Application of wolfberry miRNA in the preparation of drugs or health products for treating osteoporosis

Abstract

The present invention discloses the application of wolfberry miRNA in the preparation of medicines or health products for treating osteoporosis; the wolfberry miRNA is UCGAUAAACCUCUGCAUCCAG, and the present invention conducts in-depth research on nucleic acid substances in wolfberry through a large number of experimental screenings. The experiments show that the wolfberry miRNA screened by the present invention can observe obvious fluorescence signals in the whole blood, liver, kidney and bone marrow tissues of mice, proving that after being absorbed through the digestive tract, it reaches the bone marrow and liver and kidney tissues through the blood. And the experimental results show that wolfberry miRNA can promote osteogenesis, and qPCR shows that it can down-regulate the expression of the target gene NcoR, up-regulate the expression of related osteogenic genes osteocalcin, osteopontin, bone sialoprotein, osteoblast-specific genes, key genes for bone formation, and promote zebrafish bone formation, promote stem cell differentiation into osteoblasts, and can be used for the preparation of uses in treating osteoporosis.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a wolfberry miRNA derived from wolfberry that can be stably absorbed into the blood through the gastrointestinal tract and its use in treating osteoporosis. Background Art

[0002] Osteoporosis is a progressive metabolic bone disease caused by factors such as aging or lifestyle, characterized by low bone mass, destruction of bone tissue microstructure, increased bone brittleness, and susceptibility to fractures. The destruction and imbalance of osteoblast and osteoclast activity and coupling mechanism are the main factors for the onset of osteoporosis. With the acceleration of the aging process of the population, the incidence of osteoporosis and osteoporotic fractures has been increasing year by year. The Yellow Emperor's Classic of Internal Medicine believes that the kidney is "the place where essence is stored, responsible for bone and marrow production", and the Suwen mentions that "essence is the root of life". Modern research believes that the essence stored in the kidney corresponds to embryonic stem cells and other adult stem cells, which explains the scientific connotation of "kidney storage of essence". Therefore, it is of great significance to promote the differentiation of stem cells into osteoblasts to "tonify the kidney and strengthen bones".

[0003] Lycium barbarum is the dried mature fruit of Lycium barbarum L., a plant of the Solanaceae family. It is mainly distributed in Ningxia, Inner Mongolia, Xinjiang and other northwestern regions of my country. It is a commonly used Chinese medicine for nourishing the liver and kidneys, and improving the eyesight. The Shennong's Herbal Classic states that "long-term consumption of Lycium barbarum strengthens the bones and muscles, lightens the body, and prevents aging"; the Compendium of Materia Medica records that "long-term consumption of Lycium barbarum strengthens the bones and muscles, lightens the body, and prevents aging"; the Famous Doctors' Records also states that "long-term consumption of Lycium barbarum strengthens the bones and muscles, and long-term consumption can resist cold and heat." In recent years, domestic and foreign scholars have conducted a large number of scientific studies on the prevention and treatment of bone destruction-related diseases with Chinese medicine, and found that Chinese medicine can regulate osteoblasts and osteoclasts, target the RANKL / RANK / OPG system of bone tissue, downregulate bone destruction-promoting factors, and upregulate protective factors, thereby counteracting inflammatory damage and reducing bone destruction. Lycium barbarum extract has been proven to strengthen bones and muscles. In rat osteoporosis and arthritis models, it can effectively inhibit bone resorption, accelerate bone formation, and significantly improve the state of bone destruction. Modern pharmacological studies have shown that Lycium barbarum polysaccharides can improve the femoral dry weight, bone density, and trabecular structure of castrated female rats, and reduce absorption pits; Lycium barbarum polysaccharide-containing serum can also promote the proliferation of mouse cranial preosteal cell line MC3T3-E1 cells, increase the intracellular calcium ion and type I collagen content, and enhance the osteogenic differentiation and mineralization ability of bone marrow mesenchymal stem cells. In addition, studies have shown that Lycium barbarum extract can increase the type of type II muscle fibers by activating estrogen-related receptor γ (ERRγ), achieving the effect of simulating exercise training. The above results suggest that the active ingredients in Lycium barbarum can regulate bone metabolism directly or indirectly, but there is still a lack of analysis of its special effective ingredients and in-depth discussion of related mechanisms of action.

[0004] The widespread application of innovative technologies has promoted the rapid development of RNA research and brought microRNA (miRNA) to the forefront of disease genomics research. miRNA is a class of endogenous small RNAs with a length of about 20-24 nucleotides, which have multiple important regulatory roles in cells. There is increasing evidence that miRNA circulates in a stable, cell-free form in extracellular biological fluids such as saliva, urine, and breast milk. These miRNAs secreted outside the cell can target multiple genes, thereby affecting specific target cells. Abnormal secretion of miRNA may lead to cell dysfunction and disease. In recent years, cross-species cell-to-cell information exchange has attracted much attention. It is currently believed that different species of animals and plants can communicate with each other through signal molecules such as hormones or hormone analogs. From an evolutionary perspective, the cross-species transfer of miRNA has a unique position in promoting crosstalk, communication, and signal propagation between distant species. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to conduct in-depth research on the nucleic acid substances in wolfberry on the basis of the existing pharmacological effects of wolfberry, and to screen out wolfberry miRNA that can be stably absorbed into the blood through the gastrointestinal tract and target the bone marrow, liver and kidney. The wolfberry miRNA can promote the differentiation of stem cells into osteoblasts and can be used for the preparation of treatment for osteoporosis.

[0006] Technical solution: In order to achieve the above purpose, the technical solution adopted by the present invention is:

[0007] Application of wolfberry miRNA in the preparation of medicines or health products for treating osteoporosis; the wolfberry miRNA is UCGAUAAACCUCUGCAUCCAG.

[0008] As a preferred embodiment, in the above application, in order to enhance the pharmaceutical characteristics of wolfberry miRNA such as stability, bioavailability and tissue targeting, one or more amino acids in the wolfberry miRNA may be thio-modified and / or methoxy-modified.

[0009] A drug for targeted inhibition of NcoR gene, comprising wolfberry miRNA, the nucleotide sequence of which is UCGAUAAACCUCUGCAUCCAG.

[0010] The wolfberry miRNA and its precursor sequence provided by the present invention can be used to prepare drugs for treating osteoporosis. They can be used alone or in combination as effective components to prepare non-intestinal preparations, and administered in appropriate doses according to the administration mode and the victim's physical signs, or by gene therapy.

[0011] Lycium barbarum miRNA can be synthesized by total synthesis. Lycium barbarum agomir is a total synthetic Lycium barbarum miRNA mimic, and its synthesis method is as follows:

[0012] Agomir is a double-stranded modified RNA molecule. It is a product that has been upgraded through special chemical modification based on chemically synthesized mimics. It is not only more stable and has a longer expression time, but can also be used in cell experiments without the need for transfection reagents. In addition, it can be directly dissolved and used in animal experiments. The wolfberry agomir sequence is: UCGAUAAACCUCUGCAUCCAG, and its 5' end is labeled with FAM fluorescent marker. In addition, the 3' end is modified with cholesterol, the 5' end is modified with two thio backbones, the 3' end is modified with four thio backbones, and the entire chain is modified with methoxy.

[0013] Beneficial effects: The present invention has conducted in-depth research on the nucleic acid substances in wolfberry through a large number of experimental screenings. The experiments show that the wolfberry nucleic acid screened by the present invention can be observed in the whole blood, liver, kidney and bone marrow tissues of mice. Obvious fluorescence signals can be observed, proving that after being absorbed by the digestive tract, it reaches the bone marrow and liver and kidney tissues through the blood. The results of fluorescence localization analysis show that wolfberry miRNA can enter the body of zebrafish after administration, indicating that wolfberry agomir can enter the body of zebrafish. It proves that the wolfberry miRNA screened by the present invention will not be digested and decomposed by the gastrointestinal tract, can be stably enrolled, and distributed to the bone marrow and liver and kidney tissues to exert its efficacy.

[0014] The experimental results also showed that wolfberry miRNA can promote osteogenesis. qPCR showed that it can down-regulate the expression of the target gene NcoR, up-regulate the expression of related osteogenic genes osteocalcin (OCN), osteopontin (OPN), bone sialoprotein (BSP), osteoblast-specific gene (Osterix), and key bone formation gene (Runx2), and can promote zebrafish bone formation and promote the differentiation of stem cells into osteoblasts. It can be used to prepare for the treatment of osteoporosis and has achieved good technical results. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Figure 2 is a map of the binding sites of wolfberry miR-162a-3p and target genes. A. The secondary structure of miR162a-3p. B. The binding sites of miR-162a-3p and target genes.

[0016] Figure 2 In order to observe the fluorescence intensity of wolfberry miR-162a-3p absorbed into the blood and targeted to liver, kidney and bone marrow tissues, A. Blood samples were collected from mice gavaged with wolfberry FAM-miR162a-3p and the fluorescence intensity was observed; B. Bone marrow cavity cells were extracted and separated; C. The distribution of wolfberry FAM-miR162a-3p in the liver and kidney of mice; D. The distribution of wolfberry miRNA in the bone marrow of mice was observed under a fluorescence microscope.

[0017] Figure 3 In vivo fluorescence distribution of zebrafish after administration of Lycium barbarum agomir (fully synthetic Lycium barbarum miRNA mimic).

[0018] Figure 4 Alizarin red staining experiment was used to detect the effect of wolfberry miR162a-3p in promoting osteogenesis of human bone marrow mesenchymal stem cells.

[0019] Figure 5 Wolfberry agomir improves the inhibition of zebrafish skeletal development induced by prednisolone. (A) Wolfberry agomir increases the area of ​​the first vertebrae formed in zebrafish larvae; (B) Wolfberry agomir increases the optical density of the first vertebrae stained with alizarin red in zebrafish larvae; (C) Wolfberry agomir increases the number of vertebral segments formed in zebrafish larvae.

[0020] Figure 6 The reporter gene experiment confirmed that wolfberry miR-162a-3p targeted the downstream gene NcoR. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with specific examples, but these examples should not be construed as limiting the present invention.

[0022] Example 1

[0023] 1. High-throughput sequencing to screen high-copy number miRNAs in mice gavaged with wolfberry

[0024] Ningxia wolfberry homogenate was taken, and each mouse was gavaged with 0.3 mL of wolfberry puree every day for 14 consecutive days. On the last day of gavage, whole blood was taken from the mice for high-throughput deep sequencing. The wolfberry reference genome was used to align wolfberry miRNA and miRNA in mouse blood, respectively, to further analyze whether wolfberry miRNA can be absorbed into the blood through the digestive tract.

[0025] 2. Extraction and Solexa Sequencing

[0026] Total RNA was extracted with Trizol and deep sequencing was performed with Solexa. Small RNAs of 18 to 30 nt were gel purified and connected to Solexa sequencing adapters. The ligation products were purified, reverse transcribed, and PCR amplified. The amplified products were gel purified and sequenced. The image files obtained by sequencing were converted into digital signals. After removing impurity signals and adapter sequences, the results were analyzed and processed by computer.

[0027] 3. Prediction of new miRNAs

[0028] The small RNA sequences obtained from Solexa sequencing were first aligned with the rat genome sequence using SOAP software; MIREAP was used to analyze the hairpin structure of candidate miRNAs; candidate miRNAs with free energy greater than -20 kcal / mol were filtered out; based on miRBase17.0, reported miRNAs were filtered out; MiPred further filtered out functionally non-conserved virtual miRNA precursors (pre-miRNAs).

[0029] 4. RT-PCR analysis

[0030] Small RNA sequenced with Solexa was used for quantitative RT-PCR analysis; 10 ng of RNA was reverse transcribed into cDNA using stem-loop reverse transcription primers and TaqMan reverse transcription kit (ABI). PCR was then performed using DEPC water as a negative template control for PCR analysis.

[0031] 5. Analysis of target genes of Lycium barbarum miRNA using bioinformatics techniques

[0032] The RNAFold online software was used to verify its precursor characteristics and found that the precursor sequence of wolfberry miR162a-3p was UCGAUAAACCUCUGCAUCCAG. It has a typical stem-loop structure (see Figure 1 ), whose mature nucleotide sequence is GAUUCGGGAAAUUUUAUGUUUCUUUGCCAUUUUUUUUUGGAGUUUAGUUGGAAAAAGAGUGAGAGUCGCUGGAGGCAGCGGUUCAUCGAUCUCUUCCUGGGAACGAAUAUAUAAAUAUUGAAAAAGCAUGAAUAGAUCGAUAAACCUCUGCAUCCAGCGUUUGCCUCUUUAUCUUUGUUAUUGGCUUCAAUUUUUUUUGGUUUUUUGAAAAAAGUGAGGGAAAACAGAGUC.

[0033] The mature sequence is located at the 3' end of the precursor sequence, the length of the precursor sequence is 228bp, and the GC content is 36.84%. In addition, its minimum folding free energy (MFE) is -68.30 kcal / mol, and the minimum folding free energy index (MFEI) is 0.81, indicating that the miRNA precursor is relatively stable.

[0034] Example 2

[0035] 1. Lycium barbarum FAM-miR162a-3p reaches liver, kidney and bone marrow tissues through blood in mouse models

[0036] To verify that miR162a-3p can enter the blood, organs and bone marrow of mice, we used FAM fluorescently labeled fully synthetic miR162a-3p agomir to gavage mice. After 3 hours, the whole blood, liver, kidney and bone marrow tissues of mice were taken for rapid frozen section observation. The results showed that obvious fluorescent signals could be observed in the whole blood, liver, kidney and bone marrow tissues of mice, proving that wolfberry miR162a-3p was absorbed by the digestive tract and reached the bone marrow and liver and kidney tissues through the blood (see Figure 2 ).

[0037] 2. Investigation of the in vivo process of wolfberry miR162a-3p

[0038] The results of fluorescence localization analysis showed that wolfberry agomir (wolfberry agomir is a fully synthetic mimic of wolfberry miRNA) could enter the zebrafish body after administration and was mainly concentrated in the gastrointestinal tract of zebrafish (see Figure 3 ), indicating that wolfberry agomir can enter the body of zebrafish.

[0039] Example 3 Biological Activity Assay

[0040] 1. Alizarin red staining method was used to detect the effect of wolfberry miR162a-3p on the growth of human bone marrow mesenchymal stem cells

[0041] Bone effect

[0042] Alizarin red staining experiments showed that wolfberry miRNA promoted osteogenesis, and qPCR showed that miR162a-3p down-regulated the expression of the target gene NcoR, and up-regulated the expression of related osteogenic genes osteocalcin (OCN), osteopontin (OPN), bone sialoprotein (BSP), osteoblast-specific gene (Osterix), and key bone formation gene (Runx2) (see Figure 4 ).

[0043] 2. Lycium barbarum miR162a-3p promotes zebrafish bone formation

[0044] Alizarin red can react with calcium ions to form a deep red precipitate, which can be used to indicate the deposition of calcium matrix in bones. The results of alizarin red staining of zebrafish larvae on the ninth day showed that compared with the blank group, 20μmmol·L -1 Prednisolone significantly inhibited the formation of the first vertebra in zebrafish larvae, as evidenced by a decrease in the area stained with alizarin red (P < 0.001, Figure 5 A), the staining optical density value decreased (P<0.001, Figure 5B), indicating that the osteoporosis model of zebrafish larvae was successfully established. The positive drug etidronate disodium can significantly improve the mineralization area and optical density of the first vertebra of zebrafish larvae (P < 0.01, P < 0.05), and different concentrations of wolfberry agomir can significantly improve the staining area and optical density of the first vertebra of zebrafish larvae (P < 0.05, P < 0.001). -1 and 300 pmol·L -1 It can significantly improve the number of vertebral bone segments formed in zebrafish larvae (P<0.05, P<0.01).

[0045] The above results show that wolfberry agomir can improve the inhibition of prednisolone on the skeletal development of zebrafish larvae to varying degrees, and has the effect of promoting bone formation and increasing bone density. -1 The effect of promoting bone formation is best

[0046] Example 4 Luciferase reporter gene experiment confirms that wolfberry miR162a-3p targets NcoR

[0047] The normal sequence and binding site mutant sequence of NcoR were inserted into the 3'UTR of firefly luciferase, PGL3-NcoR WT and PGL3-NcoR mut, respectively. PGL3 is a luciferase reporter gene plasmid. After the administration of miR-162a-3p to the PGL3-NcoR WT group, the fluorescence intensity decreased significantly; after the administration of miR-162a-3p to the PGL3-NcoR mut group, the fluorescence intensity did not change significantly, indicating that miR-162a-3p binds to the downstream NcoR and inhibits the expression of NcoR (see Figure 6 ).

[0048] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Application of wolfberry miRNA in the preparation of a drug for treating osteoporosis; the nucleotide sequence of the wolfberry miRNA is UCGAUAAACCUCUGCAUCCAG.

2. The use according to claim 1, characterized in that: One or more nucleotides in the wolfberry miRNA may be thio-modified and / or methoxy-modified.

Images