Use method of novel CRISPR/Cas9 gene editing vector in cotton

Abstract

The invention relates to the technical field of genetic engineering, and discloses a use method of a novel CRISPR / Cas9 gene editing vector in cotton. The use method comprises the following steps of: obtaining a vector pK2GW7.0 containing a target sequence 35S promoter, and designing a Primer by using Primer5 software by taking the pK2GW7.0 vector as a template. According to the use method of the novel CRISPR / Cas9 gene editing vector in the cotton, a pRGEB32-GhU6.7-NPT II vector containing a cotton endogenous promoter pGhU6-7 is transformed, a Ubiquitin promoter for driving Cas9 protein expression in an original system is replaced with the 35S promoter, cotton endogenous Gh_A06G0606 and GhCLA are respectively selected as target genes to verify the application of the transformed new system in the cotton, a CRISPR / Cas9 gene editing system is introduced into a cotton genome by using agrobacterium-mediated genetic transformation, then Sanger sequencing and Hi-TOM sequencing are carried out on callus of the new vector, and mutation sites and editing efficiency of the new system in a heterologous tetraploid cotton genome are detected, so that the use method has good explorativity, innovativeness and research value.

Description

technical field

[0001] The invention relates to the technical field of genetic engineering, in particular to a method for using a novel CRISPR / Cas9 gene editing vector in cotton. Background technique

[0002] CRISPR / Cas9 technology is an RNA-guided genome editing technology, which can precisely knock out, knock in and replace genes, so as to realize the purpose of exploring gene functions and repairing disease-causing genes. This technology is easy to operate and low in price. , the ability to edit gene loci and strong expandability, etc., has developed rapidly in recent years and has become the third gene after Zinc Finger Nuclease (ZFN) and Transcription Activator-Like Effector Nuclease (TALEN). Large genome editing technology. The main components of the CRISPR / Cas9 system for gene editing include the DNA-cutting enzyme Cas9 and the guide RNA (sgRNA) synthesized from transactivating crRNA (tracrRNA) and CRISPR RNA (crRNA). Cas9 scans the target genome, first looking for 3...

Examples

Embodiment 1

[0024] Example 1: Obtaining the target sequence of the 35S promoter

[0025] The 35S promoter of the target sequence was obtained by PCR amplification using the pK2GW7.0 vector as a template. The primers for PCR amplification were:

[0026] 35S-F: 5'CGCGTGCATGCCTGCA TGAGACTTTTCAACAAAGGGTAA 3'

[0027] 35S-R: 5'GGTTTCTATCTCCTTCGGTCCTCTCCAAATGAAATGAACT 3'

[0028] The PCR reaction system is shown in Table 1:

[0029] Table 1 PCR reaction system for amplifying the 35S promoter sequence

[0030]

Embodiment 2

[0031] Example 2: Construction of Transformation Vector p7N-35S

[0032] Carry out double enzyme digestion of pRGEB32-GhU6.7-NPTⅡ, first add 2 μL of SbfI enzyme to digest at 37°C for 30 minutes, then add 2 μL of BstBI, digest at 65°C for 30 minutes, and use the uncut vector as a control to observe the digested strips by gel electrophoresis If the band is correct, then use the digestion product purification kit to purify the remaining digestion products. See Table 2 for the digestion system.

[0033] Table 2 Enzyme digestion system of pRGEB32-GhU6.7-NPTⅡ vector

[0034]

[0035]

[0036] The digested and purified pRGEB32-GhU6.7-NPTⅡ vector was connected with the 35S promoter fragment In-fusion, transformed into Escherichia coli competent Top10, the positive clones were picked for sequencing, and the vector with the correct sequence was named p7N-35S, In- The fusion reaction system is shown in Table 3.

[0037] Table 3 In-fusion connection reaction system

[0038]

Embodiment 3

[0039] Example 3: Construction of p7N-35S-sgRNA vector

[0040] 1. sgRNA design of Gh_A06G0606 and GhCLA genes

[0041] Using CRISPR-P2.0, according to the gene Gh_A06G0606 and its homologous gene Gh_D06G0687, find two targets in the common region of AD subgroups: sgRNA1 and sgRNA2, and according to the albinism gene Gh_A10G2292 and its homologous gene Gh_D10G1640, in the AD subgroup common Find two targets in the region: sgRNA3 and sgRNA4. The sequence of sgRNA is shown in Table 4.

[0042] Table 4 Sequence of sgRNA

[0043]

[0044] 2. Connection of sgRNA to p7N-35S vector

[0045] (1) The p7N-35S vector was single-digested with BsaI enzyme, 37°C, 5.5h, and the purified product (linear p7N-35S vector) was obtained for ligation with sgRNA.

[0046](2) The sequences of the targets inserted into the p7N-35S vector are tRNA+sgRNA1+gRNA+tRNA+sgRNA2+gRNA and tRNA+sgRNA3+gRNA+tRNA+sgRNA4+gRNA, obtained by overlapping PCR. The two fragments were respectively ligated to the Bs...

technical field

[0001] The invention relates to the technical field of genetic engineering, in particular to a method for using a novel CRISPR / Cas9 gene editing vector in cotton. Background technique

[0002] CRISPR / Cas9 technology is an RNA-guided genome editing technology, which can precisely knock out, knock in and replace genes, so as to realize the purpose of exploring gene functions and repairing disease-causing genes. This technology is easy to operate and low in price. , the ability to edit gene loci and strong expandability, etc., has developed rapidly in recent years and has become the third gene after Zinc Finger Nuclease (ZFN) and Transcription Activator-Like Effector Nuclease (TALEN). Large genome editing technology. The main components of the CRISPR / Cas9 system for gene editing include the DNA-cutting enzyme Cas9 and the guide RNA (sgRNA) synthesized from transactivating crRNA (tracrRNA) and CRISPR RNA (crRNA). Cas9 scans the target genome, first looking for 3...

Examples

Embodiment 1

[0024] Example 1: Obtaining the target sequence of the 35S promoter

[0025] The 35S promoter of the target sequence was obtained by PCR amplification using the pK2GW7.0 vector as a template. The primers for PCR amplification were:

[0026] 35S-F: 5'CGCGTGCATGCCTGCA TGAGACTTTTCAACAAAGGGTAA 3'

[0027] 35S-R: 5'GGTTTCTATCTCCTTCGGTCCTCTCCAAATGAAATGAACT 3'

[0028] The PCR reaction system is shown in Table 1:

[0029] Table 1 PCR reaction system for amplifying the 35S promoter sequence

[0030]

Embodiment 2

[0031] Example 2: Construction of Transformation Vector p7N-35S

[0032] Carry out double enzyme digestion of pRGEB32-GhU6.7-NPTⅡ, first add 2 μL of SbfI enzyme to digest at 37°C for 30 minutes, then add 2 μL of BstBI, digest at 65°C for 30 minutes, and use the uncut vector as a control to observe the digested strips by gel electrophoresis If the band is correct, then use the digestion product purification kit to purify the remaining digestion products. See Table 2 for the digestion system.

[0033] Table 2 Enzyme digestion system of pRGEB32-GhU6.7-NPTⅡ vector

[0034]

[0035]

[0036] The digested and purified pRGEB32-GhU6.7-NPTⅡ vector was connected with the 35S promoter fragment In-fusion, transformed into Escherichia coli competent Top10, the positive clones were picked for sequencing, and the vector with the correct sequence was named p7N-35S, In- The fusion reaction system is shown in Table 3.

[0037] Table 3 In-fusion connection reaction system

[0038]

Embodiment 3

[0039] Example 3: Construction of p7N-35S-sgRNA vector

[0040] 1. sgRNA design of Gh_A06G0606 and GhCLA genes

[0041] Using CRISPR-P2.0, according to the gene Gh_A06G0606 and its homologous gene Gh_D06G0687, find two targets in the common region of AD subgroups: sgRNA1 and sgRNA2, and according to the albinism gene Gh_A10G2292 and its homologous gene Gh_D10G1640, in the AD subgroup common Find two targets in the region: sgRNA3 and sgRNA4. The sequence of sgRNA is shown in Table 4.

[0042] Table 4 Sequence of sgRNA

[0043]

[0044] 2. Connection of sgRNA to p7N-35S vector

[0045] (1) The p7N-35S vector was single-digested with BsaI enzyme, 37°C, 5.5h, and the purified product (linear p7N-35S vector) was obtained for ligation with sgRNA.

[0046](2) The sequences of the targets inserted into the p7N-35S vector are tRNA+sgRNA1+gRNA+tRNA+sgRNA2+gRNA and tRNA+sgRNA3+gRNA+tRNA+sgRNA4+gRNA, obtained by overlapping PCR. The two fragments were respectively ligated to the Bs...

Images