until they become moths, and then mate and lay eggs in the same moth area; then the moth DNA is amplified using specific primers, and the amplified products are sequenced for verification, and the eggs produced by the mating of gene-targeted silkworm moths whose male and female parents are both pure lines are selected as gene-targeted silkworm eggs for producing spider silkworm composite silk fibers.

4. The method according to claim 1, claim 2 or claim 3, characterized in that: pUC-target-Heavy-g uses the flanking sequence of the silk heavy chain gene as the homology arm, and clones the gene sequence expression cassette encoding the golden silk weaving spider large ampullate gland silk protein controlled by the silk heavy chain gene promoter and the fluorescent protein gene controlled by the 3×P3 promoter between the left and right homology arms, and clones the gRNA expression cassette targeting the silk heavy chain gene controlled by the silkworm U6 promoter downstream of the right homology arm; the plasmid expressing Cas12a nuclease is the plasmid piggyCPF1 expressing Cas12a nuclease.

5. The method according to claim 4, characterized in that The DNA sequence of pUC-target-Heavy-g is SEQ ID NO: 1; the DNA sequence of plasmid piggyCPF1 expressing Cas12a nuclease is SEQ ID NO:

2.

6. The method according to claim 1, claim 2 or claim 3, characterized in that: In step (4), the specific primers are a primer pair for amplifying the gene of the major ampullate gland silk protein of the web spider, a primer pair for amplifying the fluorescent protein gene, a primer pair for detecting the left insertion site of the exogenous DNA, and a primer pair for detecting the right insertion site of the exogenous DNA; in step (5), the specific primer pair is a primer pair for detecting whether the obtained silkworm is a pure line target silkworm.

7. The spider silkworm composite silk fiber obtained by the method of claim 1, claim 2 or claim 3, the gene-targeted silkworm of the spider silkworm composite silk fiber, and the gene-targeted silkworm egg of the spider silkworm composite silk fiber.

8. Use of the gene-targeted silkworms for the spider silkworm composite silk fiber or the gene-targeted silkworm eggs for the spider silkworm composite silk fiber as breeding materials according to claim 7.

9. Use of the DNA fragment described in SEQ ID NO: 1 and / or the DNA fragment described in SEQ ID NO: 2 in the preparation of composite silk fibers of spider ampullate silk protein and Bombyx mori silk protein.

10. Use of the gene-targeted silkworm for the spider silkworm composite silk fiber of claim 7 or the gene-targeted silkworm eggs for the spider silkworm composite silk fiber in the preparation of the spider silkworm composite silk fiber of claim 7.

Images