Fusion protein of GLP-1 analogue and preparation method and application thereof

A GLP-1 and fusion protein technology, applied in animal/human protein, drug combination, albumin peptide, etc., can solve the problems of increased risk of antibodies, increased risk of immunogenicity, instability of Albugon, etc., and achieve good protease resistance Stability, easy industrial preparation, excellent internal and external stability effects

Active Publication Date: 2013-11-27
JIANGSU T MAB BIOPHARMA
View PDF5 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large increase in clinical dose will bring two problems: 1. Increase the potential risk of immunogenicity
Therefore, a significant increase in the dose of GLP-1 / HSA fusion protein preparations will inevitably lead to an increase in the risk of antibody production; 2. GLP-1 / HSA fusion protein preparations need to be prepared through extremely complex bioengineering techniques, and the cost per unit protein amount High, the substantial increase in dosage will make the price of the drug unaffordable for diabetic patients
[0005] Secondly, since most of the GLP-1 sequence is in a random coil conformation, it is extremely vulnerable to protease attack and degraded, so the additional second GLP-1 makes Albugon more vulnerable to protease attack and unstable
This instability reflects disadvantages in two aspects: 1. When performing recombinant expression of Albugon, whether it is a yeast expression system with low production cost or a mammalian cell expression system with high production cost, the GLP-1 / HSA fusion protein is susceptible to protease degradation, which not only leads to a decrease in expression, but also produces a lot of inhomogeneous enzymatic hydrolysis products, which makes the final product inhomogeneous; 2. After Albugon is injected into the body, it is also susceptible to protease degradation and fails when it circulates in the body
[0006] In addition, limited to the stability of the product, such products currently need to be stored and transported at low temperature, so it is extremely inconvenient for diabetics to travel

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of GLP-1 analogue and preparation method and application thereof
  • Fusion protein of GLP-1 analogue and preparation method and application thereof
  • Fusion protein of GLP-1 analogue and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0176] Embodiment 1 recombinant fusion protein expression plasmid construction

[0177] GLP-1 analogue nucleotide coding sequence (SEQ ID NO: 6):

[0178] CACGGCGAAGGGACCTTTACCAGTGATGTAAGTTTCTTATTTGGAAGAGCAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAA

[0179] 1. HSA fusion fragment at the 13' end (GLP-1 analogue) 2 Gene fragment:

[0180] The following oligonucleotide sequence (SEQ ID NO: 17) was artificially synthesized:

[0181] CACGGCGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGAGCAAGCTGCCAAGGAATTCATTGCTTGGC TGGTGAAACACGGCGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGAGCAAGCTGCCAAGGAATTCATTGCT TGGCTGGTGAAA GATGCACACAAGAGTGAGG

[0182] Among them, the underlined part is the (GLP-1 analogue) 2 gene sequence, and the rest is the N-terminal coding sequence of HSA.

[0183] 1.23' GLP-1 analog with HSA fusion fragment-(Gly 4 Ser) 3 Gene fragment

[0184] The following oligonucleotide sequence (SEQ ID NO: 18) was artificially synthesized:

[0185] CACGGCGAAGGGACCTTTACCAGTGATGTAAGTTCT...

Embodiment 2

[0291] Embodiment 2 Construction of fusion protein expression engineering bacteria

[0292] Separately select containing (GLP-1 analogue) 2 -HSA / pPIC9, GLP-1 analogs-(Gly 4 Ser) 3 -HSA / pPIC9, GLP-1 analogs-(Gly 4 Ser) 4 -HSA / pPIC9, GLP-1 analog-E1-HSA / pPIC9, GLP-1 analog-E2-HSA / pPIC9, GLP-1 analog-E3-HSA / pPIC9, GLP-1 analog-E4-HSA / pPIC9, GLP-1 analogue-E5-HSA / pPIC9, GLP-1 analogue-E6-HSA / pPIC9 bacterial clone of expression vector plasmid, extract each expression vector plasmid respectively, and then use SalI to linearize each plasmid respectively, pass Each linearized plasmid DNA was recovered by agarose gel electrophoresis, and finally each linearized plasmid was transformed into Pichia pastoris GS115 competent cells by electroporation. Immediately after the electric shock, add 1ml of 1M sorbitol solution to mix the cells, transfer them to a 1.5ml centrifuge tube, let stand at 30°C for 1.5 hours, and then spread the cell suspension on the RDB selective plate, one plat...

Embodiment 3

[0296] Preparation of embodiment 3 GLP-1 analog fusion protein

[0297] Referring to the Pichia expression manual (A Manual of Methods for Expression of Recombinant Proteins in Pichia pastoris. Invitrogen Corporation), the strains expressing each GLP-1 analog fusion protein obtained in Example 2 were inoculated in YPD medium at 30°C 220 ~280rpm shaking culture until the wet weight of the bacteria is about 50g / L, put it into the tank (Biostat C10, Sartorius) according to 10% inoculation amount, 30°C, pH5.0, 30% saturation dissolved oxygen culture for 20 hours, and then continuously add methanol to start induction , control 40% saturation of dissolved oxygen, reduce the temperature to 22° C. after 4 hours of induction, end the induction after 50 hours, and collect the fermentation supernatant by centrifugation at 10000 g for 15 minutes.

[0298] Purification adopts four-step chromatography of BLUE affinity, PHE hydrophobicity, DEAE ion exchange and gel exclusion. First, the f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a class of novel fusion protein of a GLP-1(glucagon like protein-1) analogue and a preparation method and application thereof. The fusion protein is composed of three ingredients: the GLP-1 analogue, connecting peptide and human serum albumin (HSA). The compound prepared by using the method has the advantages that the production cost is very low, the biological activity is higher, and the stability in vitro and vivo is better. The fusion protein can be used for treating diabetes, obesity and irritable bowel syndrome and other diseases which benefit from fasting plasma glucose reduction, stomach and / or bowel movement inhibition and stomach and / or bowel empty or food intake inhibition.

Description

technical field [0001] The present invention relates to a novel GLP-1 analog fusion protein and a method for preparing the fusion protein. The GLP-1 analog fusion protein is used for treating diabetes and various related diseases or disorders. Background technique [0002] Glucagon-like peptide-1 (GLP-1) and its analogs such as Exendin-4 are widely used to study the treatment of type 2 diabetes, because the GLP-1 polypeptide is digested by protease dipeptidyl peptidase Ⅳ (DPP- IV) is rapidly inactivated, and its half-life in plasma is very short, making it difficult to be widely used clinically; while Exendin-4 is insensitive to the enzymatic degradation of DPP-IV, its stability increases, but its molecular weight is low (4187.61 D), short half-life in vivo, so it must be injected twice a day, which hinders clinical use. Many efforts have been made to solve this technical problem, such as slow-release microspheres, PEG modification, fatty acid chain modification, albumin f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/81A61K38/26A61K47/48A61P3/10A61P3/04
CPCC07K14/605A61K38/00C07K2319/31A61P3/04A61P3/10C07K14/765C12P21/02
Inventor黄岩山杨志愉徐正学陆游黄文俊张伟吉鑫于东安裘霁宛
OwnerJIANGSU T MAB BIOPHARMA