Method for constructing hog-cholera virus infectious cDNA carrier having molecule mark

A swine fever virus and molecular marker technology, applied in the biological field, can solve the problem that in-depth research on infectious cDNA is rarely reported.

Active Publication Date: 2012-03-14
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

my country's CSFV infectious cDNA technology started relatively late. Although the construction of infectious cDNAs of the attenuated C strain and the virulent Shimen strain has been reported, it may be due to the instability of the full-length cDNA that it is difficult to conduct in-depth studies on these infectious cDNAs. rarely reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing hog-cholera virus infectious cDNA carrier having molecule mark
  • Method for constructing hog-cholera virus infectious cDNA carrier having molecule mark
  • Method for constructing hog-cholera virus infectious cDNA carrier having molecule mark

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 covers the amplification of CSFV vaccine C strain full-length genome cDNA fragment

[0029] Table 1 is the primers required for amplifying the 6 cDNA fragments of the C strain genome:

[0030]

[0031]

[0032]According to the genome sequence of classical swine fever virus, primers with specific restriction sites were designed in the conserved region. Primer sequences are shown in Table 1. Each fragment was amplified by nested PCR. In the primer name, up means the upstream primer, low means the downstream primer, and new means the primer used for the first round of amplification. The underlined sequence in the primer is the restriction site for cloning the fragment. The sequence in bold in the F1-upper primer is the promoter recognized by the introduced T7 RNA polymerase, and the sequence in bold in the F5-upper primer is the introduced NcoI molecular marker. The sequence in bold in the F6-lower primer is the introduced XhoI restriction enzyme sit...

Embodiment 2

[0034] Introduction of corresponding molecular markers in embodiment 2 cDNA fragments F1 and F5

[0035] Apply Stratagene's site-directed mutagenesis kit, with primer F1-Xho-MU: GAAGCCCACCTCGA T ATGCTACGTGGACG and F1-Xho-ML: CGTCCACGTAGCAT A TCGAGGTGGGCTTC carried out a site-directed mutation (G→T) at position 221 of the F1 fragment, and this mutation knocked out the original XhoI restriction enzyme site in the genome. The NcoI molecular marker in the F5 fragment was directly introduced by PCR with the F5-upper primer.

Embodiment 3

[0036] Embodiment 3 Transformation of the required plasmid for full-length cDNA cloning

[0037] Using pBR322 as a template for transformation, the plasmid pB-CN for cloning the 3'-half length of CSFV genome was obtained. The specific steps are as follows: Apply primer pGEM-U:GGG AAGCTT GGATCCTATAGGGCGAATTGG and pGEM-L:CCG CCCGGG CAAGCTATTTAGGTGACAC amplified the 171bp fragment containing the multiple cloning site of plasmid pGEM-5ZF(+), and introduced restriction sites HindIII and AvaI respectively before and after the fragment. Since the fragment encoding kana resistance in the pBR322 plasmid also contains the corresponding two enzymes, the fragment can be excised by using these two enzymes, and the 171bp fragment is cloned at the corresponding position to obtain the medium-copy plasmid pB- CN. The low-copy plasmid pACYC-177 was used as a template for transformation to obtain the plasmid pA-CN for cloning the 5'-half-length and full-length genome of CSFV. The specific ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a virus antibody research and provides a method for constructing a hog-cholera virus infectious cDNA carrier having a molecule mark. The method comprises the following steps of: (1) diluting a hog-cholera live vaccine to 1 portion per milliliter as the experimental material, after extracting the head RNA, amplifying 6 corresponding cDNA fragments through RT-PCR section according to designed 6 pairs of primers, (2) leading in the corresponding molecule marks from F1 and F5 of cDNA fragments, (3) reforming plasmids required by overall length cDNA cloning, and (4) constructing the overall length cDNA carrier. A hog-cholera virus lapinized vaccine C stem infectious cDNA carrier pA-FL22 having a molecule mark can be acquired through the method of the invention. The permissive cells of RNA electro transferred hog-cholera virus acquired by the carrier can save the infectious progeny virus which can stably inherit the molecule mark led in the construction. By using the saving technique system of the infectious cDNA carrier and the progeny virus, the copy stem and the pathopoiesia reason of the virus can be deeply researched and the foundation for developing new marked vaccines can be settled.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the construction of an infectious cDNA vector of strain C of a rabbitized attenuated vaccine of classical swine fever virus and the rescue of the virus. Through the establishment of this technical system, the genome of vaccine C strain can be modified at the molecular level, so as to facilitate in-depth research on virus replication, pathogenic mechanism, and development of new marker vaccines. Background technique [0002] Classical swine fever virus (CSFV) is a member of the genus Pestivirus in the Flaviviridae family. The genome of CSFV is a single-stranded positive-strand RNA, about 12.3kb in length, containing a large open reading frame (ORF), with a non-coding region (UTR) on each side of the ORF, and no cap structure at the 5'-end, 3' - end without polyA tail. All structural and non-structural proteins of CSFV are encoded by this large ORF and translated into a polymeric precu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/65C12N15/40
Inventor方维焕陈宁李肖梁李得江袁雪梅童超扈鸿霞
OwnerZHEJIANG UNIV