Minimal polypeptide-encoding rnas

Abstract

The present invention relates to minimal polypeptide-encoding RNA molecules, in particular, RNA molecules that lack or comprise shortened regulatory sequences as compared to those found in eukaryotic mRNAs, which are thus more amenable to chemical synthesis. The invention also encompasses compositions comprising distinct populations of said RNA molecules, each encoding a unique polypeptide, and methods for manufacturing and using the RNA molecules or compositions.

Description

[0001] MINIMAL POLYPEPTIDE-ENCODING RNAs

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to polypeptide-encoding RNA molecules, in particular, polypeptide-encoding RNA molecules that lack or comprise shortened regulatory sequences as compared to those found in eukaryotic mRNAs, which are thus more amenable to chemical synthesis. The invention also encompasses compositions comprising distinct populations of said RNA molecules, each encoding a unique polypeptide, and methods for manufacturing and using the RNA molecules or compositions.

[0004] BACKGROUND OF THE INVENTION

[0005] Messenger RNAs (mRNAs) are single-stranded RNA molecules that encode polypeptide sequences; they act as an intermediary between heritable sequences encoded by DNA and the transient polypeptide gene products thereof. The introduction of recombinant and / or heterologous polypeptides into target cells using exogenous mRNAs has numerous biotechnological and pharmaceutical applications.

[0006] Recombinant mRNAs are typically designed to mimic mRNAs produced naturally in a cell, so that they are translated by the cellular machinery already present. Eukaryotic mRNAs are complex molecules that comprise numerous regulatory elements that can modulate both stability of the mRNA, and translation of the polypeptide therefrom. These regulatory elements may be intrinsic to the sequence encoded by the DNA template - such as 5’ and 3’ untranslated region sequences (UTRs) - or extrinsic, being added to the RNA co- or post- transcriptionally - such as 5’cap structures and polyA tails.

[0007] For example, 5’cap structures can be added during transcription of mRNAs (or pre-mRNAs), wherein the 5’ terminus of the nascent polynucleotide is capped with the addition of a 7- methylguanosine by a triphosphate linkage (m7Gppp), in order to regulate nuclear export, improve the stability of the molecule and promote translation.

[0008] Further, mRNAs also comprise regions of untranslated sequence, known as UTRs, which regulate translation by various means. For example, internal ribosome entry site (IRESs) sequences recruit ribosomes to the 5’UTR and thereby facilitate translation.

[0009] Eukaryotic mRNAs also comprise polyA tails, a tract of adenosine nucleotides at the 3’ end of the molecule that are added co-transcriptionally. Mammalian polyA tails are typically around 200 nucleotides in length and are associated with mRNA stability and translational regulation. PolyA shortening (deadenylation), for example, is associated with translational repression (Passmore & Coller, 2022, PMID: 34594027).

[0010] Recombinant mRNA produced in vitro is widely used for vaccination and is being studied for various indications. These recombinant mRNAs typically contain, from 5’ to 3’, a 5’ cap, 5'IITR, start codon, ORF, stop codon, 3'IITR, and a polyA tail. Like naturally occurring eukaryotic mRNAs, which typically exceed 1000 nucleotides in length, these recombinant mRNAs are relatively long molecules.

[0011] Whilst the length of an RNA is not a key limitation for the generation of recombinant RNAs for protein expression using in vitro transcription (IVT), it represents a challenge for the production of RNAs by chemical synthesis methods (i.e., template independent synthesis).

[0012] For certain applications, chemical synthesis of RNA molecules - i.e., synthesis that does not rely on transcription from a DNA template - is advantageous over IVT-production. For example, IVT requires that a DNA template is first generated before being subjected to the IVT procedure. It is then necessary to purify the resultant RNA from this complex mixture of nucleotides and enzymes / proteins. This procedure, by comparison with the direct chemical synthesis of the RNA of interest, is indirect and time consuming.

[0013] There is thus a need for the development of RNAs that are amenable to chemical synthesis but which retain the ability to express a polypeptide in a cell.

[0014] It has previously been shown (WO 2021 / 038089 A1) that certain regulatory elements can be removed from mRNAs to produce synthetic RNA molecules, termed “ChemRNAs” therein, capable of expressing a polypeptide.

[0015] SUMMARY OF THE INVENTION

[0016] The present invention relates to minimal protein-encoding RNA molecules that possess an ORF that is capable of being translated in a cell.

[0017] The RNA molecules of the invention lack lengthy or complex regulatory elements found in natural and recombinant RNAs, which improves both the time and cost efficiency of production by chemical synthesis. Chemically synthesized RNAs are advantageous over IVT mRNAs in a number of scenarios. In particular, in the context of personalized medicines - such as anti-cancer vaccines - the rapid and adaptable production of custom RNAs by chemical synthesis, without the need to first generate a DNA template and perform enzymatic IVT reactions, allows the time and cost effective generation of subject- or application-specific RNA molecules.

[0018] The present inventors have developed a number of particularly effective minimal proteinencoding RNA molecule structures that allow for the efficient production of polypeptides and the stimulation of antigen specific T-cell responses. These particularly effective proteinencoding RNA molecule structures have been further improved by the present inventors by, for example, the introduction of chemical modifications to the constituent nucleotides of molecules or the modular components thereof. In particular, the present inventors have found that the introduction of modified internucleoside linkages (i.e., non-canonical / non- phosphodiester internucleoside linkages) - including the introduction of an alternating pattern of internucleoside linkages - can augment and enhance the activity of RNAs of the invention.

[0019] Further, the present inventors show that administration of a vaccine comprising a mixture of RNA molecules encoding a plurality of antigens is capable of inducing polypeptide-specific T cells against each antigen, in vivo.

[0020] The present invention therefore paves the way for individualized RNA-based vaccines, wherein the short length of the RNA components not only simplifies the design and application of such treatments, but also allows them to be rapidly produced, without the need for e.g., expensive 5'cap analogues or laborious IVT procedures, using oligonucleotide synthesizers that can produce multiple chemically synthesized RNAs in parallel. This circumvents the need for creating DNA templates and conducting in vitro enzymatic transcription, which would help to further streamline, accelerate and scale up the process of developing personalized vaccines in a time and cost-effective manner.

[0021] In the context of anti-cancer vaccines, it is envisaged that groups of subject-specific antigens or epitopes, in particular neo-antigens or neo-epitopes, could be identified and corresponding polypeptide (e.g., epitope / neo-epitope) encoding RNAs produced rapidly and efficiently to generate a personalized medicament.

[0022] In one aspect, the invention provides a composition comprising two or more discrete populations of RNA molecules, wherein the RNA molecules of each population comprise an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, wherein the RNA molecule is of formula (i):

[0023] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0024] X comprises one or more upstream elements selected from a:

[0025] (a) 5’cap;

[0026] (b) 5’IITR; and / or

[0027] (c) start codon; and / or;

[0028] Y comprises one or more downstream elements selected from a:

[0029] (d) stop codon;

[0030] (e) 3’IITR; and / or

[0031] (f) polynucleotide tract, optionally a polyA tract; and wherein the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF.

[0032] In one aspect, the invention provides a composition comprising two or more discrete populations of RNA molecules, wherein the RNA molecules of each population comprise an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, wherein the RNA molecule is of formula (i):

[0033] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0034] X comprises one or more upstream elements selected from a:

[0035] (a) 5’cap;

[0036] (b) 5’IITR; and / or

[0037] (c) start codon; and / or;

[0038] Y comprises one or more downstream elements selected from a:

[0039] (d) stop codon;

[0040] (e) 3’IITR; and / or

[0041] (f) polynucleotide tract, optionally a polyA tract; wherein the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF and wherein the length of any of the RNA molecules is not more than 200 nucleotides.

[0042] In one aspect, the invention provides a composition comprising two or more discrete populations of RNA molecules, wherein the RNA molecules of each population comprise an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, wherein the RNA molecule is of formula (i):

[0043] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0044] X comprises one or more upstream elements selected from a:

[0045] (a) 5’cap;

[0046] (b) 5’IITR; and / or

[0047] (c) start codon; and / or;

[0048] Y comprises one or more downstream elements selected from a:

[0049] (d) stop codon;

[0050] (e) 3’IITR; and / or

[0051] (f) polynucleotide tract, optionally a polyA tract; wherein the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF and wherein at least one of the two or more discrete populations of RNA molecules does not comprise one or more of the elements set out in (a) to (f).

[0052] In one aspect, the invention provides a composition comprising two or more discrete populations of RNA molecules, wherein the RNA molecules of each population comprise an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, wherein the RNA molecule is of formula (i):

[0053] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0054] X comprises one or more upstream elements selected from a:

[0055] (a) 5’cap;

[0056] (b) 5’IITR; and / or

[0057] (c) start codon; and / or;

[0058] Y comprises one or more downstream elements selected from a:

[0059] (d) stop codon;

[0060] (e) 3’IITR; and / or

[0061] (f) polynucleotide tract, optionally a polyA tract; wherein the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF; and wherein: (i) at least one of the two or more discrete populations of RNA molecules does not comprise one or more of the elements set out in (a) to (f); and / or

[0062] (ii) the length of any of the RNA molecules is not more than 200 nucleotides.

[0063] In another aspect, there is provided a pharmaceutical composition, the pharmaceutical composition comprising the composition of the invention and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0064] In a further aspect, there is provided an in vitro, in vivo, or ex vivo method of stimulating antigen-specific T cells, said method comprising the step of introducing the composition or pharmaceutical composition of the invention to one or more cells, optionally wherein the cells are capable of processing and presenting polypeptide epitopes to T cells and / or stimulating and / or activating T cells, preferably wherein one or more of the cells are dendritic cells.

[0065] In another aspect, there is provided the composition or pharmaceutical composition of the invention for use in medicine.

[0066] In another aspect, there is provided the composition or pharmaceutical composition of the invention for use in the treatment or prevention of cancer, infectious diseases, and / or allergies, optionally wherein the cancer is a solid cancer and / or is characterised by the presence of one or more cancer antigens, such as one or more cancer neo-epitopes.

[0067] A method of manufacturing a composition of the invention, said method comprising the step of:

[0068] (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules according to the invention, optionally wherein the chemical synthesis is solid-phase phosphoramidite synthesis; optionally, wherein the method additionally comprises the step(s) of:

[0069] (b) storing each discrete population of RNA molecules separately until required; and, optionally

[0070] (c) mixing the populations of RNA molecules synthesized in part (a) to form a composition comprising a mixture of discrete RNA populations.

[0071] Also provided herein are minimal protein-encoding RNA molecules, which have structures (or formulae) that allow for the efficient production of the polypeptide encoded by an ORF therein. In one aspect, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0072] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0073] X comprises one or more upstream elements selected from a:

[0074] (a) 5’ cap;

[0075] (b) 5’IITR; and / or

[0076] (c) start codon; and / or;

[0077] Y comprises one or more downstream elements selected from a:

[0078] (d) stop codon;

[0079] (e) 3’IITR; and / or

[0080] (f) polynucleotide tract, optionally a polyA tract.

[0081] In another aspect, there is provided a pharmaceutical composition, the pharmaceutical composition comprising the RNA molecule of the invention and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0082] In a further aspect, there is provided an in vitro, in vivo, or ex vivo method of stimulating antigen-specific T cells, said method comprising the step of introducing the RNA molecule or pharmaceutical composition of the invention to one or more cells, optionally wherein the cells are capable of processing and presenting polypeptide epitopes to T cells and / or stimulating and / or activating T cells, preferably wherein one or more of the cells are dendritic cells.

[0083] In another aspect, there is provided the RNA molecule or pharmaceutical composition of the invention for use in medicine.

[0084] In another aspect, there is provided the RNA molecule or pharmaceutical composition of the invention for use in the treatment or prevention of cancer, infectious diseases, and / or allergies, optionally wherein the cancer is a solid cancer and / or is characterised by the presence of one or more neo-antigens or neo-epitopes.

[0085] A method of manufacturing an RNA molecule of the invention, said method comprising the step of independent chemical synthesis of the RNA molecule, optionally wherein the chemical synthesis is solid-phase phosphoramidite synthesis. BRIEF DESCRIPTION OF THE FIGURES

[0086] Figure 1 - Immunogenicity of a mixture of cancer neoepitope-encoding RNAs in vivo

[0087] (A) Schematic of the experimental design. Four female C57BL / 6 mice per group were vaccinated three times i.v. using RNA-LPX encoding MC38 neoepitopes. A mixture of two IVT RNAs each encoding ten neoepitopes (Gr. 1) and a mixture of ten ChemRNAs, each encoding a single neoepitope (Gr. 2) were used. Blood was analyzed 7, 14, and 20 days after the first vaccination. On Day 20, mice were euthanized and splenocytes were analyzed for immunogenicity and T cell functionality and co-cultured with lipofected BMDCs to evaluate translational efficiency of various ChemRNA candidates. (B) Flow cytometry analysis of T cells from blood of mice immunized with RNA-LPX. Mean percentages ± SEM (n = 4) of neoepitopespecific T cells in CD8+T cells are depicted. (C-D) IFNy ELISpot analysis of splenocytes six days after the 3rd vaccination. (C) Splenocytes were restimulated with peptides. Each data point represents one mouse. Geometric mean of each treatment group is depicted as a horizontal line. Statistical significance was determined by nested t-test. ns = not significant; *** = p < 0.001 ; **** = p < 0.0001. (D) Splenocytes of treatment group 1 were pooled and cocultured with BMDCs lipofected with the indicated construct designs. Mean ± SEM of technical triplicates is shown. Dotted line shows the mean of construct design 12. The ORF of the depicted construct designs encoded either the minimal epitope only (M), or the minimal epitope with 3 flanking amino acids (M3), or the minimal epitope extended to a 20 or 27 amino acid long sequence with the mutation located in the center. IFN = interferon; IVT = in vitro transcription; LPX = Lipoplex; ORF = open reading frame; P-Thioate = Phosphorothioate internucleoside linkage; RNA = ribonucleic acid; UTR = untranslated region.

[0088] Figure 2 - Further assessment of the immunogenicity of a mixture of cancer neoepitope-encoding RNAs in vivo

[0089] (A) Schematic of the experimental design. Six female C57BL / 6 mice per group were vaccinated three times i.v. using RNA-LPX encoding MC38 neoepitopes. A mixture of two IVT RNAs each encoding ten neoepitopes (Gr. 1) or mixtures of ten ChemRNAs, each encoding a single neoepitope (Gr. 2 - 5) were used. Blood was analyzed 7, 14, and 21 days after the first vaccination. On Day 21 , mice were euthanized and splenocytes were analyzed for immunogenicity and T cell functionality. (B) Flow cytometry analysis of T cells from blood of mice immunized with RNA-LPX. Geometric mean (n = 6) of neoepitope-specific T cells in CD8+T cells are depicted. Each data point represents one mouse. Geometric mean of each treatment group is depicted as a horizontal line. Dotted lines show the geometric mean of Group 1 . Groups are, from left to right, Gr 1 to Gr 5. Statistical significance was determined by One-way Analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. ** = p < 0.01 ; **** = p < 0.0001. (C) IFNy ELISpot analysis of splenocytes seven days after the 3rd vaccination. Splenocytes were restimulated with peptides. Each data point represents one mouse. Geometric mean of each treatment group is depicted as a horizontal line. Dotted lines show the geometric mean of Group 1 . Statistical significance was determined by One-way Analysis of variance (ANOVA) with Dunnett’s multiple comparisons test, ns = not significant; * = p < 0.05; ** = p < 0.01 ; *** = p < 0.001 ; **** = p < 0.0001. IFN = interferon; LPX = Lipoplex; P-Thioate = Phosphorothioate internucleoside linkage; RNA = ribonucleic acid; UTR = untranslated region.

[0090] Figure 3 - Influence of poly(A) tail length on ChemRNA translation efficiency and T-cell activation in vitro

[0091] Translation efficiency was assessed using a HiBiT luciferase assay, in (A) immature dendritic cells (iDCs) electroporated with LargeBit-coding RNA (mean percentages ± SEM from two independent experiments, each with three technical replicates), or (B) HEK293 LgBiT cells (mean percentages ± SEM from a single experiment with three technical replicates). (A+B) T- cell activation was evaluated using a Jurkat-NFAT assay (mean percentages ± SEM from a single experiment with two technical replicates). The poly(A) tail length varied across the ChemRNA constructs (0, 6, 12, 18, 36, 60 nucleotides). AUC: Area under the curve; HiBiT: High-affinity LgBiT-binding peptide tag; iDCs: immature dendritic cells; NFAT: Nuclear Factor of Activated T-cells; ORF: open reading frame.

[0092] Figure 4 - Influence of phosphorothioate modifications on ChemRNA translation efficiency and T-cell activation in vitro

[0093] Translation efficiency was assessed using a HiBiT luciferase assay, in (A) immature dendritic cells (iDCs) electroporated with LargeBit-coding RNA (mean percentages ± SEM from two independent experiments, each with three technical replicates), or (B) HEK293 LgBiT cells (mean percentages ± SEM from a single experiment with three technical replicates). (A+B) T- cell activation was evaluated using a Jurkat-NFAT assay (mean percentages ± SEM from a single experiment with two technical replicates). The level of phosphorothioate modification varied across the ChemRNA constructs (none (-), entire construct (+), only in poly(A) tail (A), every second bond in poly(A) tail (A / 2) - i.e. , an alternating pattern of phosphorothioate and phosphodiester backbone linkages). AUC: Area under the curve; HiBiT: High-affinity LgBiT- binding peptide tag; iDCs: immature dendritic cells; NFAT: Nuclear Factor of Activated T-cells; ORF: open reading frame. Figure 5 - Influence of 5’UTR on ChemRNA translation efficiency and T-cell activation in vitro

[0094] Translation efficiency was assessed using a HiBiT luciferase assay, in (A) immature dendritic cells (iDCs) electroporated with LargeBit-coding RNA (mean percentages ± SEM from two independent experiments, each with three technical replicates), or (B) HEK293 LgBiT cells (mean percentages ± SEM from a single experiment with three technical replicates). (A+B) T- cell activation was evaluated using a Jurkat-NFAT assay (mean percentages ± SEM from a single experiment with two technical replicates). Different 5’UTR sequences were tested in the ChemRNA constructs (none (-), TISU (T), full TISU (FT), RPA39 (39), UTR2 (2), UTR7 (7), Aptamer (Apt); see also Table 1). AUC: Area under the curve; HiBiT: High-affinity LgBiT- binding peptide tag; iDCs: immature dendritic cells; NFAT: Nuclear Factor of Activated T-cells; ORF: open reading frame; UTR: untranslated region.

[0095] Figure 6 - Influence of nucleotide modifications on ChemRNA translation efficiency and T-cell activation in vitro

[0096] Translation efficiency was assessed using a HiBiT luciferase assay, in (A) immature dendritic cells (iDCs) electroporated with LargeBit-coding RNA (mean percentages ± SEM from two independent experiments, each with three technical replicates), or (B) HEK293 LgBiT cells (mean percentages ± SEM from a single experiment with three technical replicates). (A+B) T- cell activation was evaluated using a Jurkat-NFAT assay (mean percentages ± SEM from a single experiment with two technical replicates). Different nucleotide modifications were tested in the ChemRNA constructs (none (-), inverted thymidine (0T), 2’0-Methyladenosine (2’0), 5’ monophosphate (P), pseudouridine (^P)). AUC: Area under the curve; HiBiT: High-affinity LgBiT-binding peptide tag; iDCs: immature dendritic cells; NFAT: Nuclear Factor of Activated T-cells; ORF: open reading frame; UTR: untranslated region.

[0097] Figure 7 - Influence of poly(A) tail and 5‘ UTR on ChemRNA translation efficiency and T-cell activation in vitro

[0098] Translation efficiency was assessed using a HiBiT luciferase assay, in (A) immature dendritic cells (iDCs) electroporated with LargeBit-coding RNA (mean percentages ± SEM from two independent experiments, each with three technical replicates), or (B) HEK293 LgBiT cells (mean percentages ± SEM from a single experiment with three technical replicates). (A+B) T- cell activation was evaluated using a Jurkat-NFAT assay (mean percentages ± SEM from a single experiment with two technical replicates). ChemRNA constructs + / - 5’UTR and + / - poly(A) tail were tested. AUC: Area under the curve; HiBiT: High-affinity LgBiT-binding peptide tag; iDCs: immature dendritic cells; NFAT: Nuclear Factor of Activated T-cells; ORF: open reading frame; UTR: untranslated region.

[0099] DETAILED DESCRIPTION OF THE INVENTION

[0100] The present invention relates to polypeptide-encoding RNA molecules that lack regulatory sequences / elements that are found in eukaryotic mRNAs or comprise shortened or short versions of said elements. These minimal polypeptide-encoding RNAs are still capable of being translated in cellulo despite lacking certain regulatory elements, and their reduced length makes them a tractable target for chemical synthesis.

[0101] Minimal protein-encoding RNAs

[0102] The present inventors have found that certain RNA structures, or formulae, which comprise an ORF are capable of driving the expression of said ORF in cellulo.

[0103] The RNAs of the present invention are shorter than typical protein-encoding RNAs, namely mRNAs, found in eukaryotes.

[0104] Any of the following RNAs described herein may be utilised in a composition according to the present invention.

[0105] In one aspect, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0106] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0107] X comprises one or more upstream elements selected from a:

[0108] (a) 5’ cap;

[0109] (b) 5’UTR; and / or

[0110] (c) start codon; and / or;

[0111] Y comprises one or more downstream elements selected from a:

[0112] (d) stop codon;

[0113] (e) 3’UTR; and / or (f) polynucleotide tract, optionally a polyA tract.

[0114] The RNAs herein have a specific ‘structure’ or ‘formula’ which denotes the arrangement of sequence elements within the RNA molecule. RNAs of the invention comprise an ORF, with the optional inclusion of one or more upstream and / or downstream elements.

[0115] Irrespective the inclusion of any of the upstream / downstream elements, the ORF of the RNAs herein is capable of being translated in a cell, in particular in instances where no further or secondary components are provided for the purpose of promoting translation. In other words, the RNAs are capable of being translated in cellulo - whether that be in vitro / ex vivo, or in vivo

[0116] - by components already present within a cell.

[0117] In one embodiment, there is provided an RNA, wherein the RNA does not comprise one or more of the elements set out in (a) to (f) above, optionally wherein the RNA does not comprise 2, 3, 4, 5, or 6 of the elements set out in (a) to (f).

[0118] It is envisaged that any combination of the above identified up- or down-stream elements may be present or absent. In one embodiment, the RNA does not comprise a 5’cap. In one embodiment, the RNA does not comprise a 5’IITR. In one embodiment, the RNA does not comprise a start codon. In one embodiment, the RNA does not comprise a stop codon. In one embodiment, the RNA does not comprise a 3’IITR. In one embodiment, the RNA does not comprise a polyA tract. In one embodiment, the RNA does not comprise both a 3’IITR and a stop codon. In one embodiment, the RNA does not comprise both a 5’cap and a 3’IITR. In one embodiment, the RNA does not comprise any of: a 5’cap, stop codon, and 3’IITR.

[0119] In one embodiment, the RNA is of formula: start codon - ORF (formula ii). In one embodiment, the RNA is of formula: 5’IITR - start codon - ORF (formula iii). In one embodiment, the RNA is of formula: start codon - ORF - stop codon - polyA tract (formula iv). In one embodiment, the RNA is of formula: 5’cap - start codon - ORF (formula v). In one embodiment, the RNA is of formula: 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi). In one embodiment, the RNA is of formula: 5’cap - 5’IITR - start codon - ORF (formula vii). In one embodiment, the RNA is of formula: 5’cap - start codon - ORF - stop codon - polyA tract (formula viii). In one embodiment, the RNA is of formula: 5’cap - 5’IITR - start codon - ORF

[0120] - stop codon - polyA tract (formula ix).

[0121] It will be understood that an RNA with a recited formula - insofar as nucleotide sequence elements are concerned - consists of said formula, unless otherwise stated. In particular, it is noted that, the RNA of the present invention may comprise further non nucleotide sequence elements (e.g., chemical modifications, salts, or conjugates) that are not expressly defined in the formula.

[0122] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0123] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0124] X comprises one or more upstream elements selected from a:

[0125] (a) 5’cap;

[0126] (b) 5’IITR; and / or

[0127] (c) start codon; and / or;

[0128] Y comprises one or more downstream elements selected from a:

[0129] (d) stop codon;

[0130] (e) 3’IITR; and / or

[0131] (f) polynucleotide tract, optionally a polyA tract, wherein the RNA comprises one or more contiguous sequence(s) of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages.

[0132] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0133] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0134] X comprises one or more upstream elements selected from a:

[0135] (a) 5’cap;

[0136] (b) 5’IITR; and / or

[0137] (c) start codon; and / or;

[0138] Y comprises one or more downstream elements selected from a:

[0139] (d) stop codon;

[0140] (e) 3’IITR; and / or

[0141] (f) a polyA tract, wherein the RNA comprises a polyA tract that comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages, and optionally wherein the length of the RNA molecule is not more than 200 nucleotides in length.

[0142] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0143] X - ORF - Y (Formula i) wherein X may be absent or present, and if present:

[0144] X comprises one or more upstream elements selected from a:

[0145] (a) 5’ cap;

[0146] (b) 5’IITR; and / or

[0147] (c) start codon; wherein Y comprises a stop codon and a polyA tract; wherein the polyA tract comprises one or more modified internucleoside linkages and all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0148] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0149] X - ORF - Y (Formula i) wherein X may be absent or present, and if present:

[0150] X comprises one or more upstream elements selected from a:

[0151] (a) 5’cap;

[0152] (b) 5’IITR; and / or

[0153] (c) start codon; wherein Y comprises a stop codon and a polyA tract; wherein the polyA tract is 12 to 60 nucleotides in length and comprises one or more modified internucleoside linkages and all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages, optionally wherein the RNA is not more than 200 nucleotides in length.

[0154] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i): X - ORF - Y (Formula i) wherein X may be absent or present, and if present:

[0155] X comprises one or more upstream elements selected from a:

[0156] (a) 5’cap;

[0157] (b) 5’IITR; and / or

[0158] (c) start codon; wherein Y comprises a stop codon and a polyA tract; wherein the polyA tract is 12 to 60 nucleotides in length and comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages, and optionally wherein the RNA is not more than 200 nucleotides in length.

[0159] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0160] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0161] X comprises one or more upstream elements selected from a:

[0162] (a) 5’cap;

[0163] (b) 5’IITR; and / or

[0164] (c) start codon; and / or;

[0165] Y comprises one or more downstream elements selected from a:

[0166] (d) stop codon;

[0167] (e) 3’IITR; and / or

[0168] (f) polynucleotide tract, optionally a polyA tract, wherein the RNA comprises one or more contiguous sequence(s) of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages, and wherein the length of the RNA molecule is not more than 200 nucleotides in length.

[0169] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0170] X - ORF - Y (Formula i) wherein either X or Y may be absent, and when present: X comprises one or more upstream elements selected from a:

[0171] (a) 5’ cap;

[0172] (b) 5’IITR; and / or

[0173] (c) start codon; and / or;

[0174] Y comprises one or more downstream elements selected from a:

[0175] (d) stop codon;

[0176] (e) 3’IITR; and / or

[0177] (f) polynucleotide tract, optionally a polyA tract, wherein any one or more of (a) to (f), when present, comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage; wherein the ORF comprises only phosphodiester internucleoside linkages.

[0178] It will be understood that “one or more internucleoside linkage that is not a phosphodiester internucleoside linkage” is not intended to be limited to any one alternative / non-canonical internucleoside linkage type. In other words, any of the one or more internucleoside linkage that is not a phosphodiester internucleoside linkage (where there are two or more) may be different from one another (and also not phosphodiester linkages); multiple different types of non-canonical internucleoside linkage may be utilised in a given RNA.

[0179] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0180] X - ORF - Y (Formula i) wherein either X or Y may be absent, and when present:

[0181] X comprises one or more upstream elements selected from a:

[0182] (a) 5’ cap;

[0183] (b) 5’IITR; and / or

[0184] (c) start codon; and / or;

[0185] Y comprises one or more downstream elements selected from a:

[0186] (d) stop codon;

[0187] (e) 3’IITR; and / or

[0188] (f) polynucleotide tract, optionally a polyA tract, wherein the RNA is molecule is not more than 200 nucleotides in length; optionally, wherein any one or more of (a) to (f), when present, comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage; and optionally wherein the ORF comprises only phosphodiester internucleoside linkages.

[0189] In any of the foregoing embodiments, the construct may preferably be: 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi).

[0190] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0191] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the polyA tract is 12 to 60 nucleotides in length, preferably 18 to 36 nucleotides in length, and comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0192] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0193] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the 5’IITR comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the 5’IITR are phosphodiester internucleoside linkages.

[0194] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0195] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the polyA tract is 12 to 60 nucleotides in length, preferably 18 to 36 nucleotides in length (such as 18 or 36 nucleotides in length).

[0196] In one embodiment, there is provided an RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0197] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the polyA tract is greater than 30 nucleotides in length, preferably about 36 nucleotides in length, and wherein the RNA is not more than 200 nucleotides in length. In any of the foregoing embodiments, the RNA is preferably not more than 200 nucleotides in length.

[0198] Upstream and downstream elements

[0199] RNAs of the present invention preferably have short upstream and downstream elements, if they are present. The shorter the regulatory elements the shorter the overall RNA sequence, increasing the cost and time efficiency for production by chemical synthesis.

[0200] In one embodiment, the combined length of the upstream and downstream elements, if present, is fewer than 200 nucleotides, such as fewer than 190, fewer than 180, fewer than 170, fewer than 160, fewer than 150, fewer than 140, fewer than 130, fewer than 120, fewer than 110, fewer than 100, fewer than 90, fewer than 80, fewer than 70, fewer than 60, fewer than 60, fewer than 40, fewer than 30, fewer than 20, or fewer than 10 nucleotides in length.

[0201] In one embodiment, the combined length of the upstream and downstream elements, if present, is 3 to 200 nucleotides, 3 to 150 nucleotides, 3 to 110 nucleotides, 3 to 100 nucleotides, 3 to 90 nucleotides, 3 to 80 nucleotides, 3 to 70 nucleotides, 3 to 60 nucleotides, 3 to 50 nucleotides, 3 to 40 nucleotides, 3 to 30 nucleotides, 3 to 20 nucleotides, 3 to 10 nucleotides.

[0202] In one embodiment, the combined length of the upstream and downstream elements, if present, is 3 to 120 nucleotides. In one embodiment, the combined length of the upstream and downstream elements, if present, is 3 to 106 nucleotides. In one embodiment, the combined length of the upstream and downstream elements, if present, is 3 to 80 nucleotides. In one embodiment, the combined length of the upstream and downstream elements, if present, is 3 to 60 nucleotides. In one embodiment, the combined length of the upstream and downstream elements, if present, is 3 to 40 nucleotides.

[0203] The upstream elements may be selected from: a 5’cap, 5’UTR, and / or a start codon.

[0204] The downstream elements may be selected from a: stop codon, 3’UTR, and / or a polynucleotide tract, preferably a polyA tract.

[0205] Any suitable start and / or stop codon may be selected. In one embodiment, the start codon is an AUG start codon. In one embodiment, the stop codon is a UAA stop codon. Stop codons are preferably present when any downstream elements (other than the stop codon itself) are present in an RNA. In these cases, the stop codon may prevent translation beyond the ORF. Where no downstream elements are present, the 3’ end of the RNA represents the 3’ end of the ORF and thus translation termination may not be required.

[0206] In one embodiment, a stop codon is present when one or more other downstream elements are present in the RNA. In one embodiment, the RNA does not comprise a stop codon unless a downstream element is present.

[0207] The upstream and downstream elements may be unrelated to the ORF to which they are operably or physically linked (i.e. , by virtue of presence in the same RNA molecule), that is, they are not necessarily the elements that are associated with the ORF sequence, or the longer naturally-occurring sequence from which the encoded polypeptide is derived, as it is found in its natural context.

[0208] In one embodiment, one or more of the upstream and / or downstream elements is / are derived from a human nucleotide sequence. In one embodiment, one or more of the upstream and / or downstream elements is / are derived from a non-human nucleotide sequence, such as a mammalian (e.g., mouse), bacterial, fungal, or viral nucleotide sequence. In one embodiment, one or more of the upstream and / or downstream elements is / are synthetic sequences or modified sequences without an identical naturally occurring counterpart.

[0209] The upstream and downstream elements herein may be contiguous with one another such that one element abuts a next without any intervening nucleotides. Alternatively, the upstream and downstream elements herein may be separated by a linker or spacer sequence. Such linkers or spacers may be short sequences (e.g., of 1 to 10 nucleotides in length) that separate the elements described herein but are not part of that element sequence.

[0210] 5’caps

[0211] Naturally occurring 5’capping structures are complex and may add unnecessary and / or unwanted complexity to the chemical synthesis of RNAs. The present inventors have found that the inclusion of certain elements, such as polyA tracts and / or the use of phosphorothioate internucleoside linkages, are able to mitigate any reductions in stability that could be associated with the exclusion of 5’capping structures, whilst also keeping chemical synthesis time and cost efficient. Preferably the RNA of the invention does not comprise a 5’cap.

[0212] However, in one embodiment a 5’ cap is present in the RNA, optionally wherein the 5’ cap is included to improve stability and / or translational efficiency. In one embodiment, the RNA comprises a 5’cap structure. In one embodiment, the RNA does not have uncapped 5'- triphosphates. In one embodiment, the RNA may comprise a conventional 5’cap and / or a 5’cap analog.

[0213] The term "conventional 5’cap" refers to a cap structure found on the 5'-end of an RNA molecule and generally consists of a guanosine 5'-triphosphate (Gppp) which is connected via its triphosphate moiety to the 5'-end of the next nucleotide of the RNA ( / .e., the guanosine is connected via a 5' to 5' triphosphate linkage to the rest of the RNA). The guanosine may be methylated at position N7(resulting in the cap structure m7Gppp). The term "5’cap analog" includes a 5’cap which is based on a conventional 5’cap but which has been modified at either the 2'- or 3'-position of the m7guanosine structure in order to avoid an integration of the 5'-cap analog in the reverse orientation (such 5'-cap analogs are also called anti-reverse cap analogs (ARCAs)).

[0214] Particularly preferred 5'-cap analogs are those having one or more substitutions at the bridging and non-bridging oxygen in the phosphate bridge, such as phosphorothioate modified 5’cap analogs at the p-phosphate (such as m27’2 OG(5')ppSp(5')G (referred to as beta-S-ARCA or p- S-ARCA)), as described in PCT / EP2019 / 056502. The 5’cap structure may be attached to the RNA after synthesis using capping enzymes, for example, capping enzymes of vaccinia virus.

[0215] In one embodiment, the RNA comprises a 5’cap structure selected from the group consisting of: m27’2 OG(5’)ppSp(5')G (in particular its D1 diastereomer), m27’3 OG(5')ppp(5')G, and n ’3'" °Gppp(mi2'’°)ApG.

[0216] In one embodiment, the RNA comprises a capO, cap1 , or cap2, preferably cap1 or cap2.

[0217] According to the present disclosure, the term "capO" means the structure "m7GpppN", wherein N is any nucleoside bearing an OH moiety at position 2'. According to the present disclosure, the term "cap1" means the structure "m7GpppNm", wherein Nm is any nucleoside bearing an OCH3 moiety at position 2'. According to the present disclosure, the term "cap2" means the structure "m7GpppNmNm", wherein each Nm is independently any nucleoside bearing an OCH3 moiety at position 2'. The D1 diastereomer of beta-S-ARCA (P-S-ARCA) has the following structure:

[0218] The "D1 diastereomer of beta-S-ARCA" or "beta-S-ARCA(DI)" is the diastereomer of beta-S- ARCA which elutes first on an HPLC column compared to the D2 diastereomer of beta-S- ARCA (beta-S-ARCA(D2)) and thus exhibits a shorter retention time.

[0219] The 5’cap analog rri27,3''oGppp(mi2''o)ApG (also referred to as m27’3'oG(5')ppp(5')m2'oApG) which is a building block of a cap1 has the following structure:

[0220] An exemplary capO RNA comprising p-S-ARCA and RNA (here ‘mRNA’) has the following structure: An exemplary capO RNA comprising m27’3 OG(5')ppp(5')G and RNA (here ‘mRNA’) has the following structure:

[0221] An exemplary cap1 RNA comprising m27’3'oGppp(mi2'o)ApG and RNA (here ‘mRNA’) has the following structure:

[0222] In one embodiment, the 5’ cap is a beta-S-ARCA(DI) (m27’2'°GppSpG) or m27’3'°Gppp(mi2' °)ApG capping structure.

[0223] Other suitable capping structures may be known to the person skilled in the art and may be used in any of the RNAs of the present invention.

[0224] 5’UTRs and 3’UTRs

[0225] The term "untranslated region" (UTR) typically relates to a region derived from a DNA molecule that is transcribed into an RNA but is not subsequently translated into an amino acid sequence.

[0226] Herein, UTRs refer to a corresponding region of an RNA molecule that are not, as the name suggests, translated. The UTRs (if present) are chemically synthesized sequences and are therefore made without the requirement for a DNA template (i.e., they have not been transcribed). UTR sequences typically enhance the translation efficiency and / or stability of an RNA molecule.

[0227] UTRs used herein may be derived from naturally occurring DNA or RNA sequences. UTRs may be non-naturally occurring or synthetic, for example the UTR sequences may have been synthetically designed. In one embodiment, the 5’UTR and / or 3’UTR is derived from a human nucleotide sequence. In one embodiment, the 5’UTR and / or 3’UTR is derived from a nonhuman nucleotide sequence, such as a mammalian (e.g., mouse), bacterial, fungal, or viral nucleotide sequence. The UTR may have any sequence that is capable of enhancing the stability and / or translation efficiency of an RNA molecule.

[0228] UTRs can be present 5' (upstream) of an open reading frame (5’UTR) and / or 3' (downstream) of an open reading frame (3’UTR). A 5’UTR, if present, is located at the 5'-end, upstream of the start codon (if present), of the ORF. A 5’UTR is downstream of the 5’ cap (if present), e.g., directly adjacent to the 5'-cap.

[0229] In one embodiment, the 5’UTR is fewer than 100 nucleotides in length, such as fewer than 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, or fewer than 10 nucleotides in length. In one embodiment, the 5’UTR is 5 to 50 nucleotides in length, such as 5 to 45, 5 to 40, 5 to 35, 5 to 30, 5 to 25, 5 to 20, 5 to 15, or 5 to 10 nucleotides in length. In one embodiment, the 5’UTR is 5 to 25 nucleotides in length. In one embodiment, the 5’UTR is 5 to 15 nucleotides in length.

[0230] In one embodiment, the 5’UTR is selected from the group consisting of: TISU of SEQ ID NO: 69; full TISU of SEQ ID NO: 70; RPA39 of SEQ ID NO: 71 ; UTR2 of SEQ ID NO: 72; UTR7 of SEQ ID NO: 73; or aptamer of SEQ ID NO: 74.

[0231] Table 1 : exemplary 5’UTR sequences In one embodiment, the 5’UTR is a sequence having at least 60% sequence identity to any of SEQ ID NOs 69 to 74, preferably at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to any of SEQ ID NOs 69 to 74. In one embodiment, the 5’UTR is a sequence having at least 90% sequence identity to any of SEQ ID NOs 69 to 74. In one embodiment, the 5’IITR is a sequence comprising an insertion, deletion or substitution of 1 , 2, 3, 4, or 5 (optionally 1 or 2) nucleotides as compared to the sequence of any one of SEQ ID NOs 69 to 74.

[0232] In one embodiment, the 5’IITR is a naturally occurring UTR sequence, or a fragment of a naturally occurring UTR sequence, preferably a fragment of a naturally occurring UTR sequence that consists of 5 to 50 contiguous nucleotides of said naturally occurring UTR sequence.

[0233] In one embodiment, the 5’UTR comprises or consists of a ‘Kozak sequence’ or an optimized kozak sequence. Such sequences are known in the art. In one embodiment, the 5’UTR comprises an IRES.

[0234] A 3’UTR, if present, is located at the 3'-end, downstream of the termination codon of the ORF. Here, as is typical in the art, the term "3’UTR" does not include the polyA sequence, which is considered to be a separate element. Thus, the 3’UTR (if present) is upstream of the poly-A sequence (if present), e.g., directly adjacent to the poly-A sequence.

[0235] In one embodiment, the 3’UTR is fewer than 100 nucleotides in length, such as fewer than 90, 80, 70, 60, 50, 45, 40, 35, 30, 25, 20, 15, or fewer than 10 nucleotides in length. In one embodiment, the 3’UTR is 5 to 50 nucleotides in length, such as 5 to 45, 5 to 40, 5 to 35, 5 to 30, 5 to 25, 5 to 20, 5 to 15, or 5 to 10 nucleotides in length. In one embodiment, the 3’UTR is 5 to 25 nucleotides in length. In one embodiment, the 3’UTR is 5 to 15 nucleotides in length.

[0236] In one embodiment, the 3’UTR is a naturally occurring UTR sequence, or a fragment of a naturally occurring UTR sequence, preferably a fragment of a naturally occurring UTR sequence that consists of 5 to 50 contiguous nucleotides of said naturally occurring UTR sequence. In certain embodiments, the 3’UTR is derived from a globin gene or mRNA, such as a gene or mRNA of alpha2-globin, alphal-globin, or beta-globin, e.g., beta-globin, e.g., human beta-globin. Incorporation of a 5’IITR and / or 3’IITR into an RNA molecule can result in an enhancement in translation efficiency. The 5’IITR and / or 3’IITR may be autologous or heterologous to the RNA into which they are introduced.

[0237] In one embodiment, RNAs herein comprise a 5’IITR and / or a 3'IITR. In one embodiment, RNAs herein comprise a 5’IITR but do not comprise a 3'IITR. The inclusion of a 5’IITR and / or 3’IITR and the choice of sequence thereof is independent of the choices made in respect of the other UTR. That is, each may be selected independently of one another, and any other sequence elements in the RNA.

[0238] Polynucleotide tract

[0239] RNAs of the invention may comprise a polynucleotide tract, preferably a poly-adenosine or polyA tract. Such polyA tracts or ‘tails’ are well known in the art and are commonly found in mRNAs.

[0240] Mammalian polyA tails are typically around 200 nucleotides in length and are associated with mRNA stability and translational regulation. Preferably, polyA tracts within RNAs of the invention, if present, are shorter than polyA tracts found in naturally occurring or traditional IVT RNAs.

[0241] A polynucleotide tract is a stretch of contiguous nucleosides of a single identity (e.g., A, G, T / U, or C). In one embodiment the polynucleotide tract is a poly adenosine (polyA) tract.

[0242] In one embodiment the polynucleotide tract consists of 3 to 100 contiguous adenosine nucleotides, 3 to 90 contiguous adenosine nucleotides, 3 to 80 contiguous adenosine nucleotides, 3 to 70 contiguous adenosine nucleotides, 3 to 60 contiguous adenosine nucleotides, 3 to 50 contiguous adenosine nucleotides, 3 to 40 contiguous adenosine nucleotides, 3 to 30 contiguous adenosine nucleotides, 3 to 20 contiguous adenosine nucleotides, or 3 to 10 contiguous adenosine nucleotides.

[0243] In one embodiment the polynucleotide tract consists of 3 to 100 contiguous adenosine nucleotides. In one embodiment the polynucleotide tract consists of 3 to 60 contiguous adenosine nucleotides. In one embodiment the polynucleotide tract consists of 6 to 60 contiguous adenosine nucleotides. In one embodiment the polynucleotide tract consists of 12 to 60 contiguous adenosine nucleotides. In one embodiment the polynucleotide tract consists of 6 to 36 contiguous adenosine nucleotides. In one embodiment the polynucleotide tract consists of 6 to 60 contiguous adenosine nucleotides.

[0244] In one embodiment the polynucleotide tract consists of 12 to 60 contiguous adenosine nucleotides.

[0245] In one embodiment the polynucleotide tract consists of 18 to 60 contiguous adenosine nucleotides.

[0246] In one embodiment the polynucleotide tract consists of 18 to 36 contiguous adenosine nucleotides.

[0247] In one embodiment, the polyA tract consists of at least 3 contiguous adenosine nucleotides, such as at least 6 contiguous adenosine nucleotides, at least 12 contiguous adenosine nucleotides, at least 18 contiguous adenosine nucleotides, at least 24 contiguous adenosine nucleotides, at least 30 contiguous adenosine nucleotides, at least 36 contiguous adenosine nucleotides, at least 42 contiguous adenosine nucleotides, at least 48 contiguous adenosine nucleotides, at least 54 contiguous adenosine nucleotides, or at least 60 contiguous adenosine nucleotides.

[0248] In one embodiment, the polyA tract consists of about 12 contiguous adenosine nucleotides, about 13 contiguous adenosine nucleotides, about 14 contiguous adenosine nucleotides, about 15 contiguous adenosine nucleotides, about 16 contiguous adenosine nucleotides, about 17 contiguous adenosine nucleotides, about 18 contiguous adenosine nucleotides, about 19 contiguous adenosine nucleotides, about 20 contiguous adenosine nucleotides, about 21 contiguous adenosine nucleotides, about 22 contiguous adenosine nucleotides, about 23 contiguous adenosine nucleotides, about 24 contiguous adenosine nucleotides, about 25 contiguous adenosine nucleotides, about 26 contiguous adenosine nucleotides, about 27 contiguous adenosine nucleotides, about 28 contiguous adenosine nucleotides, about 29 contiguous adenosine nucleotides, about 30 contiguous adenosine nucleotides, about 31 contiguous adenosine nucleotides, about 32 contiguous adenosine nucleotides, about 33 contiguous adenosine nucleotides, about 34 contiguous adenosine nucleotides, about 35 contiguous adenosine nucleotides, about 36 contiguous adenosine nucleotides, about 37 contiguous adenosine nucleotides, about 38 contiguous adenosine nucleotides, about 39 contiguous adenosine nucleotides, or about 40 contiguous adenosine nucleotides. In one embodiment, the polyA tract consists of at least 30 contiguous adenosine nucleotides.

[0249] In one embodiment, the polyA tract consists of about 12 contiguous adenosine nucleotides.

[0250] In a preferred embodiment, the polyA tract consists of about 18 contiguous adenosine nucleotides.

[0251] In a preferred embodiment, the polyA tract consists of about 36 contiguous adenosine nucleotides.

[0252] In one embodiment, the polyA tract consists of about 60 contiguous adenosine nucleotides.

[0253] In one embodiment, the RNA does not comprise a polyA signal sequence (AALIAAA).

[0254] In one embodiment, the internucleoside linkage between adjacent A nucleotides in the poly A tract is composed of phosphodiester bonds. In one embodiment, the internucleoside linkage between adjacent A nucleotides in the poly A tract is composed of phosphorothioate bonds. In one embodiment, the internucleoside linkage between adjacent A nucleotides in the poly A tract are phosphorothioate bonds, but the internucleoside linkage between adjacent nucleotides in the remainder of the RNA molecule are phosphodiester bonds. A polyA tract of the present invention may comprise a contiguous stretch of A nucleotides in which the internucleoside linkage between each A nucleotide is not the same. In one embodiment, the internucleoside linkage between adjacent A nucleotides in the polyA tract is the same. In one embodiment, the internucleoside linkage between adjacent A nucleotides in the poly A tract is not the same. In one embodiment, the internucleoside linkage between adjacent A nucleotides in the poly A tract is composed of alternating bond types. In a preferred embodiment, the internucleoside linkage between adjacent A nucleotides in the poly A tract is composed of alternating phosphorothioate and phosphodiester bonds.

[0255] PolyA tracts are preferably synthesized as part of the RNA molecule of the invention, e.g., as opposed to addition by enzymatic processing after the initial synthesis is complete. In one embodiment, the polyA tract is a fully synthetic polyA tract that is synthesized in the same process as the rest of the RNA molecule in which it is present. The ORF

[0256] RNAs of the present invention comprise an open reading frame (ORF) that encodes a polypeptide that is capable of being expressed. In particular, the polypeptide is capable of being expressed when the RNA is introduced into a cell.

[0257] Herein, the terms peptide, polypeptide, and protein are used interchangeably and refer, as is standard in the art, to a polymer composed of two or more amino acid substituents.

[0258] The polypeptide of the present invention is preferably a polypeptide sequence that is found within a naturally occurring polypeptide sequence. Preferably the polypeptide of the present invention is shorter than the polypeptide from which it is derived. In other words, the polypeptide preferably represents a fragment, such as a contiguous fragment, of a longer naturally-occurring polypeptide sequence.

[0259] It is advantageous to select shorter sequence fragments for expression by the RNAs of the invention in order to maintain minimal RNA lengths and thus retain efficiency in chemical synthesis.

[0260] In one embodiment, the polypeptide encoded by the ORF has an amino acid sequence that is a contiguous amino acid sequence found in a naturally occurring protein, preferably a protein that is associated with a human disease or disorder.

[0261] In one embodiment, the ORF encodes a polypeptide that is derived from a single naturally- occurring polypeptide sequence.

[0262] In one embodiment, the ORF encodes a polypeptide that is a chimeric sequence having amino acid sequences derived from one or more naturally-occurring polypeptide sequences and / or one or more synthetic sequences.

[0263] It is not essential that the ORF comprises the same nucleotide sequence as the corresponding sequence that encodes the naturally occurring polypeptide (or equivalent fragment thereof). It will be understood that the nucleotide sequence that encodes the polypeptide sequence may be varied, due to the degeneracy of the triplet code, and still encode the same polypeptide.

[0264] In one embodiment, the ORF sequence (i.e., the polynucleotide sequence) is codon optimised.

[0265] In one embodiment, the RNA comprises only one ORF. The polypeptides encoded by the ORF, or shorter fragments thereof that may be generated by proteolytic processing in cellulo, are preferably able to be bound and presented by MHC molecules, preferably MHC class I molecules, to T cells. In one embodiment, the polypeptide encoded by the ORF comprises or consists of a contiguous amino acid sequence that is capable of forming a peptide-MHC complex (pMHC).ln one embodiment, the polypeptide encoded by the ORF comprises or consists of a contiguous amino acid sequence that is capable of forming a peptide-MHC complex (pMHC) and wherein said pMHC is capable of binding to a T cell receptor (TOR).

[0266] In a preferred embodiment, the MHC is a class I MHC and the TCR is a TCR derived from or presented on a CD8+ T cell.

[0267] Peptides that are presented by MHC-I are typically 8 to 11 amino acids in length. Polypeptides encoded by the ORF herein may therefore be designed to be suitable MHC-I ligands.

[0268] In order to mitigate potential error in antigen / MHC ligand predictions that would mean short (e.g., 8 to 11 amino acid) polypeptides may not be efficiently bound or presented by MHC-I, it is possible to design ORFs that are longer (e.g., >11 amino acids) than the typical length of polypeptides presented by MHC molecules. It is intended that such polypeptides are proteolytically processed in a cell, e.g., by the (immuno)proteasome, into shorter polypeptides (e.g., of around 8 to 11 amino acids in length), to generate suitable antigens for binding and presentation by MHC-I. Thus, in cellulo, a pool of polypeptides may be generated from a single polypeptide that is encoded by the ORF.

[0269] Alternatively, or in conjunction with the above, polypeptides encoded by the ORF may be selected or designed such that they are more amenable to presentation by MHC-I molecules, e.g., by favouring sequences with a hydrophobic C terminus.

[0270] In one embodiment, the polypeptide encoded by the ORF is 8 to 50 amino acids in length, preferably 8 to 27 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 8 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 9 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 20 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 21 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 27 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is at least 8 amino acids in length, such as at least 9 amino acids in length, at least 10 amino acids in length, at least 11 amino acids in length, at least 12 amino acids in length, at least 13 amino acids in length, at least 14 amino acids in length, at least 15 amino acids in length, at least 16 amino acids in length, at least 17 amino acids in length, at least 18 amino acids in length, at least 19 amino acids in length, at least 20 amino acids in length, at least 21 amino acids in length, at least 22 amino acids in length, at least 23 amino acids in length, at least 24 amino acids in length, at least 25 amino acids in length, at least 26 amino acids in length, at least 27 amino acids in length, at least 28 amino acids in length, at least 29 amino acids in length, or at least 30 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 20 to 30 amino acids in length. In one embodiment, the polypeptide encoded by the ORF is 8 to 15 amino acids in length.

[0271] In one embodiment, the polypeptide is capable of being processed in a cell to form a shorter polypeptide sequence than the sequence translated from the ORF. In one embodiment, the polypeptide is processed in a cell to form a shorter polypeptide sequence than the sequence translated from the ORF.

[0272] In one embodiment, the polypeptide encoded by the ORF is derived from a human polypeptide sequence. In one embodiment, the polypeptide encoded by the ORF is derived from a nonhuman polypeptide sequence. In one embodiment, the polypeptide encoded by the ORF is derived from any pathogen or commensal organism. In one embodiment, the polypeptide encoded by the ORF is derived from an animal pathogen or commensal organism. In one embodiment, the polypeptide encoded by the ORF is derived from a human pathogen or commensal organism. In one embodiment, the polypeptide encoded by the ORF is derived from a fungal, bacterial, or viral polypeptide sequence. In one embodiment, the polypeptide encoded by the ORF is derived from a viral polypeptide sequence.

[0273] In this context, ‘derived from’ is intended to indicate that the polypeptide sequence is a shorter version of a given naturally-occurring ‘parental’ polypeptide sequence (i.e., representing a region within a longer sequence) and / or a modified sequence as compared to the parental polypeptide sequence.

[0274] In one embodiment, the polypeptide encoded by the ORF is an allergen.

[0275] In one embodiment, the polypeptide encoded by the ORF is an auto-antigen. Auto-antigens or auto-immune antigens are antigens that are associated with autoimmune diseases or disorders. Thus, the auto-antigens may be considered disease-related autoantigens. RNAs herein may be used to express auto-antigens in a subject in a noninflammatory context in order to augment, alleviate, or treat autoimmune diseases, such as in Krienke et al., Science 371, 145-153 (2021).

[0276] In one embodiment, the peptide encoded by the ORF is or is derived from a cancer antigen, such as a tumour-associated antigen, a cancer non-neo-antigen, or a cancer neo-antigen. In one embodiment, the peptide encoded by the ORF is a cancer epitope, such as a cancer non- neo-epitope, or a cancer neo-epitope. A cancer epitope as referred to herein may be understood to refer to a peptide fragment (typically a peptide fragment capable of inducing an immune response (e.g., capable of forming a peptide-MHC complex (pMHC) as further described herein)) derived from a cancer antigen (i.e. , an antigen associated with a cancer or tumour), which may be patient-specific. In one embodiment, the peptide encoded by the ORF is a cancer antigen (such as a cancer neo-antigen) that is derived from a human subject, preferably wherein the subject is the intended recipient of the RNA in which the ORF is present.

[0277] General features of the RNA

[0278] The RNA molecules of the present invention are fully synthetic molecules that are designed and synthesized by a user.

[0279] In one embodiment, there exists no naturally-occurring RNA or DNA molecule with identical nucleotide sequence to the RNA of the invention.

[0280] The RNA molecules of the present invention are preferably single-stranded molecules, that is, they consist of a single polynucleotide molecule. This molecule may, for example, form regions of intra-strand secondary structure, but any such structure is not considered to make the molecule double-stranded. The RNA molecules of the invention typically do not comprise significant portions (e.g., more than 5 nucleotides) of complementarity, such that the RNA molecules typically do not comprise stable double-stranded hairpins.

[0281] In one embodiment, the RNA is a single-stranded RNA molecule. In one embodiment, the RNA comprises or consists of the sense strand of a sequence. In one embodiment, the RNA is not an antisense compound. In one embodiment, the RNA does not comprise or consist of an antisense strand of a sequence.

[0282] The RNA herein is preferably not an siRNA, an antisense oligonucleotide, miRNA, an aptamer, a short hairpin RNA (shRNA), or any other RNA sequence that (i) does not encode a polypeptide that is capable of being translated, and / or (ii) represents the whole or part of a polypeptide sequence that is naturally occurring and / or expressed by a cell naturally.

[0283] The RNA herein is also not a naturally occurring mRNA or pre-mRNA. Optionally, the RNA does not contain an intron or any intronic sequences, or splice site sequences.

[0284] Preferably, the RNA is not spiced or otherwise modified in the target cell. In particular, the RNA is preferably not modified such that the length of the RNA is changed in the target cell.

[0285] RNAs of the present invention are preferably shorter than typical naturally occurring mRNAs, or mRNAs produced by IVT methods, which comprise conventional regulatory element sequences.

[0286] In one embodiment, the RNA is no more than 250 nucleotides in length, such as no more than 240 nucleotides in length, no more than 230 nucleotides in length, no more than 220 nucleotides in length, no more than 210 nucleotides in length, no more than 200 nucleotides in length, no more than 190 nucleotides in length, no more than 180 nucleotides in length, no more than 170 nucleotides in length, no more than 160 nucleotides in length, no more than 150 nucleotides in length, no more than 140 nucleotides in length, no more than 130 nucleotides in length, no more than 120 nucleotides in length, no more than 110 nucleotides in length, no more than 100 nucleotides in length, no more than 90 nucleotides in length, no more than 80 nucleotides in length, no more than 70 nucleotides in length, no more than 60 nucleotides in length, no more than 50 nucleotides in length, no more than 40 nucleotides in length, no more than 30 nucleotides in length, or no more than 24 nucleotides in length.

[0287] In one embodiment, the RNA is 24 to 250 nucleotides in length, 24 to 200 nucleotides in length, 27 to 200 nucleotides in length, 27 to 150 nucleotides in length, 27 to 100 nucleotides in length, or 27 to 50 nucleotides in length. In one embodiment, the RNA is 27 to 187 nucleotides in length. The codons of the RNA used in the present disclosure may be optimized, e.g., to increase the GC content of the RNA and / or to replace codons which are rare in the cell (or subject) in which the polypeptide of interest is to be expressed by codons which are synonymous frequent codons in said cell (or subject).

[0288] In one embodiment, the amino acid sequence encoded by the RNA used in the present disclosure is encoded by a coding sequence which is codon-optimized and / or the G / C content of which is increased compared to the naturally-occurring coding sequence. This also includes embodiments wherein one or more sequence regions of the coding sequence are codon- optimized and / or increased in the G / C content compared to the corresponding sequence regions of the wild type coding sequence. In one embodiment, the codon-optimization and / or the increase in the G / C content preferably does not change the sequence of the encoded amino acid sequence.

[0289] The term "codon-optimized" refers to the alteration of codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without preferably altering the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, coding regions (i.e., the ORF) may be codon-optimized for optimal expression in a subject to be treated using the RNA described herein. Codon-optimization is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Thus, the sequence of mRNA may be modified such that codons for which frequently occurring tRNAs are available are inserted in place of "rare codons".

[0290] In one embodiment, the guanosine / cytosine (G / C) content of the coding region of the RNA described herein is increased compared to the G / C content of the corresponding coding sequence of the naturally occurring RNA, wherein the amino acid sequence encoded by the RNA is preferably not modified compared to the amino acid sequence encoded by the wild type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of that RNA. Sequences having an increased G (guanosine) / C (cytosine) content are more stable than sequences having an increased A (adenosine) / U (uracil) content. In respect to the fact that several codons code for one and the same amino acid (so-called degeneration of the genetic code), the most favorable codons for the stability can be determined (so-called alternative codon usage).

[0291] Depending on the amino acid to be encoded by the RNA, there are various possibilities for modification of the RNA sequence, compared to its wild type sequence. In particular, codons which contain A and / or II nucleotides can be modified by substituting these codons by other codons, which code for the same amino acids but contain no A and / or II or contain a lower content of A and / or II nucleotides.

[0292] In various embodiments, the G / C content of the ORF of the RNA described herein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, or even more compared to the G / C content of the corresponding coding region of the naturally occurring RNA.

[0293] Modified RNAs

[0294] The RNA molecules of the present invention may comprise one or more non-canonical nucleotides and / or one or more nucleotides arranged in a non-canonical fashion. Non- canonical nucleotides may also be referred to as modified nucleotides herein.

[0295] By non-canonical, it is meant any nucleotide or arrangement thereof that deviates from that typically found in naturally occurring DNA and RNA. The five canonical nucleotides that usually make up naturally occurring nucleic acids are uridine, adenosine, thymidine, cytidine and guanosine, commonly abbreviated to their one letter codes II, A, T, C and G, respectively. These nucleotides are canonically linked via a phosphodiester bond to form a ‘sugarphosphate backbone’.

[0296] In one embodiment, the RNA comprises one or more non-canonical nucleotides. In one embodiment, the RNA comprises one or more modified nucleotides.

[0297] A modified (or non-canonical) purine (A or G) or pyrimidine (C, T, or II) base moiety is preferably modified by one or more alkyl groups, more preferably one or more C1-4 alkyl groups, even more preferably one or more methyl groups. Particular examples of modified purine or pyrimidine base moieties include N7-alkyl-guanine, N6-alkyl-adenine, 5-alkyl- cytosine, 5-alkyl-uracil, and N(1)-alkyl-uracil, such as N7-CI-4 alkyl-guanine, N6-CI-4 alkyladenine, 5-C1-4 alkyl-cytosine, 5-C1-4 alkyl-uracil, and N(1)-CI-4 alkyl-uracil, preferably N7- methyl-guanine, N6-methyl-adenine, 5-methyl-cytosine, 5-methyl-uracil, and N(1 ^methyluracil.

[0298] Modified or non-canonical ribonucleotides may be introduced in order to increase the stability and / or decrease immunogenicity and / or decrease cytotoxicity of the RNA. For example, in one embodiment, uridine in the RNA described herein is replaced (partially or completely, preferably completely) by a modified nucleoside. In one embodiment, the modified nucleoside is a modified uridine.

[0299] In one embodiment, the modified uridine replacing uridine is selected from the group consisting of pseudouridine (ip), N1-methyl-pseudouridine (m1 ip), 5-methyl-uridine (m5U), and combinations thereof.

[0300] In one embodiment, the modified nucleoside replacing (partially or completely, preferably completely) uridine in the RNA may be any one or more of 3-methyl-uridine (m3U), 5-methoxy- uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio- uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5- aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5- carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1- propynyl-pseudouridine, 5-taurinomethyl-uridine (im5U), 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine(Tm5s2U), 1-taurinomethyl-4-thio-pseudouridine), 5-methyl-2- thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4ip), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ip), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio- dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4- methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3- amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3 ip), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio- uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-O-methyl-uridine (s2Um), 5- methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl- uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O- dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1 -thio- uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2- carbomethoxyvinyl) uridine, 5-[3-(1-E-propenylamino)uridine, or any other modified uridine known in the art.

[0301] In one embodiment, the RNA comprises one or more non-canonical nucleotides and / or one or more nucleotides arranged in a non-canonical configuration selected from the group consisting of: an inverted nucleotide, preferably inverted thymidine, 2'0-Methyl adenosine, pseudouridine, 1 -methylpseudouridine, and a monophosphate nucleotide.

[0302] Modified (or non-canonical) nucleotides may be present anywhere in the RNA and may be present in all substituent nucleotides or only some (if present at all).

[0303] In one embodiment, the one or more non-canonical nucleotides is / are present at the 5’ end of the RNA molecule, that is, as the 5’ terminal nucleotide. In one embodiment, the nucleotide at the 5’ terminus is arranged in a non-canonical configuration. In one embodiment, the 5’ terminal nucleotide is a modified nucleotide. The 5’ terminal nucleotide may be selected from nucleotides or modified versions thereof comprising: a free 5’ OH group, a free 5’ monophosphate group, a free 5’ diphosphate group, a free 5’ triphosphate group, or a free 5’ disphosphate group.

[0304] In one embodiment, the one or more non-canonical nucleotides is / are present at the 3 end of the RNA molecule, that is, as the 3’ terminal nucleotide. In one embodiment, the 3’ terminal nucleotide is a modified nucleotide. In one embodiment, the nucleotide at the 3’ terminus is arranged in a non-canonical configuration. The 3’ terminal nucleotide may be selected from nucleotides or modified versions thereof comprising a free 3’ OH group.

[0305] In one embodiment, the one or more non-canonical nucleotides is / are present within the one or more upstream elements, optionally wherein the one or more non-canonical nucleotides is / are present within the one or more upstream elements only. In one embodiment, the one or more non-canonical nucleotides is / are present within the 5’ cap, optionally wherein the one or more non-canonical nucleotides is / are present within the 5’ cap only. In one embodiment, the one or more non-canonical nucleotides is / are present within the 5’IITR, optionally wherein the one or more non-canonical nucleotides is / are present within the 5’IITR only. In one embodiment, the one or more non-canonical nucleotides is / are present within the start codon, optionally wherein the one or more non-canonical nucleotides is / are present within the stop codon only. In one embodiment, the one or more non-canonical nucleotides is / are present within the ORF, optionally wherein the one or more non-canonical nucleotides is / are present within the ORF only.

[0306] In one embodiment, the one or more non-canonical nucleotides is / are present within the one or more downstream elements, optionally wherein the one or more non-canonical nucleotides is / are present within the one or more downstream elements only. In one embodiment, the one or more non-canonical nucleotides is / are present within the stop codon, optionally wherein the one or more non-canonical nucleotides is / are present within the stop codon only. In one embodiment, the one or more non-canonical nucleotides is / are present within the 3’IITR, optionally wherein the one or more non-canonical nucleotides is / are present within the 3’IITR only. In one embodiment, the one or more non-canonical nucleotides is / are present within the polyA tract, optionally wherein the one or more non-canonical nucleotides is / are present within the poly A tract only.

[0307] The ‘pattern’ of modified nucleotides may be regular or irregular. A regular pattern would, for example, be an alternating pattern of modified and unmodified nucleotides.

[0308] In one embodiment, the RNA comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage (i.e. , a non-canonical internucleoside linkage). A non- canonical internucleoside linkage according to the present invention may be any suitable covalent linkage (which is not a phosphodiester internucleoside linkage) between adjacent nucleosides / nucleotides. Preferably, an internucleoside linkage that is not a phosphodiester internucleoside linkage is a phosphorothioate internucleoside linkage.

[0309] In one embodiment, the RNA comprises one or more phosphorothioate internucleoside linkage. In one embodiment, the RNA comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage, wherein all of the internucleoside linkages that are not a phosphodiester internucleoside linkage are phosphorothioate internucleoside linkages. In one embodiment, the RNA comprises only phosphodiester and phosphorothioate internucleoside linkages.

[0310] In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the one or more upstream elements, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the one or more upstream elements only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the 5’cap, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the 5’cap only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the 5’IITR, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the 5’IITR only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the start codon, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the stop codon only.

[0311] In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the ORF, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the ORF only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present anywhere except within the ORF.

[0312] In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the one or more downstream elements, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the one or more downstream elements only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the stop codon, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the stop codon only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the 3’IITR, optionally wherein the one or more phosphorothioate internucleoside linkage is / are present within the 3’IITR only. In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the polyA tract, optionally wherein the one or more phosphorothioate internucleoside linkage s is / are present within the poly A tract only.

[0313] Non-canonical internucleoside linkages may be present between nucleotides that are entirely comprised within one element of the RNA (e.g., the ORF or the 5’IITR) or between two nucleotides that are each comprised within different elements of the RNA (e.g., the ORF and the 5’IITR).

[0314] The ‘pattern’ of non-canonical internucleoside linkages present within the RNA may be regular or irregular. A regular pattern would, for example, be an alternating pattern of canonical and non-canonical internucleoside linkages (e.g., the pattern of linkages from 5’ to 3’ along the backbone may be: - phosphodiester - phosphorothioate - phosphodiester - phosphorothioate - etc.).

[0315] In one embodiment, the one or more phosphorothioate internucleoside linkage is / are present within the polyA tract only, optionally wherein the phosphorothioate internucleoside linkage is / are present between alternating nucleotides (i.e., the pattern of linkages from 5’ to 3’ along the backbone is: - phosphodiester - phosphorothioate - phosphodiester - phosphorothioate - etc.).

[0316] In one embodiment, the polyA tract consists of A nucleotides only linked via phosphorothioate internucleoside linkages.

[0317] In one embodiment, the RNA comprises one or more nucleotides arranged in a non-canonical configuration.

[0318] Preferably, the ORF does not comprise any modified or non-canonical nucleotides and / or any nucleotides having a non-canonical internucleoside linkage.

[0319] Preferably, the start codon does not comprise any modified or non-canonical nucleotides and / or any nucleotides having a non-canonical internucleoside linkage.

[0320] In one embodiment, the RNA molecule is of formula:

[0321] (a) start codon - ORF (formula ii);

[0322] (b) start codon - ORF - stop codon - polyA tract (formula iv); or

[0323] (c) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more phosphorothioate internucleoside linkage.

[0324] In one embodiment, the RNA molecule is of formula:

[0325] (a) start codon - ORF - stop codon - polyA tract (formula iv); or

[0326] (b) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more phosphorothioate internucleoside linkage, wherein the phosphorothioate internucleoside linkage is not present in the start codon or ORF.

[0327] In one embodiment, the RNA molecule is of formula:

[0328] (a) start codon - ORF - stop codon - polyA tract (formula iv); or

[0329] (b) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more non-canonical internucleoside linkages, preferably one or more phosphorothioate internucleoside linkages, wherein the phosphorothioate internucleoside linkage is not present in the ORF.

[0330] In one embodiment, the RNA molecule is of formula:

[0331] (a) start codon - ORF - stop codon - polyA tract (formula iv); or (b) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more non-canonical internucleoside linkages, preferably one or more phosphorothioate internucleoside linkages, wherein the non-canonical internucleoside linkages are present in the 5’IITR only.

[0332] In one embodiment, the RNA molecule is of formula:

[0333] 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more non-canonical internucleoside linkages, preferably one or more phosphorothioate internucleoside linkages, wherein the non-canonical internucleoside linkages are present in the 5’IITR only.

[0334] In one embodiment, the RNA molecule is of formula:

[0335] (a) start codon - ORF - stop codon - polyA tract (formula iv); or

[0336] (b) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more non-canonical internucleoside linkages, preferably one or more phosphorothioate internucleoside linkages, wherein the non-canonical internucleoside linkages are present in the polyA tract only.

[0337] In one embodiment, the RNA molecule is of formula:

[0338] 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and comprises one or more non-canonical internucleoside linkages, preferably one or more phosphorothioate internucleoside linkages, wherein the non-canonical internucleoside linkages are present in the 5’IITR and polyA tract only.

[0339] In one embodiment, the RNA molecule is of formula: start codon - ORF - stop codon - polyA tract (formula iv); or wherein the polyA tract comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphorothioate and phosphodiester internucleoside linkages, optionally wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0340] In one embodiment, the RNA molecule is of formula: start codon - ORF - stop codon - polyA tract (formula iv); or wherein the polyA tract is 12 to 60 nucleotides in length comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphorothioate and phosphodiester internucleoside linkages, optionally wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0341] In one embodiment, the RNA molecule is of formula:

[0342] 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); wherein the polyA tract comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphorothioate and phosphodiester internucleoside linkages, optionally wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0343] In one embodiment, the RNA molecule is of formula:

[0344] 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); wherein the polyA tract is 12 to 60 nucleotides in length and comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphorothioate and phosphodiester internucleoside linkages, wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0345] In one embodiment, the RNA molecule is of formula:

[0346] 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); wherein the 5’IITR comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably an alternating pattern of phosphorothioate and phosphodiester internucleoside linkages, optionally wherein all other internucleoside linkages in regions other than the 5’IITR are phosphodiester internucleoside linkages.

[0347] An RNA, or a defined / named region thereof, that consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages refers to an RNA molecule (or region thereof) wherein the entirety of said molecule or region thereof is composed of nucleotides wherein consecutive nucleotides are connected by alternating bond types (i.e., directly consecutive bonds are not identical). For example, an RNA consisting of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages may comprise a pattern of alternating phosphorothioate and phosphodiester bonds across its entire length. By way of further example, in some embodiments the polyA tract, optionally only the polyA tract, of an RNA may consist of an alternating pattern of internucleoside linkages; thus, all ‘A’s in the polyA tract are joined by alternating internucleoside linkages (e.g., phosphorothioate and phosphodiester).

[0348] RNA compositions

[0349] In one aspect, there is provided a composition comprising two or more discrete populations of RNA molecules, wherein the RNA molecules of each population comprise an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, wherein the RNA molecule is of formula (i):

[0350] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0351] X comprises one or more upstream elements selected from a:

[0352] (a) 5’ cap;

[0353] (b) 5’IITR; and / or

[0354] (c) start codon; and / or;

[0355] Y comprises one or more downstream elements selected from a:

[0356] (d) stop codon;

[0357] (e) 3’IITR; and / or

[0358] (f) polynucleotide tract, optionally a polyA tract; and wherein the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF.

[0359] A composition according to the foregoing aspect may comprise any RNA as defined herein above.

[0360] The compositions of the present invention represent a mixture of RNA molecules in which discrete - or distinct - populations of RNA molecules exist. A single ‘population’ encompasses any RNA molecules of identical sequence; conversely, distinct populations have different nucleotide sequences. A difference in sequence may be as few as one nucleotide difference, provided said difference results in a change in the corresponding amino acid that is encoded by the ORF (i.e., it is not a ‘silent’ difference giving rise to the same amino acid when translated). Any two populations of RNA molecules in a composition according to the invention differ at least in the nucleotide sequence of the ORF.

[0361] In one embodiment the populations of RNA molecules are distinguished at least by the nucleotide sequence of the ORF. Preferably, at least two, or more preferably all, of the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF.

[0362] It will be understood that any RNA described herein may be an RNA that forms the basis of a population as defined herein. Any two or more RNAs described herein may be independently selected and combined to form a composition according to the present invention. For example an RNA of formula iii may be combined with an RNA of formula iv, providing each population also differs in the sequence of the ORF.

[0363] Thus, any features of an RNA described herein may be independently selected and assigned to an RNA (RNA population) without having to be present in any one or more further RNA populations.

[0364] It will be understood that a single population is made up of RNAs each of identical nucleotide sequence to one another. All RNAs in a single population are of the same sequence.

[0365] In one embodiment, the discrete populations are further distinguished by the length of the RNA molecule. In one embodiment, the discrete populations are further distinguished by the sequence of any of the one or more upstream elements. In one embodiment, the discrete populations are further distinguished by presence or absence of any of the one or more upstream elements. In one embodiment, the discrete populations are further distinguished by the sequence of any of the one or more downstream elements. In one embodiment, the discrete populations are further distinguished by presence or absence of any of the one or more downstream elements.

[0366] In one embodiment, the composition comprises 2 to 30 discrete populations, optionally 2 to 25 discrete populations, optionally 2 to 25 discrete populations, optionally 2 to 20 discrete populations, optionally 2 to 15 discrete populations, optionally 2 to 10 discrete populations, or optionally 2 to 5 discrete populations.

[0367] In one embodiment, the composition comprises 2 to 20 discrete populations, such as 5 to 15 discrete populations, or 8 to 12 discrete populations of RNA molecules.

[0368] In one embodiment, the composition comprises 2 discrete populations, 3 discrete populations, 4 discrete populations, 5 discrete populations, 6 discrete populations, 7 discrete populations, 8 discrete populations, 9 discrete populations, 10 discrete populations, 11 discrete populations, 12 discrete populations, 13 discrete populations, 14 discrete populations, 15 discrete populations, 16 discrete populations, 17 discrete populations, 18 discrete populations, 19 discrete populations, or 20 discrete populations.

[0369] In one embodiment, each discrete population comprises an ORF encoding a different polypeptide from a single subject.

[0370] By from a single subject, it is meant that the polypeptide encoded by the ORF has at least one portion of contiguous polypeptide sequence that is encoded for by a naturally occurring nucleic acid (DNA or RNA) within a subject. For example, such polypeptides include those derived from cancer neoantigens.

[0371] It will be understood that polypeptide sequences may be encoded by multiple individuals, however, this does not preclude any group of ORF-encoded polypeptides being derived from a single individual.

[0372] In one embodiment, each discrete population comprises an ORF encoding a different polypeptide from more than one subject.

[0373] In one embodiment, each discrete population comprises an ORF encoding a polypeptide from a non-human organism, optionally a pathogenic or commensal organism. In one embodiment, each discrete population comprises an ORF encoding a different polypeptide from a single organism.

[0374] In one embodiment, each discrete population comprises an ORF encoding a different polypeptide from a different organism, such as from two or more viruses. In one embodiment, each discrete population comprises an ORF encoding a polypeptide from a virus. In one embodiment, each discrete population comprises an ORF encoding a different polypeptide from a single virus. In one embodiment, each discrete population comprises an ORF encoding a different polypeptide from two or more viruses.

[0375] In one embodiment, each discrete population comprises an ORF encoding a polypeptide from a bacterium or fungus. In one embodiment, each discrete population comprises an ORF encoding a polypeptide from a single bacterium or fungus. In one embodiment, each discrete population comprises an ORF encoding a polypeptide from two or more bacteria or fungi. In one embodiment, each discrete population comprises an ORF encoding a polypeptide from a single allergen. In one embodiment, each discrete population comprises an ORF encoding a polypeptide from two or more allergens.

[0376] In one embodiment, all of the discrete populations comprise an ORF encoding a different polypeptide wherein each polypeptide is derived from a single auto-antigen. In one embodiment, two or more of the discrete populations each comprise a distinct ORF encoding a polypeptide, wherein the polypeptides encoded by the two or more different populations are derived from two or more different auto-antigens. In other words, the polypeptides encoded by the ORF may be derived from a single naturally occurring polypeptide auto-antigen or two or more different naturally occurring polypeptide auto-antigens. In accordance with the present invention, each discrete population consists of RNAs of identical nucleotide sequence.

[0377] In one embodiment, all of the discrete populations comprise an ORF encoding a different polypeptide, wherein each polypeptide is from an auto-antigen relating to a single autoimmune disease or disorder. In one embodiment, two or more of the discrete populations each comprise a distinct ORF encoding a polypeptide, wherein the polypeptides encoded by the two or more different populations are derived from two or more different auto-antigens that relate to two or more autoimmune diseases or disorders. In other words, the polypeptides encoded by the ORF may be derived from one or more polypeptide(s) associated with or implicated in a single autoimmune disease, or derived from one or more polypeptide(s) associated with or implicated in more than one autoimmune disease.

[0378] The compositions herein may comprise RNAs encoding for polypeptides derived from one or more cancer antigen(s). In one embodiment, a mixture of cancer epitopes are encoded by two or more of the discrete populations of RNA. The compositions herein may comprise RNAs encoding for polypeptides derived from either or both of (i) cancer non-neoantigens (i.e. , non- neo-epitopes); and / or (ii) cancer neoantigens (i.e., neo-epitopes). In one embodiment, a mixture of cancer non-neo-epitopes and cancer neo-epitopes are encoded by two or more of the discrete populations of RNA. In one embodiment, only cancer non-neo-epitopes are encoded by each of the discrete populations of RNA. In one embodiment, only cancer neoepitopes are encoded by each of the discrete populations of RNA.

[0379] In one embodiment, the discrete populations are present in equimolar amounts. In one embodiment, the discrete populations are present in non-equimolar amounts. In one embodiment, the composition does not comprise any polynucleic acid molecules that are not those forming the discrete populations of RNA as described herein.

[0380] The polypeptides encoded by the ORFs that define each population may represent distinct contiguous regions of polypeptide sequence derived from a single longer naturally occurring polypeptide. For example, in a notional peptide of 200 amino acids in length three ORFs may be designed that encode amino acids 1 to 8, 100 to 110, and 190 to 199, thus forming three discrete RNA populations. Alternatively, the polypeptide encoded by the ORFs that define each population may be derived from distinct polypeptides. As a further alternative, polypeptides encoded by the ORFs may be derived from a combination of the two foregoing scenarios (e.g., one ORF encodes a polypeptide derived from polypeptide X and two ORFs encode two distinct polypeptides, each derived from polypeptide Y).

[0381] When the ORFs are derived from a single longer polypeptide, the polypeptide sequences encoded by the ORF may be partially overlapping or non-overlapping. Partially overlapping refers to a situation where the two polypeptides are distinct but share some region of sequence overlap (e.g., amino acids 1 to 9 encoded by ORF 1 would be partially overlapping if ORF 2 encoded amino acids 7 to 15 from a longer polypeptide). A non-overlapping sequence in this context is where the two polypeptide sequences share no overlapping region of sequence.

[0382] In one embodiment, the polypeptides encoded by the ORFs that define each population are derived from a single polypeptide. In one embodiment, the polypeptides encoded by the ORFs that define each population are derived from a two or more polypeptides. In one embodiment, the polypeptides encoded by the ORFs that define each population are each derived a distinct polypeptides.

[0383] Further compositions, combinations, and kits

[0384] The RNAs and compositions comprising two or more discrete populations thereof as described herein may be (further) formulated in to compositions, in particular, compositions that are adapted to the intended use.

[0385] Certain components may be selected to modulate the physical or chemical properties of the RNAs of the invention, e.g., to promote the formation of particles and / or to make the compositions more amenable to therapeutic use. In one embodiment there is provided a composition comprising one or more particles, said particles comprising one or more RNA according to the invention.

[0386] Additional composition components

[0387] In some embodiments, a salt for use in the compositions described herein comprises sodium chloride. Without wishing to be bound by theory, sodium chloride functions as an ionic osmolality agent for preconditioning nucleic acid (such as RNA and / or DNA) prior to mixing with lipids. In some embodiments, the compositions described herein may comprise alternative organic or inorganic salts. Alternative salts include, without limitation, potassium chloride, dipotassium phosphate, monopotassium phosphate, potassium acetate, potassium bicarbonate, potassium sulfate, disodium phosphate, monosodium phosphate, sodium acetate, sodium bicarbonate, sodium sulfate, lithium chloride, magnesium chloride, magnesium phosphate, calcium chloride, and sodium salts of ethylenediaminetetraacetic acid (EDTA).

[0388] Generally, compositions for storing nucleic acid (such as RNA and / or DNA) particles such as for freezing nucleic acid (such as RNA and / or DNA) particles comprise low sodium chloride concentrations, or comprises a low ionic strength. In some embodiments, the sodium chloride is at a concentration from 0 mM to about 50 mM, from 0 mM to about 40 mM, or from about 10 mM to about 50 mM.

[0389] According to the present disclosure, the RNA compositions described herein have a pH suitable for the stability of the RNA and, in particular, for the stability of the RNA. Without wishing to be bound by theory, the use of a buffer system maintains the pH of the particle compositions described herein during manufacturing, storage and use of the compositions. In some embodiments of the present disclosure, the buffer system may comprise a solvent (in particular, water, such as deionized water, in particular water for injection) and a buffering substance. The buffering substance may be selected from 2-[4-(2-hydroxyethyl)piperazin-1- yl]ethanesulfonic acid (HEPES), 2-amino-2-(hydroxymethyl)propane-1 ,3-diol (Tris), acetate, and histidine. A preferred buffering substance is HEPES.

[0390] Compositions described herein may also comprise a cryoprotectant and / or a surfactant as stabilizer to avoid substantial loss of the product quality and, in particular, substantial loss of RNA activity during storage, freezing, and / or lyophilization, for example to reduce or prevent aggregation, particle collapse, nucleic acid (such as RNA and / or DNA, especially mRNA) degradation and / or other types of damage. In an embodiment, the cryoprotectant is a carbohydrate. The term "carbohydrate", as used herein, refers to and encompasses monosaccharides, disaccharides, trisaccharides, oligosaccharides and polysaccharides.

[0391] In an embodiment, the cryoprotectant is a monosaccharide. The term "monosaccharide", as used herein refers to a single carbohydrate unit (e.g., a simple sugar) that cannot be hydrolyzed to simpler carbohydrate units. Exemplary monosaccharide cryoprotectants include glucose, fructose, galactose, xylose, ribose and the like.

[0392] In an embodiment, the cryoprotectant is a disaccharide. The term "disaccharide", as used herein refers to a compound or a chemical moiety formed by 2 monosaccharide units that are bonded together through a glycosidic linkage, for example through 1-4 linkages or 1-6 linkages. A disaccharide may be hydrolyzed into two monosaccharides. Exemplary disaccharide cryoprotectants include sucrose, trehalose, lactose, maltose and the like.

[0393] In some embodiments, nucleic acid RNA compositions may include sucrose. Without wishing to be bound by theory, sucrose functions to promote cryoprotection of the compositions, thereby preventing RNA aggregation and maintaining chemical and physical stability of the composition. In some embodiments, RNA compositions may include alternative cryoprotectants to sucrose. Alternative stabilizers include, without limitation, trehalose and glucose. In a specific embodiment, an alternative stabilizer to sucrose is trehalose or a mixture of sucrose and trehalose.

[0394] A preferred cryoprotectant is selected from the group consisting of sucrose, trehalose, glucose, and a combination thereof, such as a combination of sucrose and trehalose. In a preferred embodiment, the cryoprotectant is sucrose.

[0395] Some embodiments of the present disclosure contemplate the use of a chelating agent in a RNA composition described herein. Chelating agents refer to chemical compounds that are capable of forming at least two coordinate covalent bonds with a metal ion, thereby generating a stable, water-soluble complex. Without wishing to be bound by theory, chelating agents reduce the concentration of free divalent ions, which may otherwise induce accelerated nucleic acid (such as RNA and / or DNA) degradation in the present disclosure. Examples of suitable chelating agents include, without limitation, ethylenediaminetetraacetic acid (EDTA), a salt of EDTA, desferrioxamine B, deferoxamine, dithiocarb sodium, penicillamine, pentetate calcium, a sodium salt of pentetic acid, succimer, trientine, nitrilotriacetic acid, trans- diaminocyclohexanetetraacetic acid (DCTA), diethylenetriaminepentaacetic acid (DTPA), and bis(aminoethyl)glycolether-N,N,N',N'-tetraacetic acid. In some embodiments, the chelating agent is EDTA or a salt of EDTA. In an exemplary embodiment, the chelating agent is EDTA disodium dihydrate. In some embodiments, the EDTA is at a concentration from about 0.05 mM to about 5 mM, from about 0.1 mM to about 2.5 mM or from about 0.25 mM to about 1 mM.

[0396] In an alternative embodiment, the RNA compositions described herein do not comprise a chelating agent.

[0397] Pharmaceutical compositions

[0398] Compositions comprising nucleic acids described herein, optionally formulated in particles, may be useful as or for preparing pharmaceutical compositions or medicaments for therapeutic or prophylactic treatments.

[0399] In one aspect, there is provided a pharmaceutical composition, the composition comprising any RNA disclosed herein, or any composition disclosed herein, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0400] The term "pharmaceutical composition" relates to a composition comprising a therapeutically effective agent, preferably together with pharmaceutically acceptable carriers, diluents and / or excipients. Said pharmaceutical composition is useful for treating, preventing, or reducing the severity of a disease by administration of said pharmaceutical composition to a subject.

[0401] The pharmaceutical compositions of the present disclosure may comprise one or more adjuvants or may be administered with one or more adjuvants. The term "adjuvant" relates to a compound which prolongs, enhances or accelerates an immune response. Adjuvants comprise a heterogeneous group of compounds such as oil emulsions (e.g., Freund’s adjuvants), mineral compounds (such as alum), bacterial products (such as Bordetella pertussis toxin), immune-stimulating complexes. Examples of adjuvants include, without limitation, small molecules, LPS, GP96, CpG oligodeoxynucleotides, co-stimulatory ligands, immune-stimulating nucleic acid sequences, growth factors, and cytokines, such as monokines, lymphokines, interleukins, chemokines. Exemplary adjuvants may include: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-15, IFNa, IFN-y, GM-CSF, LT-a, OX- 40L, 4-1BB-L and CD40L. Further known adjuvants are aluminum hydroxide, Freund's adjuvant or oil such as Montanide® ISA51. Other suitable adjuvants for use in the present disclosure include lipopeptides, such as Pam3Cys, as well as lipophilic components, such as saponins, trehalose-6,6-dibehenate (TDB), monophosphoryl lipid-A (MPL), monomycoloyl glycerol (MMG), or glucopyranosyl lipid adjuvant (GLA).

[0402] The pharmaceutical compositions of the present disclosure may be in a storable form (e.g., in a frozen or lyophilized / freeze-dried form) or in a "ready-to-use form" ( / .e., in a form which can be immediately administered to a subject, e.g., without any processing such as diluting). Thus, prior to administration of a storable form of a pharmaceutical composition, this storable form has to be processed or transferred into a ready-to-use or administrable form. E.g., a frozen pharmaceutical composition has to be thawed, or a freeze-dried pharmaceutical composition has to be reconstituted, e.g. by using a suitable solvent (e.g., deionized water, such as water for injection) or liquid (e.g., an aqueous solution).

[0403] The pharmaceutical compositions according to the present disclosure are generally applied in a "pharmaceutically effective amount" and in "a pharmaceutically acceptable preparation". The term "pharmaceutically acceptable" refers to the non-toxicity of a material which does not interact with the action of the active component of the pharmaceutical composition.

[0404] The term "pharmaceutically effective amount" refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In some embodiments relating to the treatment of a particular disease, the desired reaction may relate to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in some embodiments, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease may also be delay of the onset or a prevention of the onset of said disease or said condition. An effective amount of the pharmaceutical compositions described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration and similar factors. Accordingly, the doses administered of the pharmaceutical compositions described herein may depend on various of such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.

[0405] The pharmaceutical compositions of the present disclosure may contain buffers, preservatives, and optionally other therapeutic agents. In some embodiments, the pharmaceutical compositions of the present disclosure comprise one or more pharmaceutically acceptable carriers, diluents and / or excipients. Suitable preservatives for use in the pharmaceutical compositions of the present disclosure include, without limitation, benzalkonium chloride, chlorobutanol, paraben and thimerosal.

[0406] The term "excipient" as used herein refers to a substance which may be present in a pharmaceutical composition of the present disclosure but is not an active ingredient. Examples of excipients, include without limitation, carriers, binders, diluents, lubricants, thickeners, surface active agents, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or colorants

[0407] The term "diluent" relates a diluting and / or thinning agent. Moreover, the term "diluent" includes any one or more of fluid, liquid or solid suspension and / or mixing media. Examples of suitable diluents include ethanol, glycerol and water.

[0408] The term "carrier" refers to a component which may be natural, synthetic, organic, inorganic in which the active component is combined in order to facilitate, enhance or enable administration of the pharmaceutical composition. A carrier as used herein may be one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for administration to subject. Suitable carrier include, without limitation, sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide / glycolide copolymers or polyoxyethylene / polyoxy-propylene copolymers. In some embodiments, the pharmaceutical composition of the present disclosure includes isotonic saline.

[0409] Pharmaceutically acceptable carriers, excipients or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edit. 1985).

[0410] Pharmaceutical carriers, excipients or diluents can be selected with regard to the intended route of administration and standard pharmaceutical practice.

[0411] Particle forming components

[0412] In one embodiment, any composition herein further comprises one or more particle forming components (such as one or more cationic or cationically ionizable lipids, or one or more cationic polymers). In one embodiment, the composition is a lipid particle composition, such as a lipoplex (LPX) or lipid nanoparticle (LNP) composition.

[0413] In one embodiment, each discrete population of RNA molecules is complexed with one or more particle forming components

[0414] It is envisaged that, in compositions comprising two or more discrete populations of RNA, the particles may be formed after mixing of the discrete populations of RNA, such that particles comprise a mixture of RNAs (i.e., RNAs from any number of the two or more discrete populations).

[0415] In one embodiment, the composition is a lipid particle composition, wherein each lipid particle in the composition comprises RNAs from two or more of the discrete populations of RNA molecules.

[0416] It is also envisaged that, in compositions comprising two or more discrete populations of RNA, the particles may be formed prior to mixing of the discrete populations of RNA, such that particles comprise only one type of RNA prior to mixing.

[0417] In one embodiment, the composition is a lipid particle composition, wherein each lipid particle in the composition comprises RNA from only one discrete population of RNA molecules.

[0418] Cationic lipids and cationically ionisable lipids

[0419] In one embodiment, any of the compositions herein comprise a cationic lipid or cationically ionizable lipid.

[0420] The compositions comprising the RNA described herein - or any particle formed thereby - may comprise at least one cationic or cationically ionizable lipid as particle forming agent. Cationic or cationically ionizable lipids contemplated for use herein include any cationic or cationically ionizable lipids (including lipid-like materials) which are able to electrostatically bind nucleic acid. In some embodiments, cationic or cationically ionizable lipids contemplated for use herein can be associated with nucleic acid, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated. As used herein, a "cationic lipid" refers to a lipid or lipid-like material having a net positive charge. Cationic lipids bind negatively charged nucleic acid by electrostatic interaction. Generally, cationic lipids possess a lipophilic moiety, such as a sterol, an acyl chain, a diacyl or more acyl chains, and the head group of the lipid typically carries the positive charge.

[0421] In some embodiments, a cationic lipid has a net positive charge only at certain pH, in particular acidic pH, while it has preferably no net positive charge, preferably has no charge, / .e., it is neutral, at a different, preferably higher pH such as physiological pH. This ionizable behavior is thought to enhance efficacy through helping with endosomal escape and reducing toxicity as compared with particles that remain cationic at physiological pH.

[0422] As used herein, a "cationically ionizable lipid" refers to a lipid or lipid-like material which has a net positive charge or is neutral, / .e., which is not permanently cationic. Thus, depending on the pH of the composition in which the cationically ionizable lipid is solved, the cationically ionizable lipid is either positively charged or neutral. For purposes of the present disclosure, cationically ionizable lipids are covered by the term "cationic lipid" unless contradicted by the circumstances.

[0423] In some embodiments, the cationic or cationically ionizable lipid comprises a head group which includes at least one nitrogen atom (N) which is positive charged or capable of being protonated, e.g., under physiological conditions.

[0424] Examples of cationic or cationically ionizable lipids are disclosed in WO2017 / 049245, WO2017 / 075531 , WO2018 / 087753, WO2018 / 081480, W02019 / 077053 or W02022 / 081750, each of which is incorporated by reference in its entirety. Examples of cationic or cationically ionizable lipids include, but are not limited to N-(2,3-dioleyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA); N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(2,3dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N,N- dioleyl-N,N-dimethylammonium chloride (DODAC); 3-(N-(N',N'dimethylaminoethane)- carbamoyl)cholesterol (DC-Chol), , and N-(1 ,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N- hydroxyethyl ammonium bromide (DMRIE). In some embodiments, a cationically ionizable lipid is selected from 1 ,2-dioleoyl-3-dimethylammonium propane (DODAP); N,N-dimethyl-2,3- dioleoyloxy)propylamine (DODMA); 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)- 9,12-octadecadien-1-yl-10,13-nonadecadien-1-yl ester (DLin-MC3-DMA); di(heptadecan-9- yl) 3,3'-((2-(4-methylpiperazin-1-yl)ethyl)azanediyl)dipropionate (BHD-C2C2-PipZ); bis(2- octyldodecyl) 3,3'-((2-(1 -methylpyrrolidin-2-yl)ethyl)azanediyl)dipropionate (BODD-C2C2- 1Me-Pyr), ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315); heptadecan-9-yl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}-octanoate) (SM-102); O-[N-{(9Z,12Z)-octadeca-9,12-dien-1-yl)}-N-{7-pentadecylcarbonyloxyoctyl}-amino]4- (dimethylamino)butanoate (HY-501); ((2-(4-

[0425] (dimethylamino)butanoyl)oxy)ethyl)azanediylbis(octane 8,1 -diyl) bis(2-hexyldecanoate) (EA- 405); (2-(4-(dimethylamino)butanoyl)oxy)azanediylbis(octane 8,1 -diyl) bis(2-hexyldecanoate) (HY-405).

[0426] In some embodiments, the cationic or cationically ionizable lipid is DOTMA. In some embodiments, the cationic or cationically ionizable lipid is DODMA.

[0427] DOTMA is a cationic lipid with a quarternary amine headgroup. The structure of DOTMA may be represented as follows:

[0428] DODMA is an ionizable cationic lipid with a tertiary amine headgroup. The structure of DODMA may be represented as follows:

[0429] In some embodiments, the cationic or cationically ionizable lipid may comprise from about 10 mol % to about 95 mol %, from about 20 mol % to about 95 mol %, from about 20 mol % to about 90 mol %, from about 30 mol % to about 90 mol %, from about 40 mol % to about 90 mol %, or from about 40 mol % to about 80 mol % of the total lipid present in the particle.

[0430] A combination of RNA molecules comprising two or more discrete populations of RNA molecules according to any of claims 1 to 28, wherein the populations are distinguished at least by the identity of the polypeptide encoded by the ORF.

[0431] Further lipids

[0432] Compositions comprising RNAs and particles described herein may also comprise lipids (including lipid-like materials) other than cationic or cationically ionizable lipids (also collectively referred to herein as cationic lipids), / .e., non-cationic lipids (including non-cationic or non-cationically ionizable lipids or lipid-like materials). Collectively, anionic and neutral lipids or lipid-like materials are referred to herein as non-cationic lipids. Optimizing the formulation of nucleic acid particles by addition of other hydrophobic moieties, such as cholesterol and lipids, in addition to a cationic or cationically ionizable lipid may enhance particle stability and efficacy of nucleic acid delivery.

[0433] One or more additional lipids may or may not affect the overall charge of the nucleic acid particles. In some embodiments, the one or more additional lipids are a non-cationic lipid or lipid-like material. The non-cationic lipid may comprise, e.g., one or more anionic lipids and / or neutral lipids. As used herein, an "anionic lipid" refers to any lipid that is negatively charged at a selected pH. As used herein, a "neutral lipid" refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH.

[0434] In some embodiments, the nucleic acid particles (especially the particles comprising mRNA) described herein comprise a cationic or cationically ionizable lipid and one or more additional lipids.

[0435] Without wishing to be bound by theory, the amount of the cationic or cationically ionizable lipid compared to the amount of the one or more additional lipids may affect important nucleic acid particle characteristics, such as charge, particle size, stability, tissue selectivity, and bioactivity of the nucleic acid. Accordingly, in some embodiments, the molar ratio of the cationic or cationically ionizable lipid to the one or more additional lipids is from about 10:0 to about 1 :9, about 4: 1 to about 1 :2, about 4: 1 to about 1 :1 , about 3: 1 to about 1 : 1 , or about 3: 1 to about 2:1.

[0436] In some embodiments, the one or more additional lipids comprised in the nucleic acid particles (especially in the particles comprising mRNA) described herein comprise one or more of the following: neutral lipids, steroids, and combinations thereof.

[0437] In some embodiments, the one or more additional lipids comprise a neutral lipid which is a phospholipid. In some embodiments, the phospholipid is selected from the group consisting of phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines and sphingomyelins. Specific phospholipids that can be used include, but are not limited to, 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1 ,2- dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1 ,2-dimyristoyl-sn-glycero-3- phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2- dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidyl ethanol amines such as 1 ,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoyl-phosphatidylethanolamine (DSPE), sphingomyelins, N-palmitoyl-D-erythro-sphingosylphosphorylcholine (SM), 1 ,2-diacylglyceryl-3-O-4'-(N,N,N-trimethyl)-homoserine (DGTS), ceramides, and their derivatives. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DOPE. In some embodiments, the neutral lipid is DSPC.

[0438] In some embodiments, the additional lipid comprises one of the following: (1) a phospholipid, (2) cholesterol or a derivative thereof; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof.

[0439] Thus, in some embodiments, the nucleic acid particles (especially the particles comprising mRNA) described herein comprise (1) a cationic or cationically ionizable lipid, and a phospholipid such as DOPE or (2) a cationic or cationically ionizable lipid and a phospholipid such as DOPE and cholesterol.

[0440] In some embodiments, the nucleic acid particles (especially the particles comprising mRNA) described herein comprise (1) DOTMA and DOPE, (2) DOTMA, DOPE and cholesterol, (3) DODMA and DOPE or (4) DODMA, DOPE and cholesterol.

[0441] In some embodiments, particles described herein do not include a polymer conjugated lipid such as a pegylated lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art.

[0442] In some embodiments, the additional lipid (e.g., one or more phospholipids and / or cholesterol) may comprise from about 0 mol % to about 90 mol %, from about 0 mol % to about 80 mol %, from about 2 mol % to about 80 mol %, from about 5 mol % to about 80 mol %, from about 5 mol % to about 60 mol %, from about 5 mol % to about 50 mol %, from about 7.5 mol % to about 50 mol %, or from about 10 mol % to about 40 mol % of the total lipid present in the particle. In some embodiments, the additional lipid (e.g., one or more phospholipids and / or cholesterol) comprises about 10 mol %, about 15 mol %, or about 20 mol % of the total lipid present in the particle.

[0443] In some embodiments, the additional lipid comprises a mixture of: (i) a phospholipid such as DOPE; and (ii) cholesterol or a derivative thereof. In some embodiments, the molar ratio of the phospholipid such as DOPE to the cholesterol or a derivative thereof is from about 9:0 to about 1 :10, about 2:1 to about 1 :4, about 1 :1 to about 1 :4, or about 1 :1 to about 1 :3. Polymer-conjuqated lipids

[0444] In some embodiments, a composition or particle may comprise at least one polymer- conjugated lipid. A polymer-conjugated lipid is typically a molecule comprising a lipid portion and a polymer portion conjugated thereto. In some embodiments, a polymer-conjugated lipid is a PEG-conjugated lipid, also referred to herein as pegylated lipid or PEG-lipid.

[0445] In some embodiments, a polymer-conjugated lipid is designed to sterically stabilize a lipid particle by forming a protective hydrophilic layer that shields the hydrophobic lipid layer. In some embodiments, a polymer-conjugated lipid can reduce its association with serum proteins and / or the resulting uptake by the reticuloendothelial system when such lipid particles are administered in vivo.

[0446] Various PEG-conjugated lipids are known in the art and include, but are not limited to pegylated diacylglycerol (PEG-DAG) such as 1-(monomethoxy-polyethyleneglycol)-2,3- dimyristoylglycerol (PEG-DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2' ,3 '-di(tetradecanoyloxy)propyl-1-0-(o- methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as o-methoxy(polyethoxy)ethyl-N-(2,3- di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(o methoxy(polyethoxy)ethyl)carbamate, and the like.

[0447] In some embodiments, a particle may comprise one or more PEG-conjugated lipids or pegylated lipids as described in WO 2017 / 075531 and WO 2018 / 081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein.

[0448] Lipoplex particles

[0449] In some embodiments of the present disclosure, the RNA described herein may be present in nucleic acid lipoplex particles.

[0450] Lipoplexes (LPX) are electrostatic complexes which are generally formed by mixing preformed cationic lipid liposomes with anionic nucleic acid (such as RNA). Formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact nucleic acid-lipoplexes (such as RNA-lipoplexes). In certain embodiments, the nucleic acid lipoplex particles (such as RNA and / or DNA lipoplex particles) include both a cationic lipid and an additional lipid. In an exemplary embodiment, the cationic lipid is DOTMA and the additional lipid is DOPE.

[0451] In some embodiments, the molar ratio of the at least one cationic lipid to the at least one additional lipid is from about 10:0 to about 1 :9, about 4:1 to about 1 :2, or about 3:1 to about 1 :1. In specific embodiments, the molar ratio may be about 3:1 , about 2.75:1 , about 2.5:1 , about 2.25:1 , about 2:1 , about 1.75:1 , about 1.5:1 , about 1.25:1 , or about 1 :1. In an exemplary embodiment, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 2:1.

[0452] Nucleic acid lipoplex particles (such as RNA lipoplex particles) described herein have an average diameter that in some embodiments ranges from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 250 to about 700 nm, from about 400 to about 600 nm, from about 300 nm to about 500 nm, or from about 350 nm to about 400 nm. In specific embodiments, the RNA lipoplex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm. In an embodiment, the nucleic acid lipoplex particles (such as RNA and / or DNA lipoplex particles) have an average diameter that ranges from about 250 nm to about 700 nm. In another embodiment, the nucleic acid lipoplex particles (such as RNA and / or DNA lipoplex particles) have an average diameter that ranges from about 300 nm to about 500 nm. In an exemplary embodiment, the nucleic acid lipoplex particles (such as RNA and / or DNA lipoplex particles) have an average diameter of about 400 nm.

[0453] The nucleic acid lipoplex particles (such as RNA lipoplex particles) and compositions comprising nucleic acid lipoplex particles (such as RNA lipoplex particles) described herein are useful for delivery of nucleic acid (such as RNA) to a target tissue after parenteral administration, in particular after intravenous administration.

[0454] Spleen targeting RNA lipoplex particles are described in WO 2013 / 143683, herein incorporated by reference. It has been found that RNA lipoplex particles having a net negative charge may be used to preferentially target spleen tissue or spleen cells such as antigen- presenting cells, in particular dendritic cells. Accordingly, following administration of the RNA lipoplex particles, RNA accumulation and / or RNA expression in the spleen occurs. Thus, nucleic acid (such as RNA) lipoplex particles of the disclosure may be used for expressing nucleic acid (such as RNA) in the spleen.

[0455] In one embodiment, after administration of the RNA lipoplex particles, RNA accumulation and / or expression in antigen presenting cells, such as professional antigen presenting cells in the spleen occurs. Thus, nucleic acid (such as RNA) lipoplex particles of the disclosure may be used for expressing nucleic acid (such as RNA), e.g., nucleic acid (such as RNA) encoding an antigen or at least one epitope, in such antigen presenting cells. In one embodiment, the antigen presenting cells are dendritic cells and / or macrophages.

[0456] The electric charge of the nucleic acid (such as RNA) lipoplex particles of the present disclosure is the sum of the electric charges present in the at least one cationic lipid and the electric charges present in the nucleic acid (such as RNA). The charge ratio is the ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the nucleic acid (such as RNA). The charge ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the nucleic acid (such as RNA) is calculated by the following equation: charge ratio=[(cationic lipid concentration (mol)) * (the total number of positive charges in the cationic lipid)] I [(nucleic acid (such as RNA) concentration (mol)) * (the total number of negative charges in nucleic acid (such as RNA))]. The concentration of nucleic acid (such as RNA) and the at least one cationic lipid amount can be determined using routine methods by one skilled in the art.

[0457] In one embodiment, at physiological pH the charge ratio of positive charges to negative charges in the nucleic acid (such as RNA) lipoplex particles is from about 1.6:2 to about 1 :2, or about 1.6:2 to about 1.1 :2. In specific embodiments, the charge ratio of positive charges to negative charges in the nucleic acid (such as RNA and / or DNA) lipoplex particles at physiological pH is about 1.6:2.0, about 1.5:2.0, about 1.4:2.0, about 1.3:2.0, about 1.2:2.0, about 1.1 :2.0, or about 1 :2.0.

[0458] Lipid nanoparticles (LNPs)

[0459] In some embodiments, RNA described herein is present in the form of lipid nanoparticles (LNPs). The LNP may comprise any lipid capable of forming a particle to which the one or more nucleic acid molecules are attached, or in which the one or more nucleic acid molecules are encapsulated. LNPs typically comprise four components: ionizable cationic lipids, neutral lipids such as phospholipids, a steroid such as cholesterol, and a polymer-conjugated lipid such as PEG- lipid. LNPs may be prepared by mixing lipids dissolved in ethanol with nucleic acid in an aqueous buffer.

[0460] In some embodiments, the LNP comprises one or more cationic lipids, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and pegylated lipids.

[0461] In some embodiments, the LNP comprises a cationic lipid, a neutral lipid, a steroid, a polymer- conjugated lipid; and the nucleic acid (such as RNA), encapsulated within or associated with the lipid nanoparticle.

[0462] In some embodiments, the LNP comprises from 40 to 55 mol percent, from 40 to 50 mol percent, from 41 to 50 mol percent, from 42 to 50 mol percent, from 43 to 50 mol percent, from 44 to 50 mol percent, from 45 to 50 mol percent, from 46 to 50 mol percent, or from 46 to 49 mol percent, cationically ionizable lipid.

[0463] In some embodiments, the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, from 7 to 13 mol percent, or from 9 to 11 mol percent.

[0464] In some embodiments, the steroid is present in a concentration ranging from 30 to 50 mol percent, from 35 to 45 mol percent or from 38 to 43 mol percent.

[0465] In some embodiments, the LNP comprises from 1 to 10 mol percent, from 1 to 5 mol percent, or from 1 to 2.5 mol percent of the polymer-conjugated lipid.

[0466] In some embodiments, the LNP comprises from 45 to 50 mol percent a cationic lipid; from 5 to 15 mol percent of a neutral lipid; from 35 to 45 mol percent of a steroid; from 1 to 5 mol percent of a polymer-conjugated lipid; and the nucleic acid (such as RNA and / or DNA), encapsulated within or associated with the lipid nanoparticle.

[0467] In some embodiments, the mol percent is determined based on total mol of lipid present in the lipid nanoparticle. In some embodiments, the mol percent is determined based on total mol of cationic lipid, neutral lipid, steroid and polymer-conjugated lipid present in the lipid nanoparticle. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC.

[0468] In some embodiments, the steroid is cholesterol.

[0469] In some embodiments, the cationic lipid is present in the LNP in an amount from about 45 to about 50 mole percent. In some embodiments, the neutral lipid is present in the LNP in an amount from about 5 to about 15 mole percent. In some embodiments, the steroid is present in the LNP in an amount from about 35 to about 45 mole percent. In some embodiments, the pegylated lipid is present in the LNP in an amount from about 1 to about 5 mole percent.

[0470] Combinations and kits

[0471] Compositions provided herein may comprise two or more discrete populations of RNA molecules. Also encompassed by the invention are combinations and kits that comprise individual RNA populations (i.e., one of the two or more discrete RNA populations) and compositions comprising the same, wherein these populations are intended for mixing but are not yet mixed (i.e., they are physically separate).

[0472] The combinations and / or kits provided herein comprise two or more physically separate RNA populations, or compositions (e.g., comprising RNA-containing particles described herein) thereof. Said RNAs or population may be used as disclosed herein without mixing, or may be used as disclosed herein only after two or more of the two or more (i.e., all or any sub-range of combinations) RNA populations has been mixed to form a composition of the invention that comprises two or more discrete populations of RNA molecules.

[0473] Provided herein is a kit comprising two or more discrete populations of RNA molecules or compositions comprising the same, wherein each population of RNA molecules is provided independently and physically separate in said kit.

[0474] Provided herein is a combination comprising two or more discrete populations of RNA molecules or compositions comprising the same, wherein each population of RNA molecules is provided independently and physically separate.

[0475] In one embodiment, there is provided a kit comprising the components of a vaccine comprising the RNA or a composition according to the invention. In one embodiment, there is provided a vaccine comprising the RNA or a composition according to the invention.

[0476] Chemically synthesized RNAs

[0477] The RNAs of the present invention are fully synthetic molecules that are generated independently of a cellular system and independently of enzyme-based polymerisation that utilizes a DNA template (e.g., as in IVT).

[0478] In one embodiment, the RNA is a synthetic RNA that is synthesized independently of a DNA template. In one embodiment, the RNA is the RNA is not produced by IVT.

[0479] In one embodiment, the RNA is chemically synthesized using a solid-phase synthesis method. In one embodiment, the RNA is synthesized using phosphoramidite synthesis. In one embodiment, the RNA is chemically synthesized using a solid-phase phosphoramidite synthesis method. Phosphoramidite synthesis, as well as other methods of chemical synthesis are well known in the art (see e.g., Roy S & Caruthers M., Molecules. 2013; 18(11): 14268-84; Flemmich L, et al., Angew Chem Int Ed Engl. 2024; 63(22):e202403063; Watts J. K. & Gait M. J., in Nucleic Acids in Chemistry and Biology, ed. Blackburn, G. M., et al. , The Royal Society of Chemistry, 4th edn, 2022, pp. 279-323.) and may be used to generate fully synthetic RNAs as described herein.

[0480] Methods of manufacture

[0481] The present invention also encompasses methods of making RNAs and compositions of the invention.

[0482] In one aspect, there is provided a method of manufacturing the RNA molecule of the invention, said method comprising the step of: (a) chemical synthesis of said RNA molecule.

[0483] In one aspect, there is provided a method of manufacturing the composition the invention, said method comprising the step of: (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules.

[0484] In one embodiment, there is provided a method of manufacturing the composition the invention, said method comprising the steps of: (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules;

[0485] (b) storing each discrete population of RNA molecules separately until required; and

[0486] (c) mixing the populations of RNA molecules synthesised in part (a) to form a composition comprising a mixture of discrete RNA populations.

[0487] In one embodiment, there is provided a method of manufacturing the composition the invention, said method comprising the steps of:

[0488] (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules; and

[0489] (b) mixing the populations of RNA molecules synthesised in part (a) to form a composition comprising a mixture of discrete RNA populations.

[0490] In one embodiment, the mixing is performed immediately after synthesis.

[0491] In one embodiment, the mixing is performed immediately prior to use, such as immediately before administering the RNA or composition to a cell or a subject.

[0492] In one embodiment, the mixing is performed within 24 hours of use, such as within 22 hours of use, such as within 20 hours of use, such as within 18 hours of use, such as within 16 hours of use, such as within 14 hours of use, such as within 12 hours of use, such as within 10 hours of use, such as within 8 hours of use, such as within 6 hours of use, such as within 4 hours of use, such as within 2 hours of use, or within 1 hour of use.

[0493] In one embodiment, the chemical synthesis is solid-phase synthesis. In one embodiment, the chemical synthesis is phosphoramidite synthesis. In one embodiment, the chemical synthesis is solid-phase phosphoramidite synthesis.

[0494] In some embodiments, prior to step (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules, the method comprises the step of identifying one or more cancer antigens, optionally one or more non-neo-epitopes and / or cancer neoepitopes present in a subject and using said cancer antigens, optionally one or more non- neo-epitopes and / or cancer neo-epitopes to design the ORF sequence(s) encoded by the RNA.

[0495] In some embodiments, prior to step (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules, the method comprises the step of identifying one or more auto-antigens present in a subject and using said auto-antigens to design the ORF sequence(s) encoded by the RNA.

[0496] In one aspect, there is provided an RNA or composition manufactured according to any of the methods described herein.

[0497] Further methods and uses

[0498] RNAs, and compositions described herein, optionally formulated in particles, may be used in the therapeutic or prophylactic treatment of various diseases, in particular diseases in which provision of a polypeptide to a subject results in a therapeutic or prophylactic effect. For example, provision of an antigen or epitope which is derived from a virus may be useful in the treatment of a viral disease caused by said virus. Provision of a tumor antigen or epitope may be useful in the treatment of a cancer disease wherein cancer cells express said tumor antigen.

[0499] RNAs, and compositions described herein, optionally formulated in particles, may also be used in non-therapeutic scenarios.

[0500] The term "disease" (also referred to as "disorder" herein) refers to an abnormal condition that affects the body of an individual. A disease is often construed as a medical condition associated with specific symptoms and signs. A disease may be caused by factors originally from an external source, such as infectious disease, or it may be caused by internal dysfunctions, such as autoimmune diseases. In humans, "disease" is often used more broadly to refer to any condition that causes pain, dysfunction, distress, social problems, or death to the individual afflicted, or similar problems for those in contact with the individual. In this broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, isolated symptoms, deviant behaviors, and atypical variations of structure and function, while in other contexts and for other purposes these may be considered distinguishable categories. Diseases usually affect individuals not only physically, but also emotionally, as contracting and living with many diseases can alter one's perspective on life, and one's personality.

[0501] In the present context, the term "treatment", "treating" or "therapeutic intervention" relates to the management and care of a subject for the purpose of combating a condition such as a disease. The term is intended to include the full spectrum of treatments for a given condition from which the subject is suffering, such as administration of the therapeutically effective compound to alleviate the symptoms or complications, to delay the progression of the disease, disorder or condition, to alleviate or relief the symptoms and complications, and / or to cure or eliminate the disease, disorder or condition as well as to prevent the condition, wherein prevention is to be understood as the management and care of an individual for the purpose of combating the disease, condition or disorder and includes the administration of the active compounds to prevent the onset of the symptoms or complications.

[0502] The term "therapeutic treatment" relates to any treatment which improves the health status and / or prolongs (increases) the lifespan of an individual. Said treatment may eliminate the disease in an individual, arrest or slow the development of a disease in an individual, inhibit or slow the development of a disease in an individual, decrease the frequency or severity of symptoms in an individual, and / or decrease the recurrence in an individual who currently has or who previously has had a disease.

[0503] The terms "prophylactic treatment" or "preventive treatment" relate to any treatment that is intended to prevent a disease from occurring in an individual. The terms "prophylactic treatment" or "preventive treatment" are used herein interchangeably.

[0504] The terms "individual" and "subject" are used herein interchangeably. They refer to a human or another mammal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate), or any other non-mammal-animal, including birds (chicken), fish or any other animal species that can be afflicted with or is susceptible to a disease (e.g., cancer, infectious diseases) but may or may not have the disease, or may have a need for prophylactic intervention such as vaccination, or may have a need for interventions such as by protein replacement or immune stimulation. In many embodiments, the individual is a human being. Unless otherwise stated, the terms "individual" and "subject" do not denote a particular age, and thus encompass adults, elderlies, children, and newborns. In some embodiments of the present disclosure, the "individual" or "subject" is a "patient".

[0505] The term "patient" means an individual or subject for treatment, in particular a diseased individual or subject.

[0506] RNAs or compositions described herein, may be administered to a subject for treating or preventing a disease in a subject, wherein the RNA encodes a therapeutic or prophylactic polypeptide and wherein delivering the therapeutic or prophylactic polypeptide to the subject is beneficial in treating or preventing the disease. In some embodiments, the RNA or composition is administered in a pharmaceutically effective amount.

[0507] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0508] In some embodiments of the disclosure, the aim is to induce an immune response by providing a vaccine.

[0509] A person skilled in the art will know that one of the principles of immunotherapy and vaccination is based on the fact that an immunoprotective reaction to a disease is produced by immunizing a subject with an antigen or an epitope (such as that encoded by the ORF of the RNA herein), which is immunologically relevant with respect to the disease to be treated. Accordingly, RNAs described herein are applicable for inducing or enhancing an immune response. RNAs described herein are thus useful in a prophylactic and / or therapeutic treatment of a disease involving an antigen or epitope.

[0510] In some embodiments of the disclosure, the aim is to treat cancer by vaccination.

[0511] It is envisaged that treatment of cancers may be achieved in a patient-specific manner in order to provide a customizable and personalized medicine. In particular, it is envisaged that cancer antigens or neo-antigens may be identified that are relevant to a single patient and that said antigens or neo-antigens are used to design the ORFs contained within the RNA or compositions of the present invention. In a particularly preferred embodiment, the composition of the invention comprises two or more discrete populations of RNA molecules, each population encoding a different polypeptide that is derived from the patient that is to be the recipient of the composition.

[0512] In some embodiments, the vaccine is a patient-specific vaccine.

[0513] In some embodiments of the disclosure, the aim is to provide protection against an infectious disease by vaccination.

[0514] In some embodiments of the disclosure, the aim is to modulate / reprogram immune cells in the blood. In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for use in medicine. In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for the manufacture of a medicament. In one embodiment, there is provided a method for the treatment or prevention of a disease or disorder, the method comprising administering the RNA, composition, or pharmaceutical composition of the invention to a subject.

[0515] In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for use in the treatment or prevention of cancer. In one embodiment, the cancer is a solid cancer.

[0516] In one embodiment, the composition of the invention comprises two or more discrete populations of RNA molecules, each population encoding a different polypeptide that is derived from a single cancer.

[0517] Preferably one or more, more preferably two or more, neo-antigens or neo-epitopes are known that are associated with the cancer, said neo-antigens or neo-epitopes comprising sequences that are comprised within the polypeptide encoded by the ORF.

[0518] In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for use in the treatment or prevention of an infectious disease. In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for use in the treatment or prevention of a viral disease.

[0519] In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for use in the treatment or prevention of allergies.

[0520] In one embodiment, there is provided the RNA, composition, or pharmaceutical composition for use in the treatment or prevention of autoimmune diseases or disorders.

[0521] In one embodiment, the autoimmune disease or disorder is selected from the group consisting of: autoimmune encephalomyelitis, Addison disease, celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis, myasthenia gravis, pernicious anemia, reactive arthritis, rheumatoid arthritis, Sjogren syndrome, systemic lupus erythematosus (lupus), and Type I diabetes. In one embodiment, the autoimmune disease or disorder is autoimmune encephalomyelitis. In one embodiment, the autoimmune disease or disorder is multiple sclerosis. It is envisaged that treatment of autoimmune diseases or disorders may be achieved in a patient-specific manner in order to provide a customizable and personalized medicine. In particular, it is envisaged that auto-antigens may be identified that are relevant to a single patient and that said auto-antigens are used to design the ORFs contained within the RNA or compositions of the present invention. Moreover, the auto-antigens may all relate to a single auto-immune disease or disorder or, alternatively, may each be directed to different autoimmune diseases or disorders.

[0522] As used above, said composition will be understood to encompass the compositions of the invention comprising two or more discrete populations of RNA molecules.

[0523] In one embodiment, there is provided an in vitro, in vivo, or ex vivo method of expressing a polypeptide in one or more cells, said method comprising the step of introducing the RNA or the composition, or the pharmaceutical composition of the invention to one or more cells.

[0524] In one embodiment, there is provided an in vitro, in vivo, or ex vivo method of expressing a therapeutic or prophylactic polypeptide in one or more cells, said method comprising the step of introducing the RNA or the composition, or the pharmaceutical composition of the invention to one or more cells, preferably one or more cells of a subject, preferably in vivo.

[0525] In one embodiment, there is provided an in vitro, in vivo, or ex vivo method of stimulating antigen-specific T cells, said method comprising the step of introducing the RNA or the composition, or the pharmaceutical composition of the invention to one or more cells.

[0526] In one embodiment, the cell or cells is / are capable of processing and presenting polypeptide epitopes to T cells and / or stimulating and / or activating T cells.

[0527] In one embodiment the one or more cells is present within a mixed population of cells comprising cells of two or more different cell types, optionally wherein the cells are all from the same subject, or wherein the cells are from one or more subjects. In one embodiment, the one or more cells are present in a subject. In one embodiment, the one or more cells are not in a subject, such as in vitro or ex vivo cells. In one embodiment, the one or more cells are all of the same cell type. In one embodiment, one or more of the one or more cells is / are dendritic cells. In one embodiment, one or more of the one or more cells are the cells of a subject.

[0528] Any methods described herein can be carried out in vitro, in vivo, or ex vivo. When a composition comprising two or more discrete populations of RNA molecules according to the invention are delivered to a cell, a population of cells, or a vessel or subject containing said cells, it will be understood that different permutations of the combination of discrete populations may be present within any given single cell. For example, when a composition comprising the notional RNA populations X, Y, and Z are delivered to a two or more cells, one cell may contain X, another X and Z, another Y and Z, etc. Thus, different combinations of each discrete population of RNA molecules may be present in any one cell.

[0529] Definitions

[0530] Any reference to RNA in the singular also includes RNA in the plural (i.e., RNAs or a population of RNAs), unless specifically stated otherwise.

[0531] RNAs of the present invention are chemically synthesized RNAs, that is, they are produced independently of a DNA template and / or enzymatic processes such as those used in in vitro transcription (IVT). The in vitro transcription methodology is known to the skilled person; cf. , e.g., Molecular Cloning: A Laboratory Manual, 4thEdition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012. Such fully synthetic or fully chemically synthesized RNAs may also be termed ChemRNAs.

[0532] RNAs described herein may be referred to as having a specific ‘structure’ or ‘formula’, these terms denote a specific modular structure of RNA upstream and downstream elements (if present) that can be combined with an ORF. It will be understood that any formula may be combined with any ORF. Further the formula may simply consist of only an ORF.

[0533] Herein the term ORF refers to a contiguous region of nucleotide sequence that encodes a polypeptide. Herein, in frame start and stop codons at the 5’ and 3’ end of the ORF (if present) are not considered to be part of the ORF sequence; rather they are up- and down-stream elements that can be removed in accordance with the disclosures herein.

[0534] Upstream and downstream elements as used herein refer to nucleotides sequences present 5’ or 3’ to the ORF, respectively. These sequences may represent sequence elements that are known in the art. These sequences / elements may have specific functions.

[0535] Reference to in cellulo applications will be understood to constitute either or both in vitro and in vivo applications, depending upon where the cell is located. Citation of documents and studies referenced herein is not intended as an admission that any of the foregoing is pertinent prior art. All statements as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the contents of these documents.

[0536] The description (including the following examples) is presented to enable a person of ordinary skill in the art to make and use the various embodiments. Descriptions of specific devices, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Thus, the various embodiments are not intended to be limited to the examples described herein and shown, but are to be accorded the scope consistent with the claims.

[0537] EXAMPLES

[0538] The present invention will be further described by way of the following non-limiting examples.

[0539] Example 1 - minimal protein-encoding RNAs are translated and induce neoepitopespecific T cells in vivo following vaccination

[0540] Minimal protein-encoding RNAs of the invention were assessed for their in vitro / ex vivo, and in vivo ability to express a variety of polypeptides encoded by the ORF within the RNA, and the ability of these polypeptides to stimulate antigen-specific T cell responses.

[0541] In particular, the main objective of the present example was to assess:

[0542] • the impact of different sequence features (elements) found in mRNAs, backbone modifications, and the nature of the encoded polypeptide sequence lengths on RNA translation and epitope presentation ex vivo;

[0543] • the immunogenicity of a mixture of cancer neoepitope-encoding RNAs in vivo; and

[0544] • the functionality of any induced neoepitope-specific T cells ex vivo

[0545] In vivo induction of neoepitope-specific T cells

[0546] To test whether RNAs of the invention could be used to induce T cell responses against neoepitopes in vivo, RNAs were produced, each encoding a single neoepitope from the murine MC38 cell line. Ten of these RNAs - each encoding a distinct neoepitope - were mixed and formulated into an RNA-lipoplex (RNA-LPX) vaccine using liposomes. The identity of the neoepitopes / neoantigens is set out in Table 2 below.

[0547] Table 2: list of polypeptide neoantigens

[0548] Mice were administered a vaccine comprising a mixture of RNAs according to the invention (Figures 1A & 2A) three times at a 7 day interval (i.e., on days 0, 7, and 14), and samples were taken periodically to assess the induction of neoepitope-specific T cells in the blood and spleen.

[0549] Study 1 : vaccination and ex vivo analysis of antigen expression and T cell responses

[0550] Four female C57BL / 6 mice per treatment group were vaccinated three times via intravenous (i.v.) injection with RNA-LPX containing:

[0551] • Gr. 1 : A mixture of two IVT RNAs each encoding ten neoepitopes, the sequences of said RNAs are as set out in SEQ ID NOs: 36 and 37, and Table 3; or

[0552] • Gr. 2: A mixture of ten ChemRNAs each encoding a single MC38 neoepitope as set out in Table 2. The individual RNA sequences used correspond to SEQ ID NOs: 11 to 20, as set out in Table 3.

[0553] Blood was analyzed 7, 14, and 20 days after the first vaccination (i.e., day 0). On day 20, mice were euthanized and splenocytes were analyzed for immunogenicity and T cell functionality and co-cultured with lipofected BMDCs to evaluate translational efficiency of various RNA candidates.

[0554] The chemically synthesized RNAs used for lipofection of BMDCs in the ex vivo assays are SEQ ID NOs: 21 to 34 (see Table 3), and the IVT control RNA for the same assays is of SEQ ID NO: 35. Flow cytometry analysis of T cells from blood of mice immunized with RNA-LPX (Figure 1 B) revealed that the composition of RNAs according to the invention (termed “ChemRNA”) are capable of inducing vaccine specific CD8+T cells in vivo. The proportion of CD8+T cells that are vaccine specific increases over time and following subsequent immunizations.

[0555] IFNy ELISpot analysis of splenocytes six days after the 3rd vaccination was then performed (Figures 1C & D). Splenocytes were restimulated with peptides to assess expansion and functionality of neoepitope specific T cells. Both, RNA-LPX vaccination with IVT-RNAs (represented by circles) and ChemRNAs (represented by squares) induced functional CD8+T cells against several vaccine encoded epitopes in vivo.

[0556] Splenocytes of treatment group 1 (Gr. 1) were pooled and co-cultured with BMDCs lipofected with RNAs having the indicated construct designs and subjected to IFNy ELISpot analysis. It is noted that each ORF indicated had a start codon but only those with a polyA tail had a stop codon (the others did not). The ORF of the depicted construct designs encoded either the minimal epitope only (M), which are of 8 or 9 amino acids in length, or the minimal epitope with 3 flanking amino acids (M3) on each end of the epitope, or the minimal epitope extended to a 20 or 27 amino acid long sequence with the mutation located in the center. The results demonstrate that (a) all construct designs have the potential to induce IFNy secretion of in vivo expanded neoepitope specific T cells and (b) various combinations of RNA features lead to stronger T cell responses as compared to encoding the minimal epitope only.

[0557] Table 3: list of RNAs utilised in Study 1

[0558]

[0559] Wherein * denotes a phosphorothioate internucleoside linkage between adjacent nucleotides. 5’Cap denotes a 5' N7-Methylguanosine-triphosphate Cap.

[0560] Study 2: vaccination and ex vivo analysis of antigen specific T cell responses

[0561] Six female C57BL / 6 mice per treatment group were vaccinated three times via intravenous

[0562] (i.v.) injection with RNA-LPX containing:

[0563] • Gr. 1: An IVT RNA encoding ten neoepitopes, the sequence of said RNA is as set out in SEQ ID NO: 68, and Table 4; or Gr. 2 to 5: Ten RNA populations, each population encoding a different MC38 neoepitope as set out in Table 2. The individual RNA sequences used correspond to SEQ ID NOs: 38 to 67, as set out in Table 4.

[0564] Test groups are distinguished either by the nature of the RNA formula (i.e., the combination of regulatory elements) or the dose (i.e., groups 3 and 4).

[0565] Blood was analyzed 7, 14, and 21 days after the first vaccination (Figure 2A). On Day 21 , mice were euthanized and splenocytes were analyzed for immunogenicity and T cell functionality.

[0566] Flow cytometry analysis of T cells from blood of mice immunized with RNA-LPX (Figure 2B) revealed that the composition of RNAs according to the invention are capable of inducing vaccine specific CD8+T cells in vivo.

[0567] Splenocytes were restimulated with peptides (Figure 2C) to assess expansion and functionality of neoepitope specific T cells. The results indicated that both RNA-LPX vaccination with IVT-RNAs (represented by circles) and ChemRNAs (represented by squares or triangles) were able to generate functional CD8+T cells against multiple epitopes encoded by the vaccine in vivo.

[0568] Table 4: list of RNAs utilised in Study 2

[0569]

[0570] Wherein * denotes a phosphorothioate internucleoside linkage between adjacent nucleotides. 5’Cap denotes a 5' N7-Methylguanosine-triphosphate Cap.

[0571] Summary of results

[0572] Studies 1 and 2 of Example 1 show that that the combination of certain RNA features increases the protein translated from RNAs and is associated with an enhanced T cell response in vivo. Further, the data provide proof of concept that a mixture of RNAs, each encoding a distinct polypeptide, can be used for vaccination against multiple antigens (such as neoepitopes) and is capable of inducing antigen-specific T cell responses against the multiple epitopes.

[0573] Example 2 - investigating the effects of different construct elements on ChemRNA translation efficiency and T-cell activation

[0574] Modular elements of the protein-encoding RNAs (or ChemRNAs) of the invention were assessed in respect of their ability both to express - i.e., drive translation of - polypeptides encoded by the ORF within the RNA, and the ability of encoded polypeptides to stimulate antigen-specific T cell responses.

[0575] Material and Methods iDC generation

[0576] Immature dendritic cells (iDCs) were generated from CD14+ peripheral blood mononuclear cells (PBMCs). PBMCs were isolated from healthy donor blood using Ficoll-Paque density gradient centrifugation. CD14+ monocytes were then purified from PBMCs by positive selection using anti-CD14 magnetic beads (Miltenyi Biotec) according to the manufacturer's instructions. The isolated CD 14+ cells were seeded in T175 culture flasks at a density of 1 x 106cells / mL in RPMI 1640 medium supplemented with 5% human serum, 1 % Non-Essential Amino acids and 1 % Sodium Pyruvate. To induce differentiation into iDCs, the culture medium was supplemented with 200 ng / mL recombinant human GM-CSF and 200 ng / mL recombinant human IL-4. Cells were incubated at 37°C in a humidified atmosphere containing 5% CO2 for 5-6 days, with half of the medium replaced every 2-3 days with fresh cytokine-containing medium. Following harvesting and counting, the cells were either immediately utilized in the assay or cryopreserved in FBS with 10% DMSO.

[0577] HEK293 LqBiT Culture Conditions

[0578] The HEK293 LgBiT cell line (Promega, N2672) was cultured as adherent cells in a humidified incubator at 37°C with 5% CO2. Cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) with GlutaMAX supplemented with 10% heat-inactivated fetal bovine serum (FBS). For selection, 200 pg / mL Hygromycin B was added to the culture medium after the first subculture following cell thawing. Cells were passaged at 70-80% confluency, typically twice per week. For detachment, the culture medium was aspirated, and cells were washed with DPBS. Accutase was applied for 3-5 minutes at room temperature. Detached cells were collected, centrifuged at 150 x g for 5 minutes, and reseeded at a density of 0.01-0.02 x 106cells / cm2, depending on the desired confluence after 3-4 days.

[0579] T-Cell Activation Assay with ChemRNA-Transfected Dendritic Cells (Jurkat-NFAT assay) Immature dendritic cells (iDCs) were harvested, counted, and seeded in 48-well plates at 1.25X106cells / mL in culture media. The following day, iDCs were transfected with 30 pmol of ChemRNA using MessengerMax reagent according to the manufacturer's instructions. Transfection complexes were added to iDCs in fresh media (200 pL / well) and incubated for 7 hours.

[0580] Concurrently, Jurkat-NFAT effector cells were harvested, washed twice with X-VIVO 15 medium, and assessed for viability (>90% required). Effector cells were electroporated with 10 pg each of alpha and beta TCR chain RNA or mock-transfected using a plate electroporator.

[0581] After 7 hours of lipofection, iDCs and Jurkat cells were harvested, washed, and resuspended at 0.8X 106cells / mL and 1.6X 106cells / mL, respectively. For the activation assay, 12.5 pL of effector and target cell suspensions were distributed into a 384-well plate. Plates were sealed with gas-permeable film, centrifuged briefly (300 x g, 1 min), and incubated overnight at 37°C, 5% CO2. The following day a Luciferase readout was performed by adding 15 pL of Bio-Gio at RT to each used well. The plate was subsequently measured on the Clariostar Plus Plate reader with a gain of 3500. Results are normalized to negative controls (co-cultures of TCR- electroporated Jurkats with untreated target cells).

[0582] Electroporation of iDCs with larqeBit coding RNA Cryopreserved dendritic cells (DCs) were thawed in a 37°C water bath. Cells were immediately transferred to a 50 mL tube containing 9 mL pre-warmed X-Vivo15 medium per thawed vial. The cell suspension was centrifuged at 300 x g for 8 minutes at room temperature (RT). The cell pellet was resuspended in 20 mL X-Vivo15 and filtered through a 70 pm cell strainer. After centrifugation, cells were resuspended in 5 mL X-Vivo15 and counted using erythrosine B staining. For electroporation, the required number of cells was centrifuged and resuspended in X-Vivo15 at a concentration of 20x106cells / mL. 250 pL of cell suspension was added to a 4 mm electroporation cuvette. LgBiT RNA was pre-diluted 1 :10 in X-Vivo15, and 6 pg RNA was added to the cell suspension. Electroporation was performed at 300 V for 12 ms with a single pulse. Post-electroporation, cells were transferred to a 15 mL tube by rinsing the cuvette twice with 2 mL IVS medium (IMDM GlutaMAX + 5% human AB serum). The cell suspension was centrifuged, resuspended in 1 mL of the respective medium per electroporation, and counted using erythrosine B staining. 1x105cells (50 pL) were seeded in white transparent F- bottom plates and incubated overnight at 37°C with 5% CO2.

[0583] HiBiT Assay with ChemRNA-transfected Dendritic Cells and HEK293 LgBiT cells Electroporated iDCs or HEK293 LgBiT cells were transfected with 175 or 20 pmol of ChemRNA using MessengerMax reagent according to the manufacturer's instructions. The Endurazine substrate was prepared by diluting it 1 :100 in the appropriate culture medium. Subsequently, 100 pL of this diluted substrate solution was added to each well. Luminescence measurements were conducted over a period of up to 72 hours using the Tecan Infinite M200 Plate Reader.

[0584] Results

[0585] Assays were performed to assess the impact on translation efficiency and T-cell activation of varying different construct elements within the minimal protein-encoding RNAs (“ChemRNAs”) of the invention, in order to further optimize the construct format. The impact of the 5’UTR, poly(A) tail length and various modifications were tested.

[0586] Constructs with and without a 5’UTR, and with different 5’UTR sequences, were tested. Constructs with and without a poly(A) tail, and with different lengths of poly(A) tail, were tested. The ability of different ChemRNA constructs to tolerate different types of modification was also tested. The ORFs encoded were assay-specific and were either (i) the 11-amino acid HiBit tag (HiBiT assay), or (ii) a 27-amino acid epitope sequence with a central mutation (Jurkat- NFAT assay). ChemRNA constructs having the following general formula were used in the experiments:

[0587] HO-[5’UTR]*-Start-ORF-Stop-[Poly(A)]*

[0588] (* = may be absent or present and varied; 5’, 3’, base or linker modifications may be included)

[0589] For example, a ChemRNA construct may have the following sequence:

[0590] HO-[5’UTR, e.g., ACAAG (TISU)]-AUG-[ORF, e.g., GUGAGCGGAUGGAGACUGUUCAAAAAGAUCAGU (HiBiT; SEQ ID NO: 75)]- UAA-(A)n

[0591] (e.g., where n = 0, 6, 12, 18, 36, 60)

[0592] An exemplary ChemRNA sequence used in some experiments is C0171 :

[0593] ACAAG-AUG-GUGAGCGGAUGGAGACUGUUCAAAAAGAUCAGU-UAA- AAAAAAAAAAAAAAAAAA (SEQ ID NO: 76)

[0594] (where dashes simply serve to illustrate the boundary of different construct elements; the nucleotides shown are contiguous)

[0595] The experiments revealed several important insights into the translation efficiency and T-cell activation potential of the minimal protein-encoding RNAs of the invention (ChemRNAs). The addition of a short poly(A) tail significantly improved both T-cell activation and ChemRNA translation efficiency in dendritic cells (DCs) and HEK293 cells. A bell-shaped distribution was observed when testing various poly(A) tail lengths, with an optimal length identified between 18 and 60 adenosines (Figure 3). In particular, a poly(A) tail length of between 18 to 36 adenosines was observed to provide a beneficial effect, whilst maintaining a short construct length. These findings demonstrate that the addition of a short poly(A) tail enhances T-cell activation and improves ChemRNA translation efficiency.

[0596] ChemRNAs completely modified with phosphorothioate were still capable of being translated and activating T cells. In ChemRNA constructs lacking a poly(A) tail, constructs with or without complete phosphorothioate modification performed similarly. Complete phosphorothioate modification of a poly(A)-containing ChemRNA construct reduced translation efficiency and T- cell activation, although modifying only the poly(A) tail did not result in the same negative effects. Notably, modifying every second phosphodiester bond within the poly(A) tail enhanced translation efficiency and improved T-cell activation (Figure 4).

[0597] The inclusion of a 5’IITR sequence in the ChemRNA construct enhanced translation efficiency and T-cell activation. All 6 different tested 5'llTRs, having a range of sequences and lengths, increased T-cell activation compared to a construct without 5'IITR. Two constructs (C0171 and C0176) showed significantly lower translation only in the HiBiT assay using DCs, despite showing enhanced T cell activation in the Jurkat assay. The reason for this discrepancy may be attributed to varying open reading frame lengths between the HiBiT and Jurkat assays (Figure 5).

[0598] A number of different RNA modifications were tested for their effects on ChemRNA translation efficiency and T cell activation. In all cases the modified ChemRNAs were capable of being translated and activating T cells. Some modifications (monophosphate, 2'0-methyl adenosine, and the substitution of uridine with pseudouridine) negatively impacted ChemRNA translation and T-cell activation. In contrast, some modifications (inverted thymidine) improved ChemRNA translation and T-cell activation, potentially due to increased stability (Figure 6).

[0599] Overall, the addition of a short poly(A) tail and a short 5'IITR (TISII) sequence to the ChemRNA constructs enhances T-cell activation and improves ChemRNA translation efficiency (Figure 7). The trend of an additive improvement with each feature was clearly observable; the HiBiT assay in iDCs for construct C0117 / C0171 is potentially attributable to the different peptides encoded by the RNAs used in HiBiT Vs T-cell activation assays and / or the difference in effect being measured by said assays.

[0600] NUMBERED EMBODIMENTS

[0601] The invention will now be described by the following numbered embodiments.

[0602] Embodiment 1. An RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):

[0603] X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:

[0604] X comprises one or more upstream elements selected from a:

[0605] (a) 5’ cap;

[0606] (b) 5’UTR; and / or

[0607] (c) start codon; and / or;

[0608] Y comprises one or more downstream elements selected from a:

[0609] (d) stop codon;

[0610] (e) 3’UTR; and / or

[0611] (f) polynucleotide tract, optionally a polyA tract.

[0612] Embodiment 2. The RNA of embodiment 1 , wherein the RNA does not comprise one or more of the elements set out in (a) to (f), optionally wherein the RNA does not comprise 2, 3, 4, 5, or 6 of the elements set out in (a) to (f).

[0613] Embodiment 3. The RNA of embodiment 1 or embodiment 2, wherein the RNA does not comprise:

[0614] (a) a 5’cap;

[0615] (b) a 3’UTR;

[0616] (c) a stop codon;

[0617] (d) both a 3’IITR and a stop codon;

[0618] (e) both a 5’cap and a 3’IITR, and / or

[0619] (f) all three of a 5’cap, stop codon, and 3’IITR.

[0620] Embodiment 4. The RNA of any of embodiments 1 to 3, wherein the RNA does not comprise a 5’cap.

[0621] Embodiment 5. The RNA of any of embodiments 1 to 4, wherein the RNA comprises neither a 5’cap or a 3’IITR. Embodiment 6. The RNA of any of embodiments 1 to 5, wherein the RNA molecule is of formula:

[0622] (a) start codon - ORF (formula ii);

[0623] (b) 5’IITR - start codon - ORF (formula iii);

[0624] (c) start codon - ORF - stop codon - polyA tract (formula iv);

[0625] (d) 5’ cap - start codon - ORF (formula v);

[0626] (e) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi);

[0627] (f) 5’cap - 5’IITR - start codon - ORF (formula vii);

[0628] (g) 5’cap - start codon - ORF - stop codon - polyA tract (formula viii); or

[0629] (h) 5’cap - 5’IITR - start codon - ORF - stop codon - polyA tract (formula ix).

[0630] Embodiment 7. The RNA of any of embodiments 1 to 6, wherein the RNA molecule is of formula: 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi).

[0631] Embodiment 8. The RNA of any of embodiments 1 to 6, wherein the RNA molecule is of formula: start codon - ORF - stop codon - polyA tract (formula iv).

[0632] Embodiment 9. The RNA of any of embodiments 1 to 8, wherein the RNA is a synthetic RNA that is synthesized independently of a DNA template.

[0633] Embodiment 10. The RNA of any of embodiments 1 to 9, wherein the RNA is single-stranded.

[0634] Embodiment 11. The RNA of any of embodiments 1 to 10, wherein the combined length of the upstream and downstream elements, if present, is 3 to 106 nucleotides.

[0635] Embodiment 12. The RNA of any of embodiments 1 to 11 , wherein the RNA is 27 to 187 nucleotides in length.

[0636] Embodiment 13. The RNA of any of embodiments 1 to 12, wherein the RNA comprises one or more non-canonical nucleotides and / or one or more nucleotides arranged in a non- canonical configuration.

[0637] Embodiment 14. The RNA of any of embodiments 1 to 13, wherein the RNA comprises one or more non-canonical nucleotides and / or one or more nucleotides arranged in a non- canonical configuration selected from the group consisting of: an inverted nucleotide, preferably inverted thymidine, 2'0-Methyl adenosine, pseudouridine, 1 -methylpseudouridine, and a monophosphate nucleotide.

[0638] Embodiment 15. The RNA of embodiment 13 or embodiment 14, wherein the one or more non-canonical nucleotides and / or one or more nucleotides arranged in a non-canonical configuration is / are present:

[0639] (a) at the 5’ end of the RNA molecule;

[0640] (b) at the 3’ end of the RNA molecule;

[0641] (c) within the one or more upstream elements;

[0642] (d) within the one or more downstream elements; and / or

[0643] (e) within the ORF.

[0644] Embodiment 16. The RNA of any of embodiments 1 to 13, wherein the 5’ terminal nucleotide or 3’ terminal nucleotide is a nucleotide as set forth in embodiment 13 or embodiment 14.

[0645] Embodiment 17. The RNA of any of embodiments 1 to 16, wherein the RNA comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage.

[0646] Embodiment 18. The RNA of any of embodiments 1 to 17, wherein the RNA comprises one or more phosphorothioate internucleoside linkage.

[0647] Embodiment 19. The RNA of embodiment 17 or embodiment 18, wherein the one or more internucleoside linkage that is not a phosphodiester internucleoside linkage is / are present between nucleosides, wherein at least one of said nucleosides is:

[0648] (a) at the 5’ end of the RNA molecule;

[0649] (b) at the 3’ end of the RNA molecule;

[0650] (c) within the one or more upstream elements;

[0651] (d) within the one or more downstream elements; and / or

[0652] (e) within the ORF.

[0653] Embodiment 20. The RNA of any of the preceding embodiments, wherein all of the internucleoside linkages in the RNA are not phosphodiester internucleoside linkages.

[0654] Embodiment 21. The RNA of any of the preceding embodiments, wherein all of the internucleoside linkages in the RNA are phosphorothioate internucleoside linkages. Embodiment 22. The RNA of any of embodiments 1 to 20, wherein the RNA molecule comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages.

[0655] Embodiment 23. The RNA of any of embodiments 1 to 19, wherein

[0656] (a) the ORF comprises only phosphodiester internucleoside linkages; and

[0657] (b) all other internucleoside linkages in the RNA molecule are not phosphodiester internucleoside linkages.

[0658] Embodiment 24. The RNA of any of embodiments 1 to 19, wherein the RNA comprises:

[0659] (a) a polyA tract wherein all of the internucleoside linkages in the polyA tract are not phosphodiester internucleoside linkages; and / or

[0660] (b) a 5’IITR wherein all of the internucleoside linkages in the 5’IITR are not phosphodiester internucleoside linkages; and wherein all of the internucleoside linkages in the remainder of the RNA molecule are phosphodiester internucleoside linkages.

[0661] Embodiment 25. The RNA of any of embodiments 1 to 19, wherein the RNA molecule comprises one or more contiguous sequence of at least 3 nucleotides in length, optionally between 5 and 10 nucleotides in length, that comprises or consists of internucleoside linkages that are not phosphodiester internucleoside linkages, optionally wherein said one or more contiguous sequence is (i) at the 3’ end, (ii) at the 5’end, or (iii) at both the 5’ end and the 3’end, of the RNA molecule.

[0662] Embodiment 26. The RNA of any of embodiments 1 to 19, wherein the RNA molecule comprises a 5’IITR, and wherein the 5’IITR comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the 5’IITR are phosphodiester internucleoside linkages.

[0663] Embodiment 27. The RNA of any of embodiments 1 to 19, wherein the RNA molecule comprises a polyA tract, and the polyA tract comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0664] Embodiment 28. The RNA of any of embodiments 1 to 27, wherein the polypeptide encoded by the ORF is 8 to 50 amino acids in length, preferably 8 to 27 amino acids in length, optionally wherein the polypeptide is capable of being processed in a cell to form a shorter polypeptide sequence than the sequence translated from the ORF.

[0665] Embodiment 29. The RNA of any of embodiments 1 to 28, wherein the polypeptide encoded by the ORF is a fragment of a naturally occurring polypeptide that is longer than the polypeptide encoded by the ORF.

[0666] Embodiment 30. The RNA of any of embodiments 1 to 29, wherein the polypeptide encoded by the ORF comprises or consists of a contiguous amino acid sequence that is capable of forming a peptide-MHC complex (pMHC), optionally wherein said pMHC is capable of binding to a T cell receptor (TOR).

[0667] Embodiment 31 . The RNA of any of embodiment 30, wherein the MHO is a class I MHO and optionally, wherein the TOR is a TOR derived from or presented on a CD8+ T cell.

[0668] Embodiment 32. The RNA of any of embodiments 1 to 31 , wherein the polypeptide encoded by the ORF is derived from a human or non-human polypeptide sequence.

[0669] Embodiment 33. The RNA of any of embodiments 1 to 32, wherein the peptide encoded by the ORF is a cancer antigen, optionally a cancer non-neo-antigen or cancer neo-antigen.

[0670] Embodiment 34. The RNA of any of embodiments 1 to 32, wherein the polypeptide encoded by the ORF is derived from a human and / or animal pathogen or commensal organism, optionally a virus, bacterium, or fungi.

[0671] Embodiment 35. The RNA of any of embodiments 1 to 32 and embodiment 34, wherein the polypeptide encoded by the ORF is an allergen or an auto-antigen.

[0672] Embodiment 36. The RNA of any of embodiments 1 to 35, wherein the RNA molecule is of formula:

[0673] (a) start codon - ORF (formula ii);

[0674] (b) start codon - ORF - stop codon - polyA tract (formula iv); or (c) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi); and wherein the RNA optionally comprises one or more phosphorothioate internucleoside linkage.

[0675] Embodiment 37. The RNA of any of embodiments 1 to 36, wherein the 5’IITR, when present, is 5 to 50 nucleotides in length.

[0676] Embodiment 38. The RNA of any of embodiments 1 to 37, wherein the 5’IITR, when present, is selected from the group consisting of: TISII of SEQ ID NO: 69; full TISII of SEQ ID NO: 70; RPA39 of SEQ ID NO: 71 ; UTR2 of SEQ ID NO: 72; UTR7 of SEQ ID NO: 73; or aptamer of SEQ ID NO: 74.

[0677] Embodiment 39. The RNA of any of embodiments 1 to 38, wherein the polynucleotide tract is a poly adenosine (polyA) tract, and wherein said polyA consists of:

[0678] (a) at least 3 contiguous adenosine nucleotides, such as at least 6 contiguous adenosine nucleotides, at least 12 contiguous adenosine nucleotides, at least 18 contiguous adenosine nucleotides, at least 24 contiguous adenosine nucleotides, at least 30 contiguous adenosine nucleotides, at least 36 contiguous adenosine nucleotides, at least 42 contiguous adenosine nucleotides, at least 48 contiguous adenosine nucleotides, at least 54 contiguous adenosine nucleotides, or at least 60 contiguous adenosine nucleotides; and / or

[0679] (b) about 12 to about 60 contiguous adenosine nucleotides, about 12 to about 36 contiguous adenosine nucleotides, or about 18 to about 36 contiguous adenosine nucleotides.

[0680] Embodiment 40. The RNA of any of embodiments 1 to 39, wherein the stop codon is a UAA stop codon.

[0681] Embodiment 41. The RNA of any of embodiments 1 to 40, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0682] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the 5’IITR comprises one or more non-canonical internucleoside linkages; wherein all other internucleoside linkages in regions other than the 5’IITR are phosphodiester internucleoside linkages. Embodiment 42. The RNA of any of embodiments 1 to 41 , wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0683] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the 5’IITR comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the 5’IITR are phosphodiester internucleoside linkages.

[0684] Embodiment 43. The RNA of any of embodiments 1 to 40, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0685] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the polyA tract comprises one or more non-canonical internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0686] Embodiment 44. The RNA of any of embodiments 1 to 40 and 43, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0687] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the polyA tract comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0688] Embodiment 45. The RNA of any of embodiments 1 to 40 and 43 to 44, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (vi):

[0689] 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi) wherein the polyA tract is 12 to 60 nucleotides in length and comprises or consists of a contiguous sequence of at least 12 nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages. Embodiment 46. The RNA of any of embodiments 1 to 40, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (iv): start codon - ORF - stop codon - polyA tract (Formula iv) wherein the polyA tract comprises one or more non-canonical internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0690] Embodiment 47. The RNA of any of embodiments 1 to 40 and 46, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (iv): start codon - ORF - stop codon - polyA tract (Formula iv) wherein the polyA tract comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0691] Embodiment 48. The RNA of any of embodiments 1 to 40 and 46 to 47, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (iv): start codon - ORF - stop codon - polyA tract (Formula iv) wherein the polyA tract is 12 to 60 nucleotides in length and comprises or consists of a contiguous sequence of at least 12 nucleotides that have an alternating pattern of internucleoside linkages, preferably alternating phosphodiester and phosphorothioate internucleoside linkages; wherein all other internucleoside linkages in regions other than the polyA tract are phosphodiester internucleoside linkages.

[0692] Embodiment 49. The RNA of any of embodiments 41 to 48, wherein the polyA tract is 12 to 60 nucleotides in length, preferably 12 to 36 nucleotides in length, more preferably 18 to 36 nucleotides in length.

[0693] Embodiment 50. The RNA of any of embodiments 1 to 40 and 46 to 49, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (iv): start codon - ORF - stop codon - polyA tract (Formula iv) wherein the polyA tract is 12 to 60 nucleotides in length, optionally 12 to 36 nucleotides in length, preferably 18 to 36 nucleotides in length, more preferably 18 or 36 nucleotides in length.

[0694] Embodiment 51 . The RNA of any of embodiments 41 and 42, wherein all nucleotides within the 5’IITR have an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages.

[0695] Embodiment 52. The RNA of any of embodiments 43 to 48, wherein all nucleotides within the polyA tract have an alternating pattern of phosphodiester and phosphorothioate internucleoside linkages.

[0696] Embodiment 53. The RNA of any of embodiments 1 to 52, wherein the RNA is not longer than 200 nucleotides in length.

[0697] Embodiment 54. A composition comprising an RNA molecule according to any of embodiments 1 to 53.

[0698] Embodiment 55. A composition of RNA molecules comprising two or more discrete populations of RNA molecules according to any of embodiments 1 to 53, wherein the populations are distinguished at least by the identity of the polypeptide encoded by the ORF.

[0699] Embodiment 56. The composition of embodiment 55, wherein the discrete populations are further distinguished by:

[0700] (a) the length of the RNA molecule;

[0701] (b) the one or more upstream elements; and / or

[0702] (c) the one or more downstream elements.

[0703] Embodiment 57. The composition of embodiment 55 or embodiment 56, wherein there are 2 to 20 discrete populations, such as 5 to 15 discrete populations, or 8 to 12 discrete populations of RNA molecules.

[0704] Embodiment 58. The composition of any of embodiments 55 to 57, wherein each discrete population comprises an ORF encoding a different polypeptide from a single subject.

[0705] Embodiment 59. The composition of any of embodiments 55 to 58, wherein the discrete populations are present in equimolar or non-equimolar amounts. Embodiment 60. The composition of any of embodiments 54 to 59, wherein the composition further comprises one or more particle forming components, optionally wherein the particle forming components is any of:

[0706] (a) a cationic lipid;

[0707] (b) a cationically ionisable lipid; and / or

[0708] (c) a cationic polymer.

[0709] Embodiment 61. The composition of any of embodiments 54 to 60, wherein the composition is a lipid particle composition, optionally a lipoplex (LPX) or lipid nanoparticle (LNP) composition, and optionally wherein:

[0710] (a) each lipid particle in the composition comprises RNAs from two or more of the discrete populations of RNA molecules; or

[0711] (b) each lipid particle in the composition comprises RNA from only one discrete population of RNA molecules.

[0712] Embodiment 62. A pharmaceutical composition, the composition comprising the RNA of any of embodiments 1 to 53, or the composition of any of embodiments 54 to 61 , and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0713] Embodiment 63. An in vitro, in vivo, or ex vivo method of stimulating antigen-specific T cells, said method comprising the step of introducing the RNA of any of embodiments 1 to 53, the composition of any of embodiments 54 to 61 , or the pharmaceutical composition of embodiment 62 to one or more cells.

[0714] Embodiment 64. The method of embodiment 63, wherein the cell is capable of processing and presenting polypeptide epitopes to T cells and / or stimulating and / or activating T cells, preferably wherein the cell is a dendritic cell.

[0715] Embodiment 65. The RNA of any of embodiments 1 to 53, the composition of any of embodiments 54 to 61 , or the pharmaceutical composition of embodiment 62 for use in medicine.

[0716] Embodiment 66. The RNA of any of embodiments 1 to 53, the composition of any of embodiments 54 to 61 , or the pharmaceutical composition of embodiment 62 for use in the treatment or prevention of cancer, infectious diseases, and / or allergies. Embodiment 67. The RNA, composition, or pharmaceutical composition for use according to embodiment 66, wherein the cancer is a solid cancer and / or is characterised by the presence of one or more neo-epitopes and / or neo-antigens.

[0717] Embodiment 68. A method of manufacturing the RNA molecule of any of embodiments 1 to 53, said method comprising the step of: (a) chemical synthesis of said RNA molecule, optionally wherein the chemical synthesis is solid-phase phosphoramidite synthesis.

[0718] Embodiment 69. A method of manufacturing the composition of any of embodiments 54 to 61 , said method comprising the step of:

[0719] (a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules according to any of embodiments 1 to 53, optionally wherein the chemical synthesis is solid-phase phosphoramidite synthesis; optionally, wherein the method additionally comprises the step(s) of:

[0720] (b) storing each discrete population of RNA molecules separately until required; and, optionally

[0721] (c) mixing the populations of RNA molecules synthesized in part (a) to form a composition comprising a mixture of discrete RNA populations.

[0722] Embodiment 70. The method of embodiment 68 or embodiment 69, wherein, prior to step (a), the method comprises the step of identifying one or more cancer neo-antigens and / or neoepitopes present in a subject and using said cancer neo-antigens and / or neo-epitopes to design the ORF sequence(s) encoded by the RNA.

[0723] Embodiment 71. The method of embodiment 70, wherein one or more, preferably all, of the cancer neo-antigens and / or neo-epitopes is / are derived from a single subject.

[0724] Embodiment 72. The method of any of embodiments 69 to 71 , wherein the step of mixing is performed immediately prior to administration to a cell, a sample, or a subject.

[0725] Embodiment 73. An RNA or composition manufactured by the method of any of embodiments 68 to 72.

Claims

1. CLAIMS1. An RNA molecule, wherein the RNA molecule comprises an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, and wherein the RNA molecule is of formula (i):X - ORF - Y (Formula i) wherein either X or Y may be absent, and when present:X comprises one or more upstream elements selected from a:(a) 5’ cap;(b) 5’IITR; and / or(c) start codon; and / or;Y comprises one or more downstream elements selected from a:(d) stop codon;(e) 3’IITR; and / or(f) polynucleotide tract, optionally a polyA tract, wherein any one or more of (a) to (f), when present, comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage; and wherein:(i) the RNA molecule does not comprise one or more of the elements set out in (a) to (f); and / or(ii) the length of the RNA molecule is not more than 200 nucleotides.

2. The RNA molecule of claim 1 , wherein the ORF comprises only phosphodiester internucleoside linkages.

3. The RNA molecule of claim 1 or claim 2, wherein the RNA comprises a 5’IITR and / or a polynucleotide tract and wherein:(a) the polynucleotide tract; and / or(b) the 5’IITR; comprises the one or more internucleoside linkage that is not a phosphodiester internucleoside linkage.

4. The RNA molecule of any of the preceding claims, wherein the RNA comprises a 5’IITR and / or a polynucleotide tract and wherein:(a) only the polynucleotide tract;Page 95 of 103(b) only the 5’IITR; or(c) only the 5’IITR and the polynucleotide tract; comprise the one or more internucleoside linkage that is not a phosphodiester internucleoside linkage.

5. The RNA molecule of any of the preceding claims, wherein at least one, optionally all, of the internucleoside linkages that are not phosphodiester internucleoside linkages are phosphorothioate (PS) internucleoside linkages.

6. The RNA molecule of any of the preceding claims, wherein the RNA comprises one or more contiguous sequence of nucleotides that has an alternating pattern of internucleoside linkages.

7. The RNA molecule of any of the preceding claims, wherein the RNA comprises one or more contiguous sequence of at least 3 nucleotides in length that has an alternating pattern of internucleoside linkages comprising phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages.

8. The RNA molecule of any of the preceding claims, wherein the RNA comprises a polynucleotide tract, preferably a polyA tract, and wherein the polynucleotide tract has an alternating pattern of internucleoside linkages across its entire length.

9. The RNA molecule of any of the preceding claims, wherein the RNA comprises a 5’IITR and wherein the 5’IITR has an alternating pattern of internucleoside linkages across its entire length.

10. The RNA molecule of any of the preceding claims, wherein the polynucleotide tract is a polyA tract.11 . The RNA molecule of any of the preceding claims, wherein the RNA molecule is of formula (vi): 5’IITR - start codon - ORF - stop codon - polyA tract (Formula vi).

12. The RNA molecule of any of the preceding claims, wherein the RNA molecule comprises a polynucleotide tract which is a polyA tract, wherein the polyA tract:(a) is 18 to 36 nucleotides in length;(b) is about 18 nucleotides in length;Page 96 of 103(c) is about 36 nucleotides in length;(d) comprises one or more internucleoside linkage that is not a phosphodiester internucleoside linkage; and / or(e) comprises or consists of a contiguous sequence of nucleotides that have an alternating pattern of internucleoside linkages; optionally wherein:(f) the alternating pattern of internucleoside linkages consists of alternating phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages; and / or(g) all internucleoside linkages outside of the polyA tract are phosphodiester internucleoside linkages.

13. The RNA molecule of any of the preceding claims, wherein RNA molecule comprises a polyA tract, and wherein the one or more internucleoside linkage that is not a phosphodiester internucleoside linkage is present within the polyA tract only, preferably wherein the polyA tract has an alternating pattern of internucleoside linkages, preferably alternating phosphorothioate and phosphodiester internucleoside linkages, across its entire length.

14. The RNA molecule of any of the preceding claims, wherein the RNA comprises one or more contiguous sequence of at least 3 nucleotides, optionally between 5 and 10 nucleotides, in length that consists of internucleoside linkages that are not phosphodiester internucleoside linkages, optionally wherein said contiguous sequence is (i) at the 3’ end, (ii) at the 5’end, or (iii) at both the 5’ end and the 3’end, of the RNA molecule.

15. The RNA molecule of any of the preceding claims, wherein the RNA does not comprise:(a) a 5’cap;(b) a 3’IITR; or(c) both a 5’cap and a 3’IITR.

16. A composition comprising two or more discrete populations of RNA molecules, wherein the RNA molecules of each population comprise an open reading frame (ORF) encoding a polypeptide that is capable of being translated from the RNA molecule, wherein the RNA molecule is of formula (i):X - ORF - Y (Formula i) wherein X and / or Y may be absent or present, and if present:X comprises one or more upstream elements selected from a:(a) 5’cap;Page 97 of 103(b) 5’IITR; and / or(c) start codon; and / or;Y comprises one or more downstream elements selected from a:(d) stop codon;(e) 3’IITR; and / or(f) polynucleotide tract, optionally a polyA tract; wherein the populations of RNA molecules are distinguished at least by the identity of the polypeptide encoded by the ORF; and wherein:(i) at least one of the two or more discrete populations of RNA molecules does not comprise one or more of the elements set out in (a) to (f); and / or(ii) the length of any of the RNA molecule is not more than 200 nucleotides.

17. The composition of claim 16, wherein any one or more of the discrete populations of RNA molecules comprises or consists of RNA molecules according to any of claims 1 to 15.

18. The composition of claim 16 or claim 17, wherein there are 2 to 20 discrete populations, such as 5 to 15 discrete populations, or 8 to 12 discrete populations of RNA molecules.

19. The composition of any of claims 16 to 18, wherein the RNA molecules of each population do not comprise one or more of the elements selected from the group consisting of: 5’ cap, 5’IITR, start codon, stop codon, and / or 3’IITR, polynucleotide tract, optionally wherein the RNA does not comprise:(a) 2, 3, 4, 5, or 6 of the elements selected from the group consisting of: 5’ cap, 5’IITR, start codon, stop codon, 3’IITR, and / or polynucleotide tract;(b) a 5’cap;(c) a 3’IITR;(d) a stop codon;(e) both a 3’IITR and a stop codon;(f) both a 5’cap and a 3’IITR; and / or(g) all three of a 5’cap, stop codon, and 3’IITR.

20. The composition of any of claims 16 to 19, wherein the RNA molecules of each population are of formula:(a) start codon - ORF (formula ii);(b) 5’IITR - start codon - ORF (formula iii);Page 98 of 103(c) start codon - ORF - stop codon - polyA tract (formula iv);(d) 5’ cap - start codon - ORF (formula v);(e) 5’IITR - start codon - ORF - stop codon - polyA tract (formula vi);(f) 5’cap - 5’IITR - start codon - ORF (formula vii);(g) 5’cap - start codon - ORF - stop codon - polyA tract (formula viii); or(h) 5’cap - 5’IITR - start codon - ORF - stop codon - polyA tract (formula ix); optionally, wherein the RNA molecules of all populations have the same formula.

21. The composition of any of claims 16 to 20, or the RNA of any of claims 1 to 15, wherein the RNA molecules are synthetic RNA molecules that are synthesized independently of a DNA template, optionally wherein the RNA molecules are synthesized by solid-phase phosphoramidite synthesis.

22. The composition of any of claims 16 to 21 , or the RNA of any of claims 1 to 15, wherein the RNA molecule or the RNA molecules of each population:(a) are single-stranded RNAs;(b) are 27 to 187 nucleotides in length; and / or(c) have upstream and downstream elements that, if present, have a combined length of 3 to 106 nucleotides; optionally wherein the RNA molecules of each population defined in any of claims 16 to 21 each comprise an ORF encoding a different polypeptide from a single subject.

23. The composition of any of claims 16 to 22, or the RNA of any of claims 1 to 15, wherein the RNA molecule or the RNA molecules of each population comprise one or more non- canonical nucleotides, or one or more nucleotides arranged in a non-canonical configuration, optionally which is selected from the group consisting of: an inverted nucleotide, preferably inverted thymidine, 2'0-Methyl adenosine, pseudouridine, 1 -methylpseudouridine, and a monophosphate nucleotide.

24. The composition of any of claims 16 to 23, wherein the RNA molecule or the RNA molecules of each population comprise one or more internucleoside linkage that is not a phosphodiester internucleoside linkage, optionally which is a phosphorothioate internucleoside linkage.

25. The composition of claim 23 or claim 24, wherein (i) the one or more non-canonical nucleotides, and / or (ii) the one or more nucleotides arranged in a non-canonical configuration,Page 99 of 103and / or (iii) at least one of the nucleosides of the one or more internucleoside linkage that is not a phosphodiester internucleoside linkage, is / are present:(a) at the 5’ end of the RNA molecule;(b) at the 3’ end of the RNA molecule;(c) within the one or more upstream elements;(d) within the one or more downstream elements;(e) within the ORF; and / or(f) within the polynucleotide tract only.

26. The composition of any of claims 16 to 25, or the RNA of any of claims 1 to 15, wherein the polypeptide encoded by the ORF is:(a) 8 to 50 amino acids in length, preferably 8 to 27 amino acids in length;(b) capable of being processed in a cell to form a shorter polypeptide sequence than the sequence translated from the ORF;(c) a fragment of a naturally occurring polypeptide that is longer than the polypeptide encoded by the ORF;(d) comprises or consists of a contiguous amino acid sequence that is capable of forming a peptide-MHC complex (pMHC);(e) derived from a human or non-human polypeptide sequence;(f) a cancer antigen or cancer neo-antigen;(g) is derived from a pathogen or commensal organism, optionally a virus, bacterium, or fungi; and / or(h) an allergen; and / or(i) an auto-antigen27. The composition of any of claims 16 to 26, or the RNA of any of claims 1 to 15, wherein the:(a) 5’IITR is 5 to 50 nucleotides in length;(b) polynucleotide tract is a poly adenosine (polyA) tract that consists of 3 to 60 contiguous adenosine nucleotides; and / or(c) stop codon is a UAA stop codon.

28. The composition of any of claims 16 to 27, or a composition comprising the RNA molecule of any of claims 1 to 15, wherein the composition:(a) additionally comprises one or more particle forming components selected from the group consisting of a cationic lipid; a cationically ionisable lipid; and a cationic polymer; and / orPage 100 of 103(b) is a lipid particle composition, optionally a lipoplex (LPX) or lipid nanoparticle (LNP) composition, optionally wherein:(i) each lipid particle in the composition comprises RNAs from two or more of the discrete populations of RNA molecules; or(ii) each lipid particle in the composition comprises RNA from only one discrete population of RNA molecules.

29. A pharmaceutical composition, the pharmaceutical composition comprising the composition of any of claims 16 to 28, or the RNA of any of claims 1 to 15, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

30. The composition of any of claims 16 to 28, or the RNA of any of claims 1 to 15, or the pharmaceutical composition of claim 29 for use in the treatment or prevention of cancer, infectious diseases, autoimmune diseases and / or allergies, optionally wherein the cancer is a solid cancer and / or is characterised by the presence of one or more neo-antigens and / or neoepitopes.

31. A method of manufacturing the composition of any of claims 16 to 28, said method comprising the step of:(a) independent chemical synthesis of each of the two or more discrete populations of RNA molecules according to any of claims 16 to 27, optionally wherein the chemical synthesis is solid-phase phosphoramidite synthesis; optionally, wherein the method additionally comprises the step(s) of:(b) storing each discrete population of RNA molecules separately until required; and, optionally(c) mixing the populations of RNA molecules synthesized in part (a) to form a composition comprising a mixture of discrete RNA populations.

32. The method of claim 31 , wherein, prior to step (a), the method comprises the step of identifying one or more cancer antigens and / or epitopes present in a subject and using said cancer antigens and / or epitopes to design the ORF sequences encoded by the RNA, optionally wherein:(a) one or more, preferably all, of the cancer antigens and / or epitopes are derived from a single subject; and / or(b) the cancer antigens and / or epitopes are selected from cancer non-neo-epitopes, cancer neo-epitopes, or mixtures thereof.Page 101 of 10333. A method of manufacturing an RNA molecule of any of claims 1 to 15, or the composition of claim 28 comprising the RNA molecule of any of claims 1 to 15, said method comprising the step of: chemical synthesis of the RNA molecule, optionally wherein the chemical synthesis is solid-phase phosphoramidite synthesis.Page 102 of 103

Images