Application of PI4K inhibitors in intracellular protein misfolding-related diseases and lysosomal storage diseases

Abstract

Provided is the use of a PI4KIIIα specific inhibitor in preventing or treating a disease associated with intracellular protein misfolding, and also provided is the use of a PI4KIIIα specific inhibitor in preventing or treating a lysosomal storage disease.

Description

Technical Field

[0001] The present invention relates to the use of PI4KIIIα specific inhibitors in preventing or treating diseases related to intracellular protein misfolding. At the same time, the present invention relates to the use of PI4KIIIα specific inhibitors in preventing or treating lysosomal storage diseases. Background Art

[0002] Lysosomes are intracellular organs with a sac-like structure and a single-layer membrane. They contain many hydrolases that can decompose various exogenous and endogenous macromolecules, including proteins, carbohydrates, lipids and other substances. Therefore, lysosomes can decompose biological macromolecules such as proteins, nucleic acids, and polysaccharides, and can also digest the local cytoplasm or organelles of the cell itself. Lysosomes are divided into primary lysosomes and secondary lysosomes.

[0003] The primary lysosome has a diameter of about 0.2-0.5um, a membrane thickness of 7.5nm, uniform contents, and no obvious particles. It is formed by secretion from the Golgi apparatus. The primary lysosome is formed in the form of budding on the cis (trans) surface of the Golgi apparatus. The formation process is as follows: ribosomes on the endoplasmic reticulum synthesize lysosomal proteins, enter the endoplasmic reticulum cavity for N-linked glycosylation modification, and the lysosomal enzyme protein first carries 3 glucose, 9 mannose and 2 N-acetylglucosamine, then cuts off three molecules of glucose and one molecule of mannose, and enters the trans (Cis) membrane sac of the Golgi apparatus; N-acetylglucosamine phosphotransferase recognizes the signal spot of the lysosomal hydrolase; transfers N-acetylglucosamine phosphate to 1-2 mannose residues; N-acetylglucosamine is cut off by N-acetylglucosidase in the intermediate membrane sac to form M6P ligand; binds to the receptor on the cis membrane sac; and is selectively packaged into primary lysosomes. Primary lysosomes contain a variety of hydrolases, but they are inactive. Enzyme activity only occurs when the lysosomes rupture or other substances enter. Its hydrolases include proteases, nucleases, lipases, phosphatases, sulfatases, and phospholipases. There are more than 60 known types of hydrolases. These enzymes are all acidic hydrolases, and the optimal pH value of the reaction is about 5. Although the lysosomal membrane is similar in thickness to the plasma membrane, its composition is different. The main differences are: (1) The membrane has a proton pump that pumps H+ into the lysosome, lowering its pH value; (2) The membrane protein is highly glycosylated, which may help prevent the degradation of its own membrane protein.

[0004] Secondary lysosomes are digestive vacuoles, which are lysosomes that are in the process of digestion or have completed digestion. They contain hydrolases and corresponding substrates and can be divided into phagolysosomes and autophagolysosomes. The former digests substances from exogenous sources, while the latter digests substances from various components of the cell itself.

[0005] According to the source of lysosomal substrates, secondary lysosomes are divided into:

[0006] (1) Heterolysosomes refer to macromolecular solutions or viruses, bacteria, etc. that cannot pass through the plasma membrane. The former are endocytic vacuoles (or endosomes) formed by pinocytosis (including receptor-mediated endocytosis), and the latter are phagocytic vacuoles formed by phagocytosis. They fuse with primary lysosomes (or endolysosomes) to form secondary lysosomes (or lysosomes).

[0007] (2) Autolysosome or autophagolysosome refers to a secondary lysosome formed by the fusion of an autophagosome that surrounds some damaged or aged organelles (mitochondria, endoplasmic reticulum fragments, etc.) and a primary lysosome (or endolysosome). The substances it digests are endogenous. Secondary lysosomes containing residual substances that cannot be digested are called residual bodies. Some residual substances can be excreted, while others are stored in the cell for a long time and are not excreted.

[0008] The remnants are also called post-lysosomes. They have lost their enzymatic activity and only leave undigested residues, hence the name. The remnants can be discharged from the cells through efflux, or they may remain in the cells and increase year by year, such as lipofuscin in liver cells.

[0009] Therefore, lysosomes are the common intersection of multiple cellular metabolic pathways such as autophagy, endocytosis, and the endoplasmic reticulum-Golgi (ER-Golgi) pathway. Autophagy or autophagy-lysosome-mediated signaling pathways are considered to be one of the main control systems for maintaining the balance of intracellular protein levels (homeostasis) (Manecka et al., 2017). The autophagy-lysosome signaling pathway is achieved by macroautophagy and chaperon-mediated autophagy (CMA). Macroautophagy mainly starts with the formation of autophagosomes, which fuse with lysosomes and introduce proteins into lysosomes for degradation (Bento et al., 2016). CMA is composed of chaperons (such as Hsc70) that bind to target proteins and transport proteins to lysosomes for degradation through the lysosomal receptor LAMP2A (Cuervo and Wong, 2014).

[0010] Due to genetic variation and other factors, the lack of hydrolases in the lysosomes, insufficient enzyme activity, lack of activating proteins, transport proteins or lysosomal protein processing and correction enzymes causes lysosomal functional defects, resulting in the inability to digest the corresponding substrates in the secondary lysosomes, substrate accumulation, metabolic disorders, and the formation of lysosomal storage disorders (LSDs). LSDs include more than 60 diseases including Gaucher's disease, Pompe disease and Niemann-Pick Type C disease (NPC). So far, the treatment of this type of disease mainly focuses on hindering the synthesis of lysosomal enzyme substrates or replacing lysosomal enzymes, but the effects of most of these programs are limited (Platt et al., 2018). Therefore, promoting autophagy and lysosomal secretion to remove substances accumulated in lysosomes from cells is a new treatment direction for LSDs (Samie and Xu, 2014).

[0011] In addition, in various protein inclusion body accumulation diseases (diseases caused by the accumulation of intracellular proteins in inclusion bodies due to misfolding), multiple autophagy-lysosomal regulators, such as mTOR (Kahan, 2011, Decreassac et al., 2013, Magahaes et al., 2016, Tian et al., 2016), Beclin-1 (Spencer et al., 2009), Spermidin

[14] (Buttner et al., 2014), PLK2 (Mbefo et al., 2010) and LAMP2 (Xilouri et al., 2013) expression and activity have different degrees of change. Proteins accumulated in these inclusions, such as α-synuclein associated with Parkinson's disease (PD) and Lewy body dementia (LBD), exist in the autophagy-lysosome pathway or are degraded by this pathway (Dehay et al., 2010. J. Neurosci, 30: 12535-12544). Therefore, promoting autophagy and lysosomal secretion can also promote the clearance of these proteins by cells, thereby reducing the accumulation of inclusion bodies.

[0012] Lysosomal contents contain many important enzymes, as well as cellular waste materials that need to be expelled from the cell. Microglial lysosomes can release their contents from the cell through exocytosis. Part of the lysosomal secretory function is achieved through lysosome exocytosis. Exocytosis is an energy-dependent activity in which vesicles fuse with the plasma membrane and then release their contents into the extracellular space. Lysosomes can release their contents by complete fusion with the plasma membrane or by "kiss-and-run" exocytosis. In "kiss-and-run" exocytosis, the fusion of the lysosomal vesicle with the plasma membrane is transient and involves the rapid opening and closing of the fusion pore to allow the release of the contents of the vesicle.

[0013] Regulation of lysosomal secretion (exocytosis) is expected to provide effective treatment for lysosomal storage diseases and cellular inclusion accumulation diseases including Parkinson's disease and Lewy body dementia.

[0014] In the brain tissue of patients with the cellular inclusion disease Multiple System Atrophy (MSA), the level of the autophagosome formation-related gene GABARAPs / GATE-16 was significantly reduced, indicating that the level of autophagosome protein in MSA patients is inhibited, resulting in the disruption of the maturation process of the autophagy system (Tanji et al., 2013).

[22] (Miki et al, 2016) showed that the degradation of α-synuclein binding proteins in MSA is regulated by the autophagy / beclin1regulator 1 (AMBRA1) protein that binds to it, and the hyperphosphorylation level of AMBRA1 in MSA neurons is significantly increased. In vitro experiments on mouse cortical cells showed that autophagy inhibitors can silence the activity of AMBRA1, thereby leading to α-synuclein aggregation.

[0015] Intracellular 15-18 nm tubulin and other protein deposits are very common in inclusion body myositis (IBM).

[0016] In some familial cases of frontotemporal lobar degeneration, mutations in the progranulin (PGRN) gene may be associated with the progranulin gene. Progranulin is a growth factor, and gene mutations may lead to a decrease in growth factors, hampering nerve growth and repair. Recently, it has been found that abnormal phosphorylation of TAR-DNA binding protein 43 (TDP-43, a nuclear protein that regulates transcription) is closely related to frontotemporal lobar degeneration with motor neuron disease.

[0017] Polyglutamine diseases (PolyQ diseases) include 9 diseases (Huntington Disease, HD; X-linked spinobulbar muscular atrophy (SBMA), dentatorubralpalludoluysian atrophy (DRPLA), and 6 spinocerebellar atrophies (SCA 1, 2, 3, 6, 7 & 17). Although the associated proteins of each disease are different, they are all related to the inactivation of autophagy mobility.

[26] (Cortes et al, 2015) The autophagosome marker protein P62 can alleviate the behavioral and motor function defects in the SBMA mouse model

[27] (Doi et al, 2013). The DRPLA fruit fly model presents a phenotype similar to lysosomal storage disease, with lipofuscin and P62 in the aggregates, indicating inactivation of lysosomal digestion caused by impaired autophagy

[28] (Settembre et al, 2008).

[0018] In Huntington's disease, mutations in the Htt gene lead to the translation and accumulation of abnormal polyglutamine (CAG-encoded) lengths.

[0019] 95% of ALS patients have TDP-43-dominant inclusions in their motor neurons. Other proteins such as FUS and SOD1 also frequently co-aggregate in ALS patients.

[0020] Prion disease is a disease caused by misfolded prion protein (PrP) (Cai et al, 2016). Normal PrP (PrP C ) is present on the cell membrane and can also be converted into an infectious form (PrP Sc ).

[0021] Phosphatidylinositol (PI) and its metabolic enzymes play an important role in lysosome formation and trafficking. PI4KIIIβ has been found to control the release of lysosomes and the sorting of lysosomal cargo. [38,39](Sridhar S, Patel B, Aphkhazava D, et al. The lipid kinase PI4KIIIβ preserves lysosomal identity [J]. The EMBO Journal, 2012, 32 (3): 324-339; De Barry J, Janoshazi, Dupont JL, et al. Functional Implication of Neuronal Calcium Sensor-1 and Phosphoinositol 4-Kinase-beta Interaction in Regulated Exocytosis of PC12 Cells [J]. Journal of Biological Chemistry, 2006, 281 (26): 18098-18111). Both PI4KIIIβ and PI4KIIα in the Golgi apparatus are involved in regulating or promoting the delivery of lysosomal enzymes and proteins to lysosomes. Histologically, PI4KIIα gene-deficient mice show lipofuscin deposits, indicating that downregulation of PI4KIIα inhibits endolysosomal transport, leading to a decrease in Purkinje cells and axonal defects in the spinal cord. Inhibition of PI4KIIIβ and PI4KIIα leads to accumulation of lysosomal proteins and Gaucher disease (a lysosomal storage disease) (Jovic M, Kean MJ, Szentpetery Z, et al. Two phosphatidylinositol 4-kinases control lysosomal delivery of the Gaucher disease enzyme-glucocerebrosidase [J]. Molecular Biology of the Cell, 2012, 23 (8): 1533-1545). However, the role of PI4KIIIα in lysosomal transport has not been reported.

[0022] PI4KIIIα forms a protein complex with the scaffolding protein TTC7A or TTC7B and the cell membrane-localized Efr3a or Efr3b, as well as the cytoplasmic protein FAM126A or FAM126B, or their homologous proteins on the cell membrane, directly regulating the level of phosphatidylinositol-4-phosphate (PI4P) on the cell membrane, and the expression or cell membrane localization of PI4KIIIα depends on Efr3a / Efr3b, TTC7A / TTC7B and FAM126A / FAM126B (Baird D, Stefan C, et al., J Cell Biol, 2008, 183:1061-1074; Nakatsu F, Baskin JM, et al., J Cell Biol, 2012, 199:1003-1016; Baskin JM, Wu X et al., Nat Cell Biol, 2016, 18: 132-138; Zhang Summary of the invention

[0023] In one aspect, the present invention provides use of a PI4KIIIα-specific inhibitor in the preparation of a compound for preventing or treating a disease associated with intracellular protein misfolding.

[0024] In another aspect, the present invention provides use of a PI4KIIIα-specific inhibitor in the preparation of a method for preventing or treating lysosomal storage diseases.

[0025] In some embodiments, the PI4KIIIα-specific inhibitor is an antibody, a small molecule compound, an RNAi molecule, or an antisense nucleic acid.

[0026] In some embodiments, the antibody is a monoclonal antibody or a polyclonal antibody.

[0027] In some embodiments, the antibody is a chimeric antibody, a humanized antibody, or a fully human antibody.

[0028] In some embodiments, the RNAi molecule is a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or a micro RNA (miRNA).

[0029] In some embodiments, the RNAi molecule is 18-100 bases in length.

[0030] In some embodiments, the RNAi molecule is modified to enhance its stability.

[0031] In some embodiments, the PI4KIIIα-specific inhibitor is a small molecule compound.

[0032] In some embodiments, the small molecule compound is phenylarsinoxide or its derivatives, G1 and its analogs, A1 and its analogs.

[0033] In some embodiments, the phenylarsenic oxide and its derivatives have a structure shown in formula (I) or a pharmaceutically acceptable salt thereof,

[0034]

[0035] wherein R1 is independently selected from (a) H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C 1-6 Alkylsulfone, C 1-6 Alkyl, C 1-6 Cycloalkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Alkylene -NH2, C 1-6 Alkylene-NH-C(O)H, -As(O), -N=NH, N-(C 1-6 alkyl)amino, N,N-(C 1-6 alkyl)2amino, -NH-C(O)H, -NH-S(O)2H, -C(O)OH, -OC(O)H, -SH, -S(O)2H, -S(O)2-NH2 or heterocyclic, and optionally substituted by R2 or R3, wherein R2 and R3 are each independently selected from amino, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, N-(C 1-6 alkyl)amino, N-(6-12 membered aromatic)amino, N,N-(C 1-6 Alkyl)2amino, C 3-6 Cycloalkyl, 6-12 membered aromatic or 3-12 membered heterocyclic, and optionally substituted by one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, -NH-C(O)-R5, -C(O)OR4, 6-12 membered aromatic, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, 3-6 membered heterocyclic group, C 3-6cycloalkyl or Bn-O-substituted, and R4 is C 1-6 and optionally substituted by one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aromatic, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, 3-6 membered heterocyclic group, C 3-6 Cycloalkyl or Bn-O-substituted, R5 is selected from H, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy or C 1-6 haloalkyl, and / or

[0036] (b) R1 on two adjacent carbon atoms forms a 5-12 membered cycloalkyl, aromatic or heterocyclic group, and is optionally substituted by one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aromatic, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, 3-6 membered heterocyclic group, C 3-6 Cycloalkyl or Bn-O-substituted,

[0037] Here, n is an integer from 0 to 5.

[0038] In some embodiments, n is an integer of 0-2, and each of the R1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C 1-6 Alkylsulfone, C 1-6 Alkyl, C 1-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, -As(O), N-(C 1-6 alkyl)amino, N,N-(C 1-6 alkyl)2amino, -NH-C(O)H or -NH-S(O)2H, and is optionally substituted by said R2 or R3.

[0039] In some embodiments, n is an integer of 0-2, and each of the R1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, C 1-6 Alkylsulfone, C 1-6 Alkyl, C 1-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6haloalkyl, -As(O), -NH-C(O)H or -NH-S(O)2H, and optionally substituted by said R2 or R3.

[0040] In some embodiments, n is 1 or 2, and each of the R1 is independently selected from H, halogen, amino, C 1-6 Alkylsulfone, C 1-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6 haloalkyl, -NH-C(O)R2 or -NH-S(O)2R3, wherein R2 is C 1-6 Alkyl, optionally substituted by a 6-12 membered aromatic group, R3 is a 6-12 membered aromatic group, optionally substituted by a halogen, C 1-6 Alkoxy or C 1-6 Haloalkyl substitution.

[0041] In some embodiments, the R1 is located at the ortho and / or para position to the -As(O) group.

[0042] In some embodiments, n is 0.

[0043] In some embodiments, the small molecule compound is selected from the group consisting of:

[0044]

[0045]

[0046]

[0047]

[0048] In some embodiments, the subject is a human or a mammal.

[0049] In some embodiments, the intracellular protein misfolding-related disease is Parkinson's disease, Lewy body dementia, multiple system atrophy, inclusion body myofasciitis, frontotemporal dementia, Huntington's disease, polyglutamine disease, amyotrophic lateral sclerosis, or prion disease.

[0050] In some embodiments, the lysosomal storage disease is a sphingolipid metabolism disorder, a mucopolysaccharidosis, a glycogen storage disease, a glycoprotein storage disease, a lipid storage disease, a post-translational modification defect, an intrinsic membrane protein deficiency disorder, a neuronal ceroid lipofuscinosis, or a lysosome-related organelle disorder.

[0051] In some embodiments, the sphingolipid metabolism disorder is Gaucher disease.

[0052] In some embodiments, it further comprises administering a second agent to a subject in need thereof.

[0053] In some embodiments, the second agent is an agent for treating a disease associated with intracellular protein misfolding or an agent for treating a lysosomal storage disease.

[0054] In some embodiments, the PI4KIIIα-specific inhibitor is administered before, after, or simultaneously with the second agent.

[0055] In another aspect, the present invention provides a method for screening drugs for preventing or treating diseases related to intracellular protein misfolding, comprising contacting a candidate drug with PI4KIIIα protein or nucleic acid or PI4KIIIα, and detecting whether the candidate drug can inhibit the formation or activity of PI4KIIIα.

[0056] In another aspect, the present invention provides a method for screening drugs for preventing or treating lysosomal storage diseases, comprising contacting a candidate drug with PI4KIIIα protein or nucleic acid or PI4KIIIα, and detecting whether the candidate drug can inhibit the formation or activity of PI4KIIIα.

[0057] The present invention found that, contrary to the results of PI4KIIα or PI4KIIIβ gene deletion, inhibition of PI4KIIIα promotes lysosomal secretion and reduces the accumulation or storage of various molecules in cells and lysosomes. PI4KIIIα inhibitors such as small molecule compounds PAO and the like can cross the blood-brain barrier, inhibit PI4KIIIα activity, promote lysosomal secretion, reduce the accumulation or storage of various molecules in cells and lysosomes, and make up for the defects of existing therapies. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Inhibition of PI4KIIIα induces microglial lysosomal exocytosis. (A) Control group, incubated with loading solution, 27 points were randomly selected, and the scale bar in the figure is 22μm; (B) 100nM PAO treatment group, 21 points were randomly selected, and the scale bar in the figure is 22μm; (C) PI4KIIIα heterozygous knockout group, 22 fluorescent points were randomly selected, and the scale bar in the figure is 16μm.

[0059] Figure 2It shows that bromophenol blue (BPB) enters the lysosomes of microglia due to "kiss-and-run" exocytosis, which weakens the fluorescence of lysosomes. The image parts are fluorescence images at 0 and 500 seconds, and the line graph is the change of lysosomal fluorescence intensity. (A) Control group, WT cells were incubated with BPB solution at 0 seconds, 20 points were randomly selected, and the scale bar was 16μm; (B) PAO treatment group, WT cells were incubated with BPB and PAO solution at 0 seconds, 22 points were randomly selected, and the scale bar was 22μm; (C) PI4KIIIα heterozygous knockout cell group, incubated with BPB solution at 0 seconds, 22 points were randomly selected, and the scale bar was 22μm.

[0060] Figure 3 It shows that the fluorescence of microglial lysosomes recovered / increased after BPB left the lysosomes. The picture parts are fluorescence images at 0, 200, and 500 seconds, and the line graph is the change graph of lysosomal fluorescence intensity. BPB solution was added 60 minutes before medication. (A) Control group, WT cells were incubated with loading solution at 0 seconds, and 22 points were randomly selected; (B) PAO treatment group, WT cells were incubated with PAO solution at 0 seconds, and 28 points were randomly selected; (C) PI4KIIIα heterozygous knockout cell group, BPB solution was incubated at 0 seconds, and 26 points were randomly selected. The scale bars in the figures are all 22μm.

[0061] Figure 4 The results show that inhibition of PI4KIIIα enzyme activity promotes the extracellular secretion of ATP from microglial lysosomes. (A) ATP co-localizes with lysosomes. Figure 1 μM Quinacrine-labeled ATP molecules in WT microglia, Lysosomes labeled with LysoTracker in the middle, and co-localized fluorescence images after merging channels in the right. The scale bar in the figure is 16μm. (B) Extracellular ATP concentration in WT cells and PI4K+ / - cells treated with 100nM PAO.

[0062] Figure 5 The results show that PI4KIIIα-induced lysosomal exocytosis of neurons was inhibited. Fluorescence images of lysosomes in hippocampal neurons were taken at 0 and 500 seconds. (A) Control group; (B) 100 nM PAO treatment group. The scale bars in the figures are 16 μm.

[0063] Figure 6 PAO inhibits cell death or apoptosis caused by α-synuclein overexpression. PAO was treated for 12 hours, MTT was added for 4 hours, and the absorbance value was detected. (A) The picture shows the cell survival; (B) Cell survival rate.

[0064] Figure 7 It was shown that PAO and PI-07 promoted α-synuclein secretion.

[0065] Figure 8 It shows that PAO down-regulates the intracellular α-synuclein protein level. (A) ELISA was used to detect the intracellular α-synuclein protein level. n=6, One-way ANOVA, **p<0.001 vs. α-syn-OE. (B) Western blot was used to detect the intracellular α-synuclein protein level.

[0066] Fig. 9 It shows that PAO promotes the secretion of HTT protein and SOD1 protein. (A) ELISA detection of HTT protein secretion; (B) ELISA detection of SOD1 protein detection.

[0067] Fig.10 PAO reduces CBE-induced SH-SY5Y cell injury. MTT assay to detect cell survival. (A) SH-SY5Y cells were treated with different concentrations of CBE; (B) After 100 μM CBE treatment, different concentrations of PAO were given for 24 hours. n=5, One-way ANOVA, **p<0.001, ***p<0.0001, vs. α-syn-OE.

[0068] Fig.11 PAO alleviates CBE-induced lysosomal aggregation and intracellular accumulation of glucosylceramide (GlcCer). (A) SH-SY5Y cells were incubated with lysosome tracker for 30 minutes, and then the supernatant was removed and replaced with PAO containing different concentrations and incubated for 10 minutes. Lyso-tracker was observed by immunofluorescence method; (B) Statistical analysis of Lyso-tracker fluorescence intensity in each group; Scale bar: 50μm; n=5; One-way ANOVA analysis, compared with the control group ##p<0.001, compared with the 100μM CBE treatment group **p<0.001, ***p<0.0001; (C) Statistical analysis of GlcCer concentration in cell lysate of each group measured by LC / MS.

[0069] Fig.12 It shows that PI4KIIIa inhibitors A1 and G1 alleviate CBE-induced lysosomal aggregation. SH-SY5Y was treated with 100 μM CBE for 72 hours, and then lysosomes were labeled with Lysosome tracker (Lyso-tracker), and 50 nM or 75 nM A1 or G1 was given 30 minutes later for 5 minutes to 10 minutes, and then fixed with 4% paraformaldehyde (PFA) for observation. Scalebar: 50 μm.

[0070] Fig.13 Knockdown of PI4Ka was shown to promote lysosomal exocytosis or reduce lysosomal storage. Fig.13 A shows the knockdown Western blot detection of PI4KⅢα protein level in SH-SY5Y cells treated with different shRNA interference lentiviral vectors (sh-ctrl, sh1-PI4Ka, sh2-PI4Ka, sh3-PI4Ka) for 48 hours; Fig.13 B. Statistical analysis of Western blot results; Fig.13 C shows the immunofluorescence method to detect the Lyso-tracker fluorescence intensity after shRNA interference lentiviral vector treatment, and statistical analysis ( Fig.13 D). Scale bar: 50 μm; n=5; data are expressed as mean±SEM, analyzed by One-way ANOVA, ***p<0.0001.

[0071] Fig.14 PAO promoted LC3B and p62 expression, and Baf-A1 blocked the protective effect of PAO in cell models, where Fig.14 A shows the detection of LC3B and p62 proteins by western blot; Fig.14 B, C show the statistical analysis of LC3B and p62 protein signal intensity using Image J software; Fig.14 D shows immunofluorescence detection of LC3B and p62, red: p62, green: LC3B, scale bar: 50 μm; Fig.14 E shows the MTT assay for cell viability in each group and statistical analysis. n = 5, data are presented as mean ± SEM, One-way ANOVA analysis, ###p<0.0001 compared with the control group, **p<0.001 compared with the 100 μM CBE treatment group.

[0072] Fig.15 Knockdown of PI4Ka activated the autophagy pathway in CBE-treated and non-CBE-treated cells. PAO promoted the expression of LC3B and p62, and Baf-A1 blocked the protective effect of PAO in the cell model. (A) Western blotting assay to detect LC3B and p62 proteins; (B, C) Statistical analysis of LC3B and p62 protein signal intensity using Image J software; (D) Immunofluorescence detection of LC3B and p62, red: p62, green: LC3B, scale: 50μm; (E) MTT assay of cell viability in each group and statistical analysis. n=5, data are expressed as mean±SEM, One-way ANOVA analysis, ###p<0.0001 compared with the control group, **p<0.001 compared with the 100μM CBE-treated group.

[0073] Fig.16PAO is shown to inhibit cholesterol accumulation caused by U18666A. Scale bar: 50 μm. DETAILED DESCRIPTION

[0074] The present invention will be described in detail below based on the embodiments and in conjunction with the accompanying drawings. The above aspects of the present invention and other aspects of the present invention will be apparent from the detailed description below. The scope of the present invention is not limited to the following embodiments.

[0075] PI4KIIIα-specific inhibitors

[0076] The term "PI4KIIIα specific inhibitor" used herein refers to various substances that can specifically reduce, decrease, or eliminate the transcription or translation of the PI4KIIIα gene, and / or the activity of the PI4KIIIα protein. In some embodiments, the PI4KIIIα specific inhibitor can reduce the activity of PI4KIIIα by at least 5%, 10%, 20%, 40%, 50%, 80%, 90%, 95% or more. In this article, when "activity" is used together with increase or decrease, it refers to the detected functional activity, which can be manifested as a change in content, or the content remains unchanged but the functional activity changes.

[0077] Herein, the activity of PI4KIIIα refers to the activity of PI4KIIIα protein in phosphorylating phosphoinositide (PI) at a specific position (e.g., converted into 4-phosphoinositide (PI4P)). The binding constant of the PI4KIIIα specific inhibitor to the PI4KIIIα protein is at least 2 times greater than the binding constant with other non-specific binding proteins. In some embodiments, the PI4KIIIα specific inhibitor is able to preferentially recognize the PI4KIIIα protein in a complex mixture, including a mixture with other PI4K subtype proteins.

[0078] In some embodiments, the PI4KIIIα specific inhibitor inhibits PI4KIII at least 1-fold, 2-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, 500-fold, or 10,000-fold more strongly than other subtypes of PI4K proteins (e.g., PI4K proteins, including PI4KIIα or PI4KIIβ). For example, in some embodiments, the PI4KIIIα specific inhibitor does not substantially inhibit PI4KII (e.g., PI4KIIα or PI4KIIβ), for example, its IC 50 Greater than or equal to 10 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 80 μM, 100 μM, 150 μM, 200 μM or 500 μM.

[0079] In some embodiments, the PI4KIIIα-specific inhibitor inhibits PI4KIIIα at least 1-fold, 2-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, 500-fold, or 10,000-fold more potently than other isoforms of PI4KIII (e.g., PI4KIIIβ).

[0080] In some embodiments, the IC of a PI4KIIIα-specific inhibitor to PI4KIIIα is 50 Less than or equal to 100 μM, 80 μM, 50 μM, 30 μM, 20 μM, 10 μM, 5 μM, 3 μM, 2 μM, 1 μM, 0.5 μM, 0.2 μM, 0.1 μM, 0.05 μM, 0.02 μM, 0.01 μM, 0.005 μM, 0.002 μM or 0.001 μM. In some embodiments, the PI4KIIIα specific inhibitor is an antibody, a small molecule compound, an RNAi molecule or an antisense nucleic acid.

[0081] In some embodiments, the PI4KIIIα-specific inhibitor is an antibody.

[0082] The term "antibody" as used herein includes any immunoglobulin, monoclonal antibody, polyclonal antibody, multivalent antibody, bivalent antibody, monovalent antibody or antibody that can bind to a specific antigen. The term "antibody" herein is intended to broadly cover conventional four-chain antibodies as well as less conventional antibodies that do not have four chains (e.g., antibodies that naturally lack light chains).

[0083] A conventional complete antibody is a heterotetramer, which contains two heavy (H) chains and two light (L) chains. The heavy chains of mammals can be divided into α, δ, ε, γ and μ, each of which consists of a variable region (VH) and the first, second and third constant regions (CH1, CH2, CH3 respectively); the light chains of mammals can be divided into λ or κ, each of which consists of a variable region (VL) and a constant region. Conventional antibodies are "Y"-shaped, and the neck of the "Y"-shaped structure is composed of the second and third constant regions of the two heavy chains, which are bound by disulfide bonds. Each arm of the "Y"-shaped structure contains the variable region and the first constant region of one of the heavy chains, which is combined with the variable region and constant region of one light chain. The variable regions of the light and heavy chains determine the binding of antigens. The variable region of each chain contains three hypervariable regions, called complementarity determining regions (CDRs) (the CDRs of the light chain contain LCDR1, LCDR2, LCDR3, and the CDRs of the heavy chain contain HCDR1, HCDR2, HCDR3). The three CDRs are separated by flanking continuous sections called framework regions (FRs), which are more highly conserved than the CDRs and form a scaffold supporting the hypervariable loops. The constant regions of the heavy and light chains are not involved in antigen binding but have a variety of effector functions.

[0084] In some embodiments of the invention, the antibody is a full-length antibody or an antigen-binding fragment.

[0085] The term "antigen binding fragment" as used herein refers to an antibody fragment formed by an antibody fragment containing one or more CDRs but not having a complete antibody structure. Examples of antigen binding fragments include, but are not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, single-chain antibody molecules (scFv), scFv dimers, camelized single domain antibodies, and nanobodies. Antigen binding fragments can bind to the same antigen as the parent antibody.

[0086] The "Fab" fragment of an antibody refers to that portion of the antibody which is composed of a light chain (including the variable region and the constant region) and the variable region and the first constant region of a heavy chain bound together by a disulfide bond.

[0087] The "Fab'" fragment refers to the Fab fragment including part of the hinge region.

[0088] "F(ab')2" fragment refers to a dimer of Fab'.

[0089] The "Fv" fragment of an antibody consists of the variable region of one light chain and the variable region of one heavy chain.

[0090] "Single-chain antibody molecule" or "scFv" refers to an engineered antibody in which the light chain variable region is directly connected to the heavy chain variable region or connected through a peptide chain. For detailed description, see, for example, Huston JS et al., Proc Natl Acad Sci USA, 85:5879 (1988).

[0091] "ScFv dimer" refers to an aggregate formed by two scFvs.

[0092] "Camelized single-domain antibody" (also called "heavy-chain antibody" or "HCAb (Heavy-chain-only antibodies, HCAb)") refers to an antibody that contains two heavy chain variable regions but no light chain. Heavy chain antibodies were originally derived from camelids (camels, dromedaries and llamas). Although the light chain is missing, camelized antibodies have all the functions of antigen binding.

[0093] "Nanobodies" are composed of a heavy chain variable region and two constant regions CH2 and CH3 from a heavy chain antibody.

[0094] In some embodiments, the antibody is a monoclonal antibody or a polyclonal antibody.

[0095] In some embodiments, the antibody is a murine antibody, a rabbit antibody, a chimeric antibody, a humanized antibody, or a fully human antibody.

[0096] As used herein, the term "fully human" when applied to an antibody or antigen-binding fragment means that the amino acid sequence of the antibody or antigen-binding fragment corresponds to the amino acid sequence of an antibody produced by a human or human immune cell, or derived from a non-human source such as a transgenic non-human animal utilizing a human antibody library, or other sequences encoding a human antibody.

[0097] The term "humanization" as used herein, when used for antibodies or antigen-binding fragments, refers to antibodies or antigen-binding fragments comprising CDRs derived from non-human animals, FR regions derived from humans, and constant regions (when applicable) derived from humans. Because humanized antibodies or antigen-binding fragments have lower immunogenicity, they can be used as therapeutic agents for people in certain embodiments. In certain embodiments, the non-human animal is a mammal (e.g., mouse, rat, rabbit, goat, sheep, guinea pig, or hamster). In certain embodiments, the humanized antibody or antigen-binding fragment, except that the CDR sequence is non-human, is substantially entirely composed of human sequences.

[0098] The term "chimeric" as used herein, when used for antibodies or antigen-binding fragments, refers to an antibody or antigen-binding fragment having a portion of a heavy chain and / or a light chain derived from one species, while the remainder of the heavy chain and / or the light chain is derived from a different species. In some embodiments, a chimeric antibody may include a constant region derived from a human and a variable region derived from a non-human animal (e.g., a mouse or a rabbit).

[0099] In some embodiments, the antibodies described herein are monospecific antibodies, bispecific antibodies, or multispecific antibodies.

[0100] In some embodiments, the antibodies described herein can be further labeled.

[0101] In some embodiments, the PI4KIIIα-specific inhibitor is an RNAi molecule.

[0102] The term "RNAi molecule" as used herein refers to RNA or its analogs that have sufficient sequence complementarity with a target RNA to guide RNA interference. In some embodiments, DNA that can be used to generate RNA is also included. RNA interference (RNAi) refers to a sequence-specific or selective process by which a target molecule (e.g., a target gene, protein, or RNA) is downregulated.

[0103] In some embodiments, the RNAi molecule is capable of reducing the expression of PI4KIIIα, for example, knocking down the PI4KA gene.

[0104] In some embodiments, the RNAi molecule has [5'-GCTGATCTCTACTACACTTCC-3'] (SEQ ID NO: 1).

[0105] In some embodiments, the RNAi molecule has [5'-GGTTATCACCGGAAATCAATA-3'] (SEQ ID NO: 2).

[0106] In some embodiments, the RNAi molecule has [5'-GCAACATTATGCTGGACAAGA-3'] (SEQ ID NO: 3).

[0107] In some embodiments, the RNAi molecule is 18-100 bases in length.

[0108] In some embodiments, the RNAi molecule is modified to enhance its stability.

[0109] In some embodiments, the RNAi molecule is a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or a micro RNA (miRNA).

[0110] The term "small interfering RNA (siRNA)" as used herein refers to an RNA molecule, preferably a double-stranded molecule, having a length of about 10 to 50 nucleotides, preferably a length of about 15 to 25 nucleotides, more preferably a length of about 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides, the strand optionally having an overhanging end comprising, for example, 1, 2 or 3 overhanging nucleotides (or nucleotide analogs), which is capable of directing or mediating the degradation of the RNA.

[0111] The term "short hairpin RNA (shRNA)" as used herein refers to an RNA molecule having a stem-loop structure, which includes a first region and a second region of complementary sequence, the degree of complementarity and the orientation of the regions are sufficient to allow base pairs to appear between the regions, the first region and the second region are connected by the loop region, and the loop is generated by the lack of base pairing between nucleotides (or nucleotide analogs) in the loop region.

[0112] The term "microRNA (microRNA or miRNA)" as used herein is a short, naturally occurring non-coding single-stranded RNA molecule with a length of about 16-26 nucleotides (nt) (e.g., about 16-29nt, 19-22nt, 20-25nt, or 21-23nt), which is usually involved in regulating gene expression in vivo. In eukaryotic cells, miRNA genes are transcribed into "primary products" (pri-miRNA) by DNA transcriptase II, and pri-miRNA is quickly processed into miRNA "precursors" (pre-miRNA) by a ribonuclease III (Drosha), and pre-miRNA is transported from the nucleus to the cytoplasm, and then recognized and sheared into mature miRNA by another ribonuclease III (Dicer). Mature miRNA molecules are complementary to one or more mRNA parts and regulate protein expression. The sequences of known miRNAs can be obtained through public databases, such as the miRBase database (www.mirbase.org), which provides information including miRNA sequence information, functional annotations, and predicted gene targets. In the present invention, miRNA also includes RNA molecules expressed in cells by artificially synthesized plasmids and having structures and functions similar to natural miRNAs, which can target corresponding mRNAs like natural miRNAs and hinder their translation into proteins.

[0113] In some embodiments, the PI4KIIIα-specific inhibitor is an antisense nucleic acid.

[0114] The term "antisense nucleic acid" as used herein includes nucleotides that are completely complementary to the target sequence and those with one or more nucleotide mismatches, as long as the antisense nucleic acid can specifically hybridize with the target sequence. For example, the antisense nucleic acid herein includes polynucleotides having at least 70% or more, preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more homology over a length of at least 15 consecutive nucleotides. Due to the formation of the hybrid, the transcription of the target gene and / or the translation of the target mRNA is reduced or blocked. .

[0115] In some embodiments, the PI4KIIIα inhibitor is a small molecule compound.

[0116] As used herein, the term "small molecule compound" refers to an organic compound having a molecular weight of less than 3000, 2500, 2000, 1500, 1000 or 500 Daltons, which may be natural or chemically synthesized.

[0117] In some embodiments, the phenylarsenic oxide and its derivatives have a structure shown in formula (I) or a pharmaceutically acceptable salt thereof,

[0118]

[0119] wherein R1 is independently selected from (a) H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C 1-6 Alkylsulfone, C 1-6 Alkyl, C 1-6 Cycloalkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Alkylene -NH2, C 1-6 Alkylene-NH-C(O)H, -As(O), -N=NH, N-(C 1-6 alkyl)amino, N,N-(C 1-6 alkyl)2amino, -NH-C(O)H, -NH-S(O)2H, -C(O)OH, -OC(O)H, -SH, -S(O)2H, -S(O)2-NH2 or heterocyclic, and optionally substituted by R2 or R3, wherein R2 and R3 are each independently selected from amino, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, N-(C 1-6 alkyl)amino, N-(6-12 membered aromatic)amino, N,N-(C 1-6 Alkyl)2amino, C 3-6 Cycloalkyl, 6-12 membered aromatic or 3-12 membered heterocyclic, and optionally substituted by one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, -NH-C(O)-R5, -C(O)OR4, 6-12 membered aromatic, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, 3-6 membered heterocyclic group, C 3-6 cycloalkyl or Bn-O-substituted, and R4 is C 1-6 and optionally substituted by one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aromatic groups, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, 3-6 membered heterocyclic group, C 3-6 Cycloalkyl or Bn-O-substituted, R5 is selected from H, C 1-6 Alkyl, C 2-6Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy or C 1-6 haloalkyl, and / or

[0120] (b) R1 on two adjacent carbon atoms forms a 5-12 membered cycloalkyl, aromatic or heterocyclic group, and is optionally substituted by one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aromatic, C 1-6 Alkyl, C 2-6 Alkynyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, 3-6 membered heterocyclic group, C 3-6 Cycloalkyl or Bn-O-substituted,

[0121] Here, n is an integer from 0 to 5.

[0122] In some embodiments, n is an integer of 0-2, and each of the R1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C 1-6 Alkylsulfone, C 1-6 Alkyl, C 1-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, -As(O), N-(C 1-6 alkyl)amino, N,N-(C 1-6 alkyl)2amino, -NH-C(O)H or -NH-S(O)2H, and is optionally substituted by said R2 or R3.

[0123] In some embodiments, n is an integer of 0-2, and each of the R1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, C 1-6 Alkylsulfone, C 1-6 Alkyl, C 1-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6 haloalkyl, -As(O), -NH-C(O)H or -NH-S(O)2H, and optionally substituted by said R2 or R3.

[0124] In some embodiments, n is 1 or 2, and each of the R1 is independently selected from H, halogen, amino, C 1-6 Alkylsulfone, C 1-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6 haloalkyl, -NH-C(O)R2 or -NH-S(O)2R3, wherein R2 is C 1-6Alkyl, optionally substituted by a 6-12 membered aromatic group, R3 is a 6-12 membered aromatic group, optionally substituted by a halogen, C 1-6 Alkoxy or C 1-6 Haloalkyl substitution.

[0125] In some embodiments, the R1 is located at the ortho and / or para position to the -As(O) group.

[0126] In some embodiments, n is 0.

[0127] As used herein, the term "substituted," when referring to a chemical group, means that one or more hydrogen atoms of the chemical group are removed and replaced with a substituent.

[0128] The term "substituent" as used herein has its ordinary meaning as known in the art and refers to a chemical moiety which is covalently attached or, where appropriate, fused to a parent group.

[0129] The term "C n -C m " represents a range of carbon atoms, wherein n and m are integers and the range of carbon atoms includes the endpoints (i.e., n and m) and each integer point therebetween. For example, C1-C6 represents a range of 1 to 6 carbon atoms, including 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms and 6 carbon atoms.

[0130] As used herein, the term "alkyl", whether used as part of another term or alone, refers to a saturated hydrocarbon group, which may be straight-chain or branched. n -C m "Alkyl" refers to an alkyl group having n to m carbon atoms. In certain embodiments, the alkyl group contains 1 to 12, 1 to 8, 1 to 6, 1 to 4, 1 to 3, or 1 to 2 carbon atoms. Examples of alkyl groups include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, and the like.

[0131] The term "alkenyl" as used herein, whether as a part of other terms or used alone, refers to an unsaturated alkyl group, which can be straight or branched, with at least one carbon-carbon double bond. In certain embodiments, the alkenyl group contains 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4 or 2 to 3 carbon atoms. In certain embodiments, the alkenyl group can also have 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1 carbon-carbon double bond. The example of alkenyl groups includes but is not limited to chemical groups such as vinyl, n-propenyl, isopropenyl, n-butenyl, sec-butenyl etc.

[0132] The term "alkynyl" as used herein, whether as part of other terms or used alone, refers to an unsaturated alkynyl group, which can be straight or branched, with at least one carbon-carbon triple bond. In certain embodiments, the alkynyl group contains 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, or 2 to 3 carbon atoms. In certain embodiments, the alkynyl group can also have 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, chemical groups such as ethynyl, propynyl, butynyl, etc.

[0133] The term "cycloalkyl" used herein refers to a ring system alkyl group consisting of at least 3 atoms. The term "nm-membered cycloalkyl" refers to a cycloalkyl group having n to m members forming a ring. In addition, the ring may also have one or more double bonds, but does not have a completely conjugated system. In certain embodiments, the cycloalkyl group has 3 to 8, 3 to 6, or 4 to 6 carbon atoms forming a ring. Examples of cycloalkyl groups include, but are not limited to, cyclopropane, cyclobutane, cyclopentyl, etc.

[0134] The term "heterocyclic radical" used herein refers to a cyclic radical in which at least one atom in the ring system is a heteroatom and the remaining ring atoms are carbon atoms. The term "nm-membered heterocyclic radical" refers to a heterocyclic radical having n to m members forming a ring. The term "heterocyclic radical" used herein includes heteroaryl and heterocycloalkyl. In addition, the ring may also have one or more double bonds. In certain embodiments, the heterocyclic radical is a saturated heterocycloalkyl. Examples of heteroatoms include, but are not limited to, oxygen, sulfur, nitrogen, phosphorus, etc.

[0135] The term "heterocycloalkyl" used herein refers to a cycloalkyl group in which at least one atom in the ring system is a heteroatom and the remaining ring atoms are carbon atoms. The term "nm-membered heterocycloalkyl" refers to a heterocycloalkyl group having n to m members forming a ring. In addition, the ring can also have one or more double bonds, but does not have a completely conjugated system. In certain embodiments, heterocycloalkyl is a saturated heterocycloalkyl group. The example of heteroatoms includes but is not limited to oxygen, sulfur, nitrogen, phosphorus, etc. In certain embodiments, heterocycloalkyl has 3 to 8, 3 to 6 or 4 to 6 carbon atoms forming a ring. The example of heterocycloalkyl includes but is not limited to azetidine, aziridine, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholine, homopiperazine, etc.

[0136] As used herein, the term "aryl" or "aromatic group", whether used as part of another term or alone, refers to a mono- or poly-carbocyclic ring system radical having alternating double and single bonds between the carbon atoms forming the ring. n -C m"Aryl" refers to an aromatic group having n to m carbon atoms forming the ring. In certain embodiments, an aryl ring system has 6 to 12, 6 to 10, or 6 to 8 carbon atoms in one or more rings. In certain embodiments, an aryl ring system has 2 or more rings fused together. Examples of aryl groups include, but are not limited to, chemical groups such as phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, and the like.

[0137] The term "heteroaryl" used herein refers to an aryl group in which at least one ring atom in an aromatic ring is a heteroatom and the remaining ring atoms are carbon atoms. The term "nm yuan heteroaryl" refers to a heteroaryl with n to m members forming a ring. The example of heteroatoms includes but is not limited to oxygen, sulfur, nitrogen, phosphorus, etc. In certain embodiments, heteroaryl can have 5 to 10, 5 to 8 or 5 to 6 members forming a ring. In certain embodiments, heteroaryl is a 5-yuan or 6-yuan heteroaryl. The example of heteroaryl includes but is not limited to furyl, thienyl, pyridyl, quinolyl, pyrrolyl, N- low alkyl pyrrolyl, pyridyl-N- oxide, pyrimidinyl, pyrazinyl, imidazolyl, indolyl, etc.

[0138] As used herein, the term "alkoxy", whether used as part of another term or alone, refers to a group of the formula "-O-alkyl". n -C m "Alkoxy" refers to an alkoxy group in which the alkyl portion has n to m carbon atoms. In certain embodiments, the alkyl portion has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkoxy groups include, but are not limited to, chemical groups such as methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), t-butoxy, and the like.

[0139] As used herein, the term "haloalkyl", whether used as part of another term or alone, refers to a group of the formula "-alkyl-X", wherein X is a halogen selected from the group consisting of fluorine, chlorine, bromine and iodine atoms. n -C m "Haloalkyl" refers to an alkyl group whose alkyl portion has n to m carbon atoms. In certain embodiments, the alkyl portion has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of haloalkyl groups include, but are not limited to, chemical groups such as halomethyl, haloethyl, halopropyl (e.g., n-halopropyl and isohalopropyl), t-halobutyl, and the like.

[0140] The term "n yuan" as used herein, wherein n is an integer, is generally used together with a ring system to describe the number of atoms forming a ring in a ring system. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, and pyridinyl is an example of a 6-membered heteroaryl ring and 1,2,3,4-tetrahydro-naphthalene is an example of a 10-membered aryl. The term "nm yuan" as used herein is generally used together with a ring system to describe the number of members forming a ring in a ring system, wherein n and m are integers and the range of members forming a ring includes endpoints (i.e., n and m) and each integer point therebetween. For example, 3-8 yuan represents the range of 3 to 8 members forming a ring, including 3 members, 4 members, 5 members, 6 members, 7 members and 8 members.

[0141] The term "halogen" as used herein refers to an atom selected from fluorine, chlorine, bromine and iodine.

[0142] The term "cyano" as used herein refers to a group of the formula "-CN".

[0143] As used herein, the term "hydroxyl" refers to a group of the formula "-OH".

[0144] As used herein, the term "nitro" refers to a group of the formula "-NO2".

[0145] The term "amino" as used herein refers to a group of the formula "-NH2".

[0146] The term "carbamoyl" as used herein refers to a group represented by the formula "-HNCONH2".

[0147] As used herein, the term "compound" is intended to include all stereoisomers (eg, enantiomers and diastereomers), geometric isomers, and tautomers of the depicted structure.

[0148] The compounds described herein may be asymmetric (e.g., have one or more stereocenters). Unless otherwise indicated, all stereoisomers, such as enantiomers and diastereomers, are intended to be included. Various geometric isomers such as olefins, carbon-carbon double bonds, etc. may also be present in the compounds described herein, and all of these stable isomers have been considered herein. Cis and trans geometric isomers of the compounds are described herein and may be separated as mixtures of isomers or as individual isomers.

[0149] Compounds herein also include tautomeric forms. Tautomeric forms are caused by the exchange of single bonds with adjacent double bonds accompanied by the migration of protons. Tautomeric forms include tautomers of protons with isomeric protonation states of the same chemical formula and total charge. Examples of proton tautomers include keto-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs, and cyclic forms, in which protons can occupy two or more positions of heterocyclic systems, such as 1H- and 3H-imidazoles, 1H-, 2H- and 4H-1,2,4-triazoles, 1H- and 2H-isoindoles, and 1H- and 2H-pyrazoles. Tautomeric forms can be balanced or spatially locked into a form by suitable substitution.

[0150] In certain embodiments, the small molecule compounds herein can be obtained by organic synthesis. Any known organic synthesis techniques can be used to prepare and the compounds herein can be synthesized according to a variety of possible synthetic pathways, including salts, esters, hydrates or solvates thereof.

[0151] In some embodiments, the small molecule compound described herein is a compound having the following structural formula, including one or more thereof:

[0152]

[0153]

[0154]

[0155]

[0156] The term "phenylarsine oxide" (PAO) as used herein refers to a small molecule compound with the following specific chemical structure:

[0157]

[0158] The terms "A1" and "G1" used in this article are both small molecule compound inhibitors of PI4KIIIα protein, which have similar structures. Among them, the chemical structure of A1 is:

[0159]

[0160] 5-(2-amino-1-(4-(4-morpholinyl)phenyl)-1H-benzimidazol-6-yl)-N-(2-fluorophenyl)-2-methoxy-3-pyridinesulfonamide

[0161] The chemical structure of G1 is:

[0162]

[0163] (aS)-5-(2-amino-4-oxo-3-(2-(trifluoromethyl)phenyl)-3,4-dihydroquinazolin-6-yl)-N-(2,4-difluorophenyl)-2-methoxypyridine-3-sulfonamide.

[0164] The present invention also relates to derivatives of phenylarsenic oxide, analogs of A1 or G1, which can also be used to treat intracellular protein misfolding-related diseases and lysosomal storage diseases as long as they have the function of inhibiting the phosphokinase activity of PI4KIIIα protein, and the preparation methods of such structural analogs have also been disclosed. In some embodiments, the derivatives of phenylarsenic oxide, A1, or G1 are analogs with similar structures to phenylarsenic oxide, A1, or G1.

[0165] Diseases related to intracellular protein misfolding

[0166] The term "intracellular protein misfolding-related disease" as used herein refers to a disease characterized by the aggregation of abnormally folded proteins in the cytoplasm, which is also diagnosed as protein aggregation (aggregation, accumulation) or protein misfolding (misfolding) disease. In addition, the term "intracellular protein misfolding-related disease" also includes some intracellular inclusion body lesions, such as protein inclusion body accumulation disease, which is mainly composed of a core protein that aggregates due to misfolding, and various stress proteins that participate in responding to unfolded proteins are attached to the outside.

[0167] Diseases associated with intracellular protein misfolding include, but are not limited to, Parkinson's disease (PD), Lewy body dementia (LBD), multiple system atrophy (MSA), inclusion body myocarditis (IBM), frontotemporal dementia (FTD), Huntington's disease (HD), polyglutamine disease (PolyQ), amyotrophic lateral sclerosis (ALS), and prion disease.

[0168] Lysosomal storage diseases

[0169] The term "lysosomal storage disease" as used herein refers to a disease caused by the accumulation of some endogenous or exogenous substances in lysosomes due to various reasons, including but not limited to lysosomal functional defects caused by insufficient enzyme activity in lysosomes, deficiency of activating proteins, transport proteins or lysosomal protein processing and correction enzymes, resulting in the inability to digest corresponding substrates in secondary lysosomes, accumulation of substrates, metabolic disorders, and the formation of storage diseases.

[0170] Lysosomal storage diseases include, but are not limited to, sphingolipid disorders, mucopolysaccharidoses, glycogen storage diseases, glycoprotein storage diseases, lipid storage diseases, post-translational modification defects, intrinsic membrane protein deficiency disorders, neuronal ceroid lipofuscinosis, or lysosome-related organelle disorders. Among them, sphingolipid metabolism disorders include but are not limited to Fabry disease, metabolic disorder skin disease (Farbe disease), Gaucher disease type I, II, III and prenatal death type, GM1 gangliosidosis type I, II, III, GM2 gangliosidosis (family Tay-Sachs idiocy), GM2 gangliosidosis, glomerular leukodystrophy (Krabbe disease), metachromatic leukodystrophy, Niemann-Pick disease type A and B; mucopolysaccharidosis includes but is not limited to Hurler-Schein syndrome and Schein disease (ML I), Hunter syndrome (MPS II), Sanfilippo disease A (MPS IIIA), Sanfilippo disease B (MPS IIIB), Sanfilippo disease C (MPS IIIC), Sanfilippo disease D (MPS IIID), centrifugal osteochondrodysplasia syndrome (MPS IVA), centrifugal osteochondrodysplasia syndrome (MPS IVB), mucopolysaccharidosis type VI (Lami syndrome, MPS VI), Sly disease (MPS VII), MPS IX; glycogen storage diseases include but are not limited to the rare disease Pompe disease (GSD II); glycoprotein storage diseases include but are not limited to α-glycosidosis, β-glycosidosis, fucosidosis, asparaglucosaminuria, Schindler disease type I (infantile onset neuroaxonal dystrophy), Schindler disease type II (Kanzaki disease), Schindler disease type III (moderate severity), sialic acid storage disease type I (cherry-red dot myoclonus syndrome), sialic acid storage disease type II (mucopolysaccharidosis I), galactosialidosis; lipid storage diseases include but are not limited to acid lipase deficiency such as Wolman's Diseases and cholesterol ester storage diseases; post-translational modification defects include but are not limited to multiple sulfatase deficiency, mucolipidosis IIα / β (I-cell disease), mucolipidosis IIα / β (pseudo-Hurler syndrome), mucolipidosis IIIγ (pseudo-Hurler syndrome variant); intrinsic membrane protein deletion disorders include but are not limited to hypercystinosis, Danon disease, myoclonic renal failure syndrome, sialic acid storage diseases such as ISSD, Salla disease and moderately severe Salla disease, Niemann-Pick disease C1 and C2 types, mucolipidosis type IV;Neuronal ceroid lipofuscinosis includes, but is not limited to, ceroid lipofuscinosis type 1 (Haltia-Santavuori disease and INCL), neuronal ceroid lipofuscinosis type 2 (Jansky-Bielschowsky disease), ceroid lipofuscinosis type 3 (Batten-Spielmeyer-Sjogren disease), ceroid lipofuscinosis type 4 (Parry disease and Kufs disease), A and B), ceroid lipofuscinosis type 5 (late infantile Finnish variant), ceroid lipofuscinosis type 6 (Lake-Cavanagh or Indian variant), ceroid lipofuscinosis type 7 (Turkish variant), ceroid lipofuscinosis type 8 (Northern epilepsy, intellectual disability epilepticus), ceroid lipofuscinosis type 9, ceroid lipofuscinosis type 10, ceroid lipofuscinosis type 11, ceroid lipofuscinosis type 12, ceroid lipofuscinosis type 13, ceroid lipofuscinosis type 14; lysosome-related organelle disorders include but are not limited to Hermansky-Pudlak disease type 1, Her Hermansky-Pudlak disease type 2, Hermansky-Pudlak disease type 3, Hermansky-Pudlak disease type 4, Hermansky-Pudlak disease type 5, Hermansky-Pudlak disease type 6, Hermansky-Pudlak disease type 7, Hermansky-Pudlak disease type 8, Hermansky-Pudlak disease type 9, Griscelli syndrome 1 (Elejalde syndrome), Griscelli syndrome 2, Chédiak–Higashi disease. ;

[0171] Drug administration and medical use

[0172] The term "pharmaceutically acceptable" as used herein refers to compounds, materials, compositions and / or dosage forms that are suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reaction or other problems or complications within the scope of reasonable medical judgment, with a reasonable benefit / risk ratio. In certain embodiments, pharmaceutically acceptable compounds, materials, compositions and / or dosage forms refer to those approved by regulatory agencies (such as the U.S. Food and Drug Administration, the China Food and Drug Administration or the European Medicines Agency) or listed in generally recognized pharmacopoeias (such as the U.S. Pharmacopoeia, the Chinese Pharmacopoeia or the European Pharmacopoeia) for animals (more particularly for humans).

[0173] The term "object" as used herein may include humans and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals. The "object" may also be a livestock animal (e.g., a cow, pig, sheep, chicken, rabbit, or horse), or a rodent (e.g., a rat or mouse), or a primate (e.g., a gorilla or monkey), or a domesticated animal (e.g., a dog or cat). The "object" may be male or female, or of different ages. A human "object" may be Caucasian, African, Asian, Semitic, or other races, or a hybrid of different races. A human "object" may be an elderly, adult, teenager, child, or infant.

[0174] In some embodiments, the subject described herein is a human or a non-human primate.

[0175] The PI4KIIIα specific inhibitor disclosed herein can be administered by routes of administration known in the art, such as injection (e.g., subcutaneous injection, intraperitoneal injection, intravenous injection (including intravenous drip or intravenous infusion), intramuscular injection or intradermal injection) or non-injection administration (e.g., oral administration, nasal administration, sublingual administration, rectal administration or topical administration). In some embodiments, the PI4KIIIα specific inhibitor described herein is administered orally, subcutaneously, intramuscularly or intravenously. In some embodiments, the PI4KIIIα specific inhibitor described herein is administered orally.

[0176] The term "therapeutically effective amount" as used herein refers to the amount of a drug that can alleviate or eliminate the disease or symptom of the subject, or can preventively inhibit or prevent the occurrence of a disease or symptom. A therapeutically effective amount can be the amount of a drug that alleviates one or more diseases or symptoms of the subject to a certain extent; the amount of a drug that can partially or completely restore one or more physiological or biochemical parameters related to the cause of the disease or symptom to normal; and / or the amount of a drug that can reduce the likelihood of the occurrence of a disease or symptom. In some embodiments, the term "therapeutically effective amount" as used herein refers to the amount of a drug that can alleviate or eliminate a disease or lysosomal storage disease associated with intracellular protein misfolding in the subject.

[0177] The therapeutically effective dose of the PI4KIIIα specific inhibitor provided herein depends on a variety of factors known in the art, such as body weight, age, past medical history, current treatment, health status of the subject and the intensity of drug interactions, allergies, hypersensitivity and side effects, as well as the route of administration and the extent of disease development. A person skilled in the art (e.g., a physician or veterinarian) may reduce or increase the dose accordingly according to these or other conditions or requirements.

[0178] In some embodiments, the treating further comprises administering a second agent to a subject in need thereof.

[0179] In some embodiments, the second agent is an agent used to treat a disease associated with intracellular protein misfolding, including but not limited to levodopa and riluzole.

[0180] In some embodiments, the PI4KIIIα-specific inhibitor is administered before, after, or simultaneously with the second agent.

[0181] The present application also relates to a method for preventing or treating a disease associated with intracellular protein misfolding, comprising administering an effective amount of a PI4KIIIα-specific inhibitor to a subject in need thereof.

[0182] The present application also relates to a method for preventing or treating lysosomal storage diseases, comprising administering an effective amount of a PI4KIIIα-specific inhibitor to a subject in need thereof.

[0183] Drug Screening

[0184] The present invention provides a method for screening drugs for preventing or treating diseases related to intracellular protein misfolding, comprising contacting a candidate drug with PI4KIIIα protein or nucleic acid or PI4KIIIα, and detecting whether the candidate drug can inhibit the formation or activity of PI4KIIIα.

[0185] The present invention also provides a method for screening drugs for preventing or treating lysosomal storage diseases, comprising contacting a candidate drug with PI4KIIIα protein or nucleic acid or PI4KIIIα, and detecting whether the candidate drug can inhibit the formation or activity of PI4KIIIα.

[0186] Example 1. PI4KIIIα inhibitor promotes microglial lysosomal exocytosis 1.1 Experimental animals

[0187] The mice used were wild-type (WT) C57BL / 6J mice and C57BL / 6J mice with heterozygous knockout (KO) of PI4KA. - / + Mutant mice [Pi4kaGt(RRO073)Byg / +, MMRRC, Cat.#016351, UC Davis Mouse Resource Center (USA)] were backcrossed with wild-type C57BL / 6 mice for more than 5 generations. The resulting Pi4kaGt(RRO073)Byg / + mice were then used in this study. WT mice were purchased from Jicui Yaokang, and all mice were bred at the Animal Research Center, School of Pharmacy, Fudan University (Shanghai, China). All mice were kept in standard cages with no more than 5 mice / box, with unlimited food and water in a 12-hour light / dark cycle. Mice that needed to be bred were kept in no more than one male and two females per box.

[0188] 1.2 Isolation and culture of primary microglia (complete culture medium: MEM + 10% FBS)

[0189] a. Isolation and culture of mixed glial cells

[0190] Anesthetize 18-20 day pregnant mice with anesthetic (1.2% Avertin intraperitoneal injection 0.3mL / 10g), take out the embryo, place it in a sterile beaker, seal the mouth of the beaker with a film glove, and send it to the cell room. Cut the head, take out the brain and the previous steps are the same as taking primary neuronal cells. Place the removed brain tissue in a cell culture dish containing Hank's balanced salt solution (HBSS), then separate the cerebral cortex under a dissecting microscope, place it in HBSS, peel off the meninges and blood vessels attached to the cerebral cortex, tear it up with forceps, and suck it into a 15mL EP tube. After rinsing with HBSS, discard HBSS and add pancreatin (the volume of pancreatin depends on the amount of cells, generally 10× pancreatin ratio is 1:10), place it in a 37℃ CO2 incubator for digestion for 10 minutes, then discard pancreatin, add FBS (about 20% of the total volume) to terminate the digestion reaction for 1.5-2 minutes. Carefully remove FBS with a disposable pipette, add MEM culture medium, and repeatedly blow and beat until the culture medium is a suspension containing cells. At this time, the cells are evenly dispersed in the MEM culture medium without obvious clumps and tissue fragments. After passing through a 70-micron cell sieve, add complete culture medium and blow and beat evenly. After counting the cells, add MEM complete culture medium containing 10% FBS and plant them in T25 cell culture bottles. Each culture bottle is cultured with microglia isolated from the brain of a fetal mouse. Incubate in a CO2 incubator, discard the old culture medium and replace it with fresh culture medium after overnight, and then change the medium every 48 hours. After about 10 days, the cells are observed to grow in layers. The upper layer with better refractive index is microglia, and the lower layer supporting growth is astrocytes.

[0191] b. Isolation and purification of microglia by mild trypsin digestion

[0192] After discarding the old culture medium, wash three times with PBS, add 5mL of low-concentration 0.125% trypsin for digestion, shake the culture bottle while observing under an inverted microscope, and transfer the suspension containing microglia into a 15mL centrifuge tube after most of the upper cells fall off. Centrifuge at 1000g for 5 minutes at 4°C, remove the supernatant, add 2mL of complete culture medium to resuspend the cell pellet, and then mix the cell suspension with 0.4% trypan blue solution in a ratio of 9:1 and drop it on a hemocytometer for counting. After counting, use 1×10 6The number of cells was inoculated in a 35 mm glass-bottomed culture dish coated with poly-lysine. After 30 minutes, fresh complete medium was replaced to remove the incompletely attached cells and cultured in a CO2 incubator. Fresh complete medium was replaced 24 hours after purification, and then full or half medium was replaced every 2 days. Primary microglia were cultured for at least 4 hours before serum-free medium was replaced for subsequent experiments.

[0193] 1.3 Immunostaining of microglia with Iba1 antibody

[0194] Iba1 (Ionized calcium-binding adapter molecule 1) antibody is a specific antibody for microglia and macrophages. It can specifically bind to calcium-binding proteins specifically expressed by microglia and is a marker for microglia in the central nervous system.

[0195] Prepare 4% (w / v) PFA: first, stir 700 mL of water magnetically to accelerate the temperature. After heating, add a few drops of 1 M sodium hydroxide solution to help dissolution. Then, add 40 g of paraformaldehyde (PFA) and stir to completely dissolve it. Add 100 mL of heated 10×PBS to the solution and make up to 1 L with water. Adjust the pH to 8.0, filter, and distribute into 50 mL centrifuge tubes. After cooling, store in a 4°C refrigerator.

[0196] The isolated and purified microglia were seeded into a 12-well plate with a PDL-coated coverslip. When the cell confluence reached about 70%, the culture medium was discarded and washed three times with PBS for 5 minutes each time. The PBS was discarded and fixed with 4% (w / v) PFA at 4°C for 20 minutes, washed three times with PBS for 5 minutes each time, and then permeabilized with 0.2% (w / v) Triton X-100-PBS at room temperature for 5 minutes, and washed three times with PBS for 5 minutes each time. Incubate with 10% BSA (PBS) at room temperature for 1 hour to block the fixed cells, and wash twice with PBS. Put the cell slide in a dark box, add anti-Iba1 antibody and incubate overnight at 4°C, wash three times with PBS for 5 minutes each time. Add fluorescently labeled secondary antibodies and incubate in the dark at room temperature for 1 hour, wash four times with PBS for 5 minutes each time. After adding anti-fluorescence quenching sealing solution containing DAPI dye, the coverslip was turned upside down on the slide, sealed with transparent nail polish, and placed in a dark box for testing. The primary antibody was diluted 1:500 and the secondary antibody was diluted 1:1000.

[0197] Three fluorescent images were randomly selected and the whole image was analyzed using Image-pro-plus software. The red dots are the number of positive cells, the blue dots are the total number of cell nuclei, and the positive cell rate was calculated. The calculation formula is: positive cell rate (%) = number of positively stained cells / total number of cell nuclei × 100%. After calculating the positive cell rate, it was concluded that the purity of the purified microglia in this experiment was >95%, which can be used for subsequent experiments.

[0198] 1.4 Fluorescence staining and live cell imaging

[0199] Primary microglia cells for live cell imaging were seeded in glass-bottomed culture dishes. The old culture medium was discarded and replaced with serum-free culture medium overnight before the experiment. 1mM LysoTracker Red DND-99 was diluted to 50nM with MEM complete culture medium containing 10% FBS. After replacing the old culture medium with the loading solution containing the fluorescent probe, the culture dish was placed in a CO2 incubator and incubated for 30 minutes to stain the lysosomes of live cells. Quinacrine was diluted to 100nM with complete culture medium to stain the intracellular ATP. Fluorescence images were taken by a Nikon inverted microscope (Nikon Eclipse Ti-E, Japan). The objective lens used was Plan Apo 60×1.40 oil objective lens. Real-time live cell imaging was obtained by continuous laser scanning, where the emission light of LysoTracker was 561nm and the emission light of Quinacrine was 488nm. High-concentration PAO stock solution was added to the cell culture medium in a spotting manner to a final concentration of 100 nM in the culture medium. The timing was started from the 0th second of the addition of PAO. A fluorescence image was collected every 10 seconds for time-lapse photography. The total shooting time was 500 seconds. Fluorescence image analysis was performed using Volocity software (PerkinElmer). The laser power used during time-lapse photography was minimized (<1%) to avoid possible fluorescence bleaching.

[0200] 1.5 Treatment of cells with PI4KIIIα inhibitor

[0201] Primary microglia were treated with phenylarsine oxide (PAO), a specific inhibitor of PI4KIIIα at low concentrations. Primary microglial cultures were incubated with 0, 25, or 100 nM PAO diluted in complete medium for 1 hour, and then cell samples were collected for lysosomal exocytosis imaging or culture medium was collected for determination of extracellular ATP concentration. Microglia were treated with MEM culture medium containing 10% FBS without PAO as a control experiment.

[0202] 1.6 Determination of ATP concentration in cell culture medium

[0203] The content of ATP in the extracellular fluid was determined by bioluminescence using a luciferase reporter assay. Microglia were starved overnight with serum-free MEM medium. Throughout the experiment, ATP hydrolase inhibitor dipyridamole (10 μM) was added to the culture medium to prevent ATP hydrolysis. 0, 25, and 100 nM of the PI4KIIIα inhibitor PAO were added to the culture medium, and the culture medium was collected after incubation for 0, 4, 6, 8, 15, 30, and 60 minutes, respectively. 50 μL of ATP assay mixture containing luciferase-luciferin buffer was added to an opaque white 96-well plate, allowed to stand for two minutes to consume ATP in the well, and then 50 μL of sample was added to the well. The luminescence value of the solution was measured using a Varioskan Flash (Thermo Fisher Scientific) multifunctional microplate reader. A standard curve was obtained from the luminescence value of the standard ATP sample, and the ATP content in the sample was obtained by comparing the standard equation. The data are expressed as the mean ± SEM of at least 3 experiments per group. One-way ANOVA was used for statistical analysis of data.

[0204] 1.7 Determination of total intracellular protein content

[0205] The old cell culture medium was aspirated, and the cells were washed three times with PBS buffer. The PBS was discarded and RIPA lysis buffer containing 1% protease inhibitor was added (100 μL / well for 12-well plate). The well plate was placed on ice for lysis for 30 minutes, and the cells at the bottom of the well were scraped clean with a cell scraper and placed in a 1.5 mL centrifuge tube. Then, the cells were centrifuged at 15000 rpm for 30 minutes at 4°C, and the supernatant was collected and the total protein content was measured. The working solution and standard solution were prepared according to the instructions, and the sample and working solution were added to the 96-well plate at a ratio of 1:8, that is, 25 μL of sample and BSA standard solution and 200 μL of working solution were added to each well. After mixing on a flat oscillator for 30 seconds, the well plate was covered with aluminum foil and incubated at 37°C for 30 minutes. After the well plate was cooled to room temperature, the absorbance at 562 nm was measured. The total protein concentration in the cell can be calculated based on the standard curve.

[0206] 1.8 Statistical analysis

[0207] Data were analyzed using GraphPad Prism 5. One-way ANOVA was used for analysis, and mean ± SEM, p < 0.03 was considered statistically significant.

[0208] 1.9 Inhibition of PI4KIIIα promotes the weakening of microglial lysosome fluorescence intensity

[0209] After calculating the positive cell rate, it was found that the purity of the purified microglia in this experiment was >95%, which can be used for subsequent experiments.

[0210] In cultured microglia (from C57B6 or PI4KA - / + mutant mice), 1mM LysoTracker Red DND-99 was diluted to 50nM, and the culture dish was incubated for 30 minutes after replacing the old culture medium with the loading solution containing the fluorescent probe to stain the lysosomes of living cells. Primary microglia cultures were incubated with 100nM concentration of PAO or culture medium for another hour before fluorescence imaging ( Figure 1 ).

[0211] Figure 1 The fluorescence intensity decreases with time (from 0 sec to 500 sec), indicating that the fusion of the lysosomal membrane with the plasma membrane causes the dissociation of the fluorescent dye in the lysosome. Figure 1 (A) In the control group (wild-type WT mouse cells, without PAO), the fluorescence intensity of each fluorescent spot did not change much within 500 seconds. Compared with the fluorescence intensity at 0 seconds, the fluorescence intensity at 250 seconds decreased by 13.5% (p<0.001). After 500 seconds of conventional lysosomal exocytosis, the fluorescence intensity decreased by only 15.1% (p<0.001). Figure 1 (B) In the PAO (100 nM) group, the decolorization was 5.2% at 100 seconds (p<0.001), 47.4% at 200 seconds (p<0.001), 68.5% at 400 seconds (p<0.001), and 70.1% at 500 seconds (p<0.001). Figure 1 (C) In the PI4K+ / - group, the fluorescence intensity of some points was not significantly weakened, with an average fluorescence intensity reduction of 45.1% (p<0.001), and the amplitude of the fluorescence intensity change decreased after 200 s.

[0212] 1.10BPB weakens the fluorescence of lysosomes in microglia

[0213] In order to further verify this "kiss-and-run" fusion form, a membrane-impermeable fluorescence quencher, bromophenol blue (BPB), was introduced at a working concentration of 1mM. BPB can quickly diffuse through the fusion pore formed during the "kiss-and-run" process to quench the residual fluorescence on the inner leaflet of the lysosomal membrane. Primary microglia without any treatment can undergo conventional exocytosis, allowing a small amount of BPB to enter the cell. When the PI4KIIIα enzyme activity is inhibited, a large amount of BPB will enter the inner leaflet of the lysosome through the fusion pore generated during the "kiss-and-run" process, causing the fluorescence of the intracellular lysosomes to be briefly quenched ( Figure 2 ).

[0214] Figure 2(A) is a control group, which showed a decolorization of 17.7% (p<0.001) at 250 seconds and 20.2% (p<0.001) at 500 seconds compared to the fluorescence intensity at 0 seconds. Figure 2 (B) Compared with the fluorescence intensity at 0 s, PAO treatment showed 22.3% (p<0.001) decolorization at 10 s, 55.1% (p<0.001) at 50 s, 62.8% (p<0.001) at 100 s, 69.1% (p<0.001) at 200 s, 75.5% (p<0.001) at 400 s, and 78% (p<0.001) at 500 s. Figure 2 (C) The average fluorescence intensity of 22 fluorescent spots at 500 seconds decreased by 62.5% compared with that at 0 seconds.

[0215] 1.11BPB disperses from lysosomes, causing microglial lysosomal fluorescence to recover / increase

[0216] In addition, when the BPB solution is incubated for 1 hour, BPB enters the cell through conventional exocytosis to a limited concentration, quenching the lysosomal fluorescence. At this time, PI4KIIIα is downregulated to allow the lysosome to fuse with the plasma membrane in a "kiss-and-run" manner, and BPB diffuses out of the lysosome before the lysosomal dye dissociates. At this time, the lysosomal fluorescence that was temporarily quenched re-emerges ( Figure 3 ).

[0217] Figure 3 (A) is a control experiment. Compared with the fluorescence intensity at 0 s, the fluorescence intensity of lysosomes remained almost unchanged at 500 s, with only a slight increase of 1.4%. Figure 3 (B) In the first 200 seconds of WT cells, due to the appearance of fusion pores, extracellular BPB entered the cells and temporarily quenched the fluorescence of lysosomes, and the fluorescence intensity decreased by an average of 41.8% compared with 0 seconds. In the last 300 seconds, due to the existence of fusion pores, intracellular BPB was expelled from the cells through the fusion pores before the dye dissociated from the lysosomes, which restored the temporarily quenched fluorescence and increased by 26.4% compared with 0 seconds. Figure 3 (C)PI4K - / + After the heterozygous knockout cells were incubated with BPB for 1 hour, the BPB concentration inside and outside the cells reached equilibrium because the lysosomes were in a "kiss-and-run" state during this process. Finally, the fluorescence intensity at 500 seconds increased by an average of 11.7% compared with 0 seconds.

[0218] 1.12PI4KIIIα inhibitor promotes ATP exocytosis from microglial lysosomes

[0219] It has been reported in the literature that extracellular ATP plays an important role in promoting the fusion of lysosomes and the plasma membrane, and the large accumulation of ATP in microglia has also been verified (Dou Y, Wu HJ, Li HQ, et al. Microglial migration mediated by ATP-induced ATP release from lysosomes [J]. Cell Research, 2012, 22 (6): 1022-1033; Imura Y, Moriza WA Y, Komatus R, et al. Microglia release ATP by exocytosis [J]. Glia, 2013, 61 (8): 1320-1330; Zhang Z, Chen G, Zhou W, et al. Regulated ATP release from astrocytes through lysosome exocytosis [J]. Nature Cell Biology, 2007, 9 (8): 945-953). Inhibition of PI4KIIIα promotes the "kiss-and-run" fusion of microglial lysosomes and cell membranes, releasing ATP in the lysosomes. After ATP is released to the extracellular space, it further promotes the fusion of lysosomes and cell membranes, thereby releasing cell degradation products and cytotoxic substances in the lysosomes, such as β-amyloid protein. In order to verify the accumulation and release of ATP in lysosomes, the present invention uses 100nM Quinacrine to label the ATP in the cells ( Figure 4 ).

[0220] Figure 4 In the merged image, it can be seen that intracellular ATP and lysosomes are co-localized, verifying that a large amount of ATP is accumulated in microglial lysosomes. At this time, when PAO is incubated, ATP is released to the extracellular space, and intracellular ATP is reduced. Figure 4 (B) Data analysis showed that PAO-treated WT cells and PI4K + / - The extracellular ATP concentration of cells measured at 8, 15, 30, and 60 minutes was significantly increased compared with that of the control group (p<0.05).

[0221] Example 2. PI4KIIIα inhibitor promotes neuronal lysosomal exocytosis 2.1 Isolation and culture of primary hippocampal neuronal cells

[0222] Anesthetize 18-20 day pregnant mice with anesthetic (1.2% Avertin intraperitoneal injection 0.3mL / 10g), take out the embryo, place it in a sterilized beaker, seal the mouth of the beaker with a thin film glove, and send it to the cell room. Cut the head, take out the brain, and place the removed brain tissue in a cell culture dish filled with DMEM high-glucose medium. Then carefully separate the hippocampus under a dissecting microscope, place it in DMEM high-glucose medium, peel off the meninges and blood vessels attached to the hippocampus, tear them up with tweezers, and suck them into a 12-well plate. After adding DMEM high-glucose medium to rinse, carefully suck out the DMEM high-glucose medium with a micropipette, add 1mL 0.125% pancreatin, and place it in a 37℃ carbon dioxide incubator for gentle digestion for 8 minutes. Take it out and shake it every 4 minutes to make the digestion uniform, then carefully suck out the pancreatin, add fetal bovine serum (FBS) (about 20% of the total volume) to terminate the digestion reaction for 1.5-2 minutes. Carefully remove FBS, add inoculation solution (DMEM-HG), blow and beat 10 times, then let stand for 2 minutes. The free single cells are in the supernatant, and the clumps are deposited below. Move the supernatant into the culture dish in an ice bath, repeat three times and discard the deposited clumps. Count the cells after blowing and beating evenly. Each well of the hemocytometer needs to be counted. If the cells are found to be unevenly distributed, count again. After counting, add inoculation solution to blow the cells evenly and plant them in a cell culture plate (usually 1*10 5 / well, and so on. If transfection is required, increase the amount of cells appropriately). Place in a CO2 incubator and incubate for 4 hours before changing the neurobasal medium. When changing the medium, gently shake the liquid in the plate and wash it once with 37℃ inoculation solution to make the vascular cells that are not firmly attached to the wall fall off. After that, change the medium by half every two days and culture in vitro for 10 days (DIV10) for subsequent experiments.

[0223] 2.2 Inhibition of PI4KIIIα promotes the weakening of lysosomal fluorescence intensity in neuronal cells

[0224] Primary hippocampal neurons were isolated from the hippocampus of WT embryonic mice, and PI4KIIIα was inhibited by drugs in the primary neurons. The changes in lysosomes in wild-type neurons treated with and without drugs were compared. Figure 5 ).

[0225] Figure 5 (A) The number of fluorescent spots in lysosomes remained almost unchanged in WT primary neuronal cells without PAO inhibition of PI4KIIIα activity. Figure 5 (B) After wild-type primary neuronal cells were incubated with PAO solution, the lysosomal fluorescence intensity was significantly reduced compared with the control group.

[0226] Example 3. PI4KIIIα inhibitor inhibits the decrease of intracellular α-synuclein protein level 3.1 PC12 and SH-SY5Y cell line culture

[0227] The complete culture system of PC12 is 10% HS and 5% FBS added to high-glucose DMEM; the complete culture system of SH-SY5Y is 15% FBS added to high-glucose DMEM.

[0228] 3.2 Immunofluorescence staining of PC12 and SH-SY5Y cells

[0229] After the cell culture system was treated with drugs, it was first fixed: 4% PFA treatment for 30 minutes; permeabilized: 0.1% Triton-X treatment for 15 minutes; blocked: 10% donkey serum blocking for 1 hour; primary antibody: Mouse anti-α-synuclein; secondary antibody: anti-Mouse Alex 555.

[0230] 3.3α-synuclein ELISA detection

[0231] Add 50ul Huα-synuclein Detection Antibody solution to each well (except chromogen blanks empty), then add 50ul sample and marker (see the figure below for marker preparation) to each well (except chromogen blanks empty), shake gently to mix, cover with membrane and incubate overnight at 4℃; wash the wells four times with 100ul 1X Wash buffer, add 100ul Anti-Rabbit IgG HRP to each well except the blank well, incubate at room temperature for 30 minutes, then wash four times with 1X Wash buffer; add 100μL Stabilized Chromogen to each well, the solution turns blue, incubate at room temperature for 30 minutes away from light; add 100μL Stop Solution to each well. Shake gently to mix, the solution turns yellow, and read using an ELISA reader (wavelength 450nm).

[0232] 3.4 Treatment of cells with PI4KIIIα inhibitor

[0233] PC12 or SY cell culture system: 10% HS + 5% FBS + high glucose DMEM, cultured to 40-60% of the culture dish, transfected with α-synuclein overexpression plasmid using Fugene HD transfection reagent. After 24 hours of culture, starve and culture for 24 hours (remove serum), change to normal culture system, add Lyso-tracker for 30 minutes, replace with fresh culture medium, and treat with PAO at the same time. PAO treatment group: 25nM, 50nM, 100nM treatment time for 10 minutes, then perform immunocytochemical staining.

[0234] 3.5 MTT assay to detect cell viability

[0235] After 12 hours of drug treatment, MTT was added at a final concentration of 0.5 mg / mL. After incubation for 4 hours, the culture medium was removed, 100 μL of DMSO was added to dissolve the adsorbed MTT, and the absorbance value was read after shaking for 15 minutes.

[0236] 3.6 Plasmid transfection

[0237] The α-synuclein overexpression plasmid information is as follows: ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGG AGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA(SEQ No.4)

[0238] α-synuclein ELISA Kit was purchased from Thermo Fisher Scientific (Catalog No. KHB0061), Fugene HD transfection reagent was purchased from Promega (Beijing) Biotech Co., Ltd. (Catalog No. E2311), and α-synuclein monoclonal antibody (Mouse monoclonal) was purchased from Sigma-Aldrich (Shanghai, Catatlog No. S5566).

[0239] 3.7PAO inhibits cell death or apoptosis caused by α-synuclein overexpression in SH-SY5Y cells

[0240] The hallmark cytopathological feature of Parkinson's disease patients is the presence of protein aggregation, mainly misfolded α-synuclein proteins. These aggregated proteins cannot be cleared in time, and are therefore believed to cause cytotoxicity. The present invention transfected the SH-SY5Y cell line with an α-synuclein overexpression (α-syn-OE) plasmid, and then treated it with PAO for 12 hours 24 hours later. The cell survival rate of each group was then detected by MTT experiment and compared with that of the α-syn-OE group ( Figure 6 ).

[0241] The results of One-way ANOVA analysis showed that: Figure 6 (A) The cell survival rate in the α-syn-OE group was significantly lower than that in the control (Vehicle) group. (B) The cell survival rate in the α-syn-OE+PAO treatment group (PAO concentrations were 6.25, 12.5, 25, 50, 75, and 100 nM) was significantly higher than that in the α-syn-OE group (n=5, mean±SEM, One-way ANOVA, **p<0.01, ***p<0.0001vs.α-syn-OE). This experiment shows that PAO can alleviate the cytotoxicity caused by overexpression of α-synuclein.

[0242] 3.8 PAO series compounds promote α-synuclein secretion

[0243] The present invention further detected the property of PAO in promoting α-synuclein secretion or excretion. The cultured PC12 and SH-SY5Y cell lines were transfected with α-synuclein overexpression plasmids using Fugene HD transfection reagent, and after starvation treatment for 24 hours, they were replaced with a complete culture system and treated with compound PAO or PAO derivative p-methylphenylarsine oxide for 4 hours. The α-synuclein level in the cell culture supernatant was detected by ELISA.

[0244] The chemical formula of the PAO derivative p-methylphenyl arsenic oxide is as follows:

[0245]

[0246] Figure 7 (A) shows that in the P12 cell line, the extracellular α-synuclein protein level in the 50nM, 75nM and 100nM PAO treatment groups was significantly increased compared with the control α-synOE group without PAO, suggesting that PAO can promote the efflux of intracellular α-synuclein protein. Figure 7 (B) shows that PAO has the same ability to increase the level of extracellular α-synuclein in the SH-SY5Y cell line. Figure 7 (C) shows that in the P12 cell line, 50nM and 75nM PI-70 treatment can also promote the efflux of intracellular α-synuclein protein.

[0247] 3.9PAO induces a decrease in intracellular α-synuclein protein levels

[0248] In the present invention, the cells are first treated with PAO, and then the intracellular α-synuclein protein level is detected by ELISA detection method and Western blot. The cell culture and drug administration treatment methods are the same as above. Figure 8 The ELISA test results showed that the α-synuclein protein levels in the 75nM and 100nM PAO treatment groups were significantly lower than those in the α-syn OE group, indicating that PAO can reduce the intracellular α-synuclein protein level. Figure 8 (B) Western blot detected that the α-synuclein levels in the 75nM and 100nM PAO treatment groups were lower than those in the control group.

[0249] Example 4. PI4KIIIα inhibitor promotes the secretion of HTT protein and SOD1 protein 4.1 SOD1 ELISA detection

[0250] Add 100ul of the diluted standard curve, blank control and sample to the corresponding wells of the detection plate. Cover the membrane and incubate at 37℃ for 2 hours; discard the liquid in each well, add 100ul Detection Reagent A Working Solution to each well, and incubate at 37℃ for 1 hour; discard the supernatant, wash each well 3 times with 1X Wash buffer, 2 minutes each time and try to avoid liquid residue; add 100ul Detection Reagent B Working Solution to each well, cover the membrane and incubate at 37℃ for 1 hour; repeat the washing operation 5 times; add 90μL Substrate Solution to each well, cover the membrane and incubate at 37℃ for 20 minutes in the dark. The solution turns blue; add 50μL Stop Solution to each well, shake gently to mix, the solution turns yellow, and read as soon as possible using an ELISA reader (absorption wavelength 450nm).

[0251] 4.2 Human Huntingtin ELISA

[0252] Add 50ul of diluted standard curve, blank control and sample to the corresponding wells of the detection plate; immediately add 50ulDetection A Working Solution to each well. After gentle shaking and mixing, cover the membrane and incubate at 37℃ for 1 hour; remove the liquid in each well, wash each well 3 times with 1X Wash buffer, 2 minutes each time and try to avoid liquid residue; add 100ulDetection Reagent B Working Solution to each well. Cover the membrane and incubate at 37℃ for 45 minutes, repeat the washing operation 5 times; add 90μl Substrate Solution to each well. Cover the new membrane and incubate at 37℃ in the dark for 10-20 minutes; add 50μl StopSolution to each well, gently shake and mix, the solution turns yellow, and immediately read with an enzyme reader (absorption wavelength 450nm).

[0253] 4.3 Transfection reagents

[0254] PC12 cell lines were transfected with HTT (1-586aa) (HTT (1-586aa) overexpression plasmid can express the N-terminus of HTT protein, which is an important site for HTT protein shuttling) or SOD1 overexpression plasmid using Fugene HD transfection reagent.

[0255] 4.4 Plasmid transfection

[0256] The following plasmids were purchased from Obio Technology (Shanghai) Corp., Ltd:

[0257] 1) Gene name: HTT (1-586aa); GenBank ID: NM_002111;

[0258] 2) Gene name: SOD1, Gene ID: 6647.

[0259] Human Superoxide Dismutase 1, Soluble (SOD1) ELISA Kit was purchased from Signalway Antibody LLC. (SAB, Catalog No. EK16688); Human Huntingtin (HTT) ELISA Kit was purchased from Signalway Antibody LLC. (SAB, Catalog No. EK2869).

[0260] 4.5PI4KIIIα inhibitor promotes the secretion of HTT protein and SOD1 protein

[0261] In nervous system diseases, HTT and SOD1 proteins are also closely related to the occurrence and development of a variety of nervous system diseases, among which Huntington's disease is related to HTT protein and amyotrophic lateral sclerosis is related to SOD1 protein. The PC12 cell line was transfected with HTT (1-586aa) (HTT (1-586aa) overexpression plasmid can express the N-terminus of HTT protein, which is an important site for HTT protein shuttling) or SOD1 overexpression plasmid using Fugene HD transfection reagent. After 24 hours of culture, the cells were starved for 24 hours and replaced with a normal culture system. At the same time, the compound PAO was treated for 4 hours, and the levels of HTT protein and SOD1 protein in the cell culture supernatant were detected by ELISA. The results showed that in the PC12 cell line, the 25nM, 50nM, 75nM and 100nM PAO treatment groups significantly promoted the secretion of HTT protein compared with the HTT OE group ( Fig. 9 A). At the same time, in the SOD1 overexpression experiment, the secretion of SOD1 in the 75nM and 100nM PAO treatment groups was significantly higher than that in the HTT OE group ( Fig. 9 B).

[0262] Example 5. Inhibition of PI4KIIIα alleviates CBE-induced lysosomal aggregation

[0263] 5.1PAO alleviates CBE-induced cytotoxicity by promoting lysosomes

[0264] Gaucher disease is a common type of lysosomal storage disease (LSD). The disease is caused by a mutation in the glucocerebrosidase gene, which leads to a lack of acid β-glucosidase (GCase) activity in the body, causing its substrate glucocerebroside to accumulate in the lysosomes of macrophages in multiple organs, including the liver, spleen, bones, lungs, and even brain, leading to lesions in the affected tissues and organs. Clinical manifestations include multiple organ involvement and progressive aggravation. Conduritol BEpoxide (CBE) is a commonly used β-glucosidase (β-glucosidase) inhibitor. In the present invention, CBE is used to investigate the regulation of PAO on Gaucher disease.

[0265] The following concentrations of CBE were added to the cultured SH-SY5Y cell line: 1.5μM, 3μM, 6.25μM, 12.5μM, 25μM, 50μM and 100μM, and the cell viability was detected after 72 hours of treatment. The results showed that the cell death or apoptosis caused by 50μM and 100μM CBE treatment for 72 hours was significantly different from that of the control group (ctrl) ( Fig.10A). 100μM CBE was selected to treat SH-SY5Y cells for subsequent experiments. After 24 hours of treatment with 100μM CBE, the cells were starved, and re-incubated with 100μM CBE for 24 hours and treated with different concentrations of PAO for 24 hours. MTT assay was performed to detect cell survival rate. n=5,One-way ANOVA,**p<0.001,***p<0.0001,vs.α-syn-OE. MTT was used to detect the effect of PAO on cell death or apoptosis caused by 100μM CBE treatment. The experimental results showed that the survival rates of cells in the 6.25nM, 12.5Nm, 25Nm, 50Nm, 75nM and 100nM PAO treatment groups were significantly higher than those in the 100μM CBE treatment group ( Fig.10 B).

[0266] 5.2PAO promotes lysosomal release and reduces the accumulation of multiple GlcCer in cells

[0267] Because PAO can induce lysosomal release, the present invention combines PAO and CBE to test whether PAO can affect lysosomal release. Lysosome tracker (LysoTracker) was added to label lysosomes after SH-SY5Y cells were treated with 100 μM CBE for 72 hours. The results showed that the number of positive cells labeled by LysoTracker in the 100 μM CBE treatment group was significantly higher than that in the negative control group ( Fig.11 ), indicating that CBE induces lysosomal aggregation and can be used to simulate Gaucher disease. SH-SY5Y was treated with 100 μM CBE for 72 hours, and LysoTracker was added. After 30 minutes, 50 nM or 75 nM PAO was given for 5 minutes (A) or 10 minutes (B), and then fixed with 4% paraformaldehyde (PFA) for observation. Scale bar = 100 μm. 5 minutes ( Fig.11 A) or 10 minutes ( Fig.11 B) After treatment with CBE, the number of positive cells labeled with Lyso-tracker decreased compared with the control group, indicating that PAO can alleviate lysosomal aggregation induced by CBE.

[0268] PAO reduces the accumulation of glucosylceramide (GlcCer) in CBE-treated cells. The fundamental defect of GD is the lack of activity of glucocerebrosidase, which mainly mediates the decomposition of glucocerebroside into glucose and GlcCer. Therefore, the storage of substrates such as GlcCer occurs in GD patients or CBE-treated cells. In order to further explore whether PAO has an effect on the storage of GlcCer in the SH-SY5Y cell model, we measured the content of GlcCer with different side chains in the cells by LC-MS experiments. The results showed that the concentrations of various GlcCer with different side chains in the 100μM CBE-treated group were much higher than those in the control group (ctrl), and the GlcCer concentration in the 100μM CBE and 50nM PAO co-treated group was lower than that in the 100μM CBE-treated group ( Fig.11 C).

[0269] Compounds A1 and G1 are also specific inhibitors of PI4KIIIα. After SH-SY5Y was treated with 100μM CBE for 72 hours, lysosome marker (Lyso-tracker) was added to mark lysosomes, and 50nM or 75nM A1 or G1 was given for 10 minutes after 30 minutes. The results showed that the number of positive cells marked by Lyso-tracker in the 100μM CBE treatment group increased significantly compared with the negative control group, and 50nM and 75nM A1 or G1 treatment for 10 minutes could reduce the number of positive cells marked by Lyso-tracker compared with the 100μM CBE treatment group ( Fig.12 ). Therefore, both A1 and G1 can promote the exocytosis of lysosomal enzymes and alleviate the lysosomal accumulation caused by CBE treatment.

[0270] 5.3 Knockdown of PI4Kα promotes lysosomal exocytosis or reduces lysosomal storage

[0271] Previous studies have shown that PAO mainly acts on phosphatidylinositol 4-kinase PI4KⅢα at low concentrations (<5μM). In order to further explore the role of PAO's target PI4KⅢα in lysosomal storage diseases and protein misfolding-related diseases, we designed a shRNA interference lentiviral vector (with a green fluorescent protein GFP expression sequence) targeting the gene sequence PI4Kα encoding the PI4KⅢα protein. The results of the protein immunoblotting experiment showed that after 48 hours of transfection of SH-SY5Y cells with the three shRNA interference lentiviral vectors targeting PI4Kα, the interference sequences sh1, sh2, and sh3 all significantly reduced the expression level of PI4KⅢα in the treatment group ( Fig.13A and 13B). After 48 hours of treatment with shRNA interference lentiviral vector, the fluorescence intensity of Lyso-tracker was observed by immunofluorescence. Compared with sh-ctrl, the immunofluorescence intensity of Lyso-tracker in the sh-ctrl and 100μM CBE co-treatment group was significantly increased. Compared with the sh-ctrl and 100μM CBE co-treatment group, the immunofluorescence intensity of Lyso-tracker in the sh1-PI4Kα and 100μM CBE co-treatment group decreased significantly. The above results indicate that knocking down PI4Kα can reduce lysosomal storage or promote lysosomal exocytosis.

[0272] Example 6. Inhibition of PI4KIIIα promotes or activates autophagy and activates autophagic flux

[0273] Previous studies have shown that ALP is blocked during the development of lysosomal storage diseases such as GD. After SH-SY5Y cells were treated with CBE for 48 hours, different concentrations of PAO or mTOR inhibitor rapamycin (RAPA) were added as positive controls according to the grouping, and incubated for 24 hours. Protein immunoblotting experiments or immunofluorescence experiments were performed to study the effects of PAO and other compounds on the autophagy lysosomal pathway by observing common ALP markers. LC3B and p62, common markers of ALP, were detected. Protein immunoblotting experiments showed that in the SH-SY5Y cell model constructed by CBE, PAO promoted LC3B protein expression in a dose-dependent manner and inhibited p62 protein levels, indicating that PAO activated the ALP pathway and activated the autophagy flow ( Fig.14 AC), which is similar to the positive control 500nM RAPA ( Fig.14 AC). The immunofluorescence results were consistent with those of western blot experiments ( Fig.14D). In addition, the H+-ATPase inhibitor Bafilomycin A1 (Baf-A1) is a commonly used ALP inhibitor. By using Baf-A1 to block the ALP signal, it can be further verified whether the protective effect of PAO and other compounds on CBE-constructed SH-SY5Y cells is related to ALP. After SH-SY5Y cells were treated with CBE for 48 hours, different concentrations of PAO or 50nM Baf-A1 were added according to the grouping and incubated for 24 hours, and the cell viability was detected by MTT assay. The experimental results showed that compared with the control group (ctrl), 100μM CBE significantly inhibited the viability of SH-SY5Y cells. Compared with the 100μM CBE treatment group, the cell viability of the 100μM CBE and 25nM, 50nM and 75nM PAO co-treatment groups was significantly increased, while the 50nM Baf-A1 treatment reduced the protective effect of PAO in the corresponding groups, so that the cell viability of the 50nM Baf-A1 and 100μM CBE and 25nM, 50nM and 75nM PAO co-treatment groups was not significantly different from that of the 100μM CBE treatment group ( Fig.14 E), indicating that Baf-A1 blocks the protective effect of PAO on CBE-treated SH-SY5Y cells by inhibiting ALP signaling. The above results confirm that PAO activates ALP to activate autophagic flux and exerts a protective effect on the GD cell model through ALP.

[0274] The ALP pathway marker LC3B was detected in SH-SY5Y cells treated with shRNA interference lentiviral vectors. The results showed that compared with the sh-ctrl group, the LC3B protein level was significantly increased after knocking down PI4Kα ( Fig.15 ), knockdown of PI4Kα in CBE-treated SH-SY5Y cells also promoted the expression of LC3B protein, indicating that the knockdown of PI4Kα also activated the ALP pathway, which was the same as the result of the PI4Kα inhibitor PAO.

[0275] Example 7. Inhibition of PI4KIIIα reduces intracellular cholesterol accumulation in Niemann disease type C (NPC) cells ( Fig.16 )

[0276] U18666A is an intracellular cholesterol transport inhibitor and is often used to construct a cell model of Niemann disease type C (NPC).

[0277] 1 Cell culture and compound treatment

[0278] SH-SY5Y cells were cultured in a complete medium containing high-glucose DMEM plus 15% FBS at 37°C and 5% CO2 incubator. When the cells were 70% confluent, 10 μM U18666A (purchased from Aibixin (Shanghai) Biotechnology Co., Ltd., catalog number: abs819512) was added. At the same time, d5PAO and PAO at different depths were added according to the grouping and cultured for 24 hours.

[0279] 2Filipin staining

[0280] 1) Discard the culture medium in the 24-well plate, add 1 mL of PBS buffer and let stand for 1 minute, discard the liquid in the 24-well plate, and repeat this step twice;

[0281] 2) Add 1 mL of 4% paraformaldehyde to each well and fix at room temperature for 30 minutes;

[0282] 3) Discard the 4% paraformaldehyde in the 24-well plate, add 1 mL of PBS buffer, gently shake the 24-well plate for 1 minute, discard the liquid in the 24-well plate, and repeat this step twice;

[0283] 4) Add 1 mL of 1.5 mg / mL glycine solution to each well and incubate at room temperature for 10 minutes;

[0284] 5) Discard the liquid in the 24-well plate, add 1 mL of Filipin staining solution (purchased from Sigma-Aldrich, catalog number: SAE0087) with a final concentration of 50 μg / mL, and incubate at room temperature for 1 hour, avoiding light;

[0285] 6) Discard the liquid in the 24-well plate, add 1 mL of PBS buffer, gently shake the 24-well plate for 1 minute, discard the liquid in the 24-well plate, and repeat this step twice;

[0286] 7) Take a glass slide and drop 5 μl of mounting medium (containing DAPI) in the center of the slide. Take out the cell slide and dry it. Place the cell side down on the slide so that it is in full contact with the mounting medium. Incubate at room temperature in the dark for 30 minutes.

[0287] 8) Observation with laser confocal microscopy.

[0288] Experimental Results

[0289] SH-SY5Y cells were treated with 10μM U18666A, and different concentrations of PAO were added according to the grouping. The cells were incubated for 24 hours and then Filipin staining was performed for observation. The results of immunofluorescence staining showed that the fluorescence intensity of Filipin staining in the group treated with 10μM U18666A alone was stronger than that in the control group (ctrl), indicating that the treatment with 10μM U18666A led to an increase in the amount of cholesterol bound to Filipin, that is, cholesterol accumulation. The fluorescence intensity of Filipin staining in the group treated with 10μM U18666A and 35nM PAO and 70nM PAO decreased compared with that in the group treated with 10μM U18666A alone ( Fig.16 ). The above results indicate that a certain concentration of PAO can inhibit the cholesterol accumulation caused by U18666A.

[0290] It should be understood by those skilled in the art that, although specific embodiments of the present invention are described herein for the purpose of illustration, various modifications may be made thereto without departing from the spirit and scope of the present invention. Therefore, the specific embodiments and examples of the present invention should not be construed as limiting the scope of the present invention. The present invention is limited only by the appended claims. All documents cited herein are fully incorporated herein by reference.

Claims

1. Use of a PI4KIIIα specific inhibitor in the preparation of a drug for preventing or treating diseases related to intracellular protein misfolding; The intracellular protein misfolding-related disease is Lewy body dementia, multiple system atrophy, Huntington's disease or amyotrophic lateral sclerosis; The PI4KIIIα specific inhibitor is phenylarsine oxide.

2. Use of a PI4KIIIα specific inhibitor in the preparation of a medicament for preventing or treating lysosomal storage diseases; wherein the lysosomal storage disease is Gaucher disease; The PI4KIIIα specific inhibitor is phenylarsine oxide.

3. Use of a PI4KIIIα specific inhibitor and a second agent in the preparation of a drug for preventing or treating a disease associated with intracellular protein misfolding; wherein the PI4KIIIα specific inhibitor is phenylarsine oxide; wherein the second agent is an agent for treating a disease associated with intracellular protein misfolding; The intracellular protein misfolding-related disease is Lewy body dementia, multiple system atrophy, Huntington's disease or amyotrophic lateral sclerosis.

4. The use according to claim 3, wherein the second agent is selected from levodopa and riluzole.

5. Use of a PI4KIIIα specific inhibitor and a second agent in the preparation of a medicament for preventing or treating lysosomal storage diseases; wherein the PI4KIIIα specific inhibitor is phenylarsine oxide; wherein the second agent is an agent for treating a lysosomal storage disease; The lysosomal storage disease is Gaucher disease.

Images