Preparation method of tobacco NtMAB1 gene silenced plant and application of the plant

Abstract

The invention belongs to the field of plant biotechnology, and discloses a preparation method of a tobacco NtMAB1 gene silenced plant and an application of the plant. The preparation method of the tobacco NtMAB1 gene silenced plant comprises: amplifying a sequence M1Ri1 and a sequence M1Ri2 from an NtMAB1 gene exon, connecting the two sequences to a pUCCRNAi vector twice, forming two RNAi silenced vectors with a hairpin structure, constructing an RNAi silenced binary vector by connecting the two silenced vectors with pCAMBIA1300‑35S through enzyme cutting, and transforming the vector into tobacco to obtain a transgenic silenced plant. Compared with the wild type, the transgenic silenced plant has a weaker growth trend of axillary buds and branches at each leaf position before topping, and the growth of axillary buds at each leaf position after topping is also significantly inhibited. In practical applications, the use of bud inhibitors and artificial pruning can be reduced or avoided, so as to achieve the effects of reducing labor and increasing efficiency in tobacco production, reducing pesticide residues, etc., and has important theoretical reference value and application value.

Description

Technical Field

[0001] The present invention relates to the field of plant biotechnology, and in particular to a preparation method of a tobacco NtMAB1 gene silenced plant and applications of the plant. Background Art

[0002] Branching is a crucial component of plant morphology and a key factor influencing crop yield. Tobacco is a cash crop primarily harvested for its leaves. Excessive branching reduces leaf nutrients, which in turn impacts leaf yield and quality. Therefore, reducing tobacco branching is crucial for tobacco production. During the bud and flowering stages of tobacco's growth cycle, topping is commonly used to halt reproductive development, concentrating nutrients on the leaves. However, topping eliminates apical dominance, causing axillary buds to rapidly grow into lateral branches. This process consumes significant amounts of nutrients, leading to an outflow of nutrients from the leaves and a reduction in leaf size. This results in smaller, thinner leaves, reduced oil content, decreased aroma, and a significant reduction in yield and quality. To address this issue, conventional methods in tobacco production include manually removing branches or using bud inhibitors to control axillary bud growth. However, these methods pose challenges such as increased production costs, environmental pollution, and pesticide residues.

[0003] In current research on branch development, the interplay of various factors and the complex hormonal regulatory network present challenges in understanding the mechanisms of branch development. However, this also provides a potential means for the regulation of branch development. While the functions of RAV family members in floral development and flowering control have been well understood, the molecular mechanisms underlying their involvement in plant branch development remain relatively understudied.

[0004] Therefore, identifying and isolating tobacco axillary bud development-related genes and constructing gene-silenced plants of tobacco axillary bud development-related genes through genetic engineering methods can reduce or avoid artificial branch removal or the use of bud inhibitors, and provide new methods and research directions for reducing labor and increasing efficiency in tobacco production, reducing pesticide residues, and improving tobacco quality. Summary of the Invention

[0005] To address the current problems of artificial bud removal or bud inhibitors in tobacco production, which are high cost, environmentally unfriendly, and produce excessive pesticide residues, the applicant has isolated and identified a new gene, NtMAB1, that regulates axillary bud development. Through gene silencing, the applicant has constructed a tobacco plant with NtMAB1 gene silenced. The applicant also provides a specific method for preparing the plant and its application. After topping, these gene-silenced plants can still control axillary bud growth without the need for artificial bud removal or bud inhibitors, providing a new method and research direction for reducing labor and increasing efficiency in tobacco production, reducing pesticide residues, and improving tobacco leaf quality.

[0006] The technical solutions of the present invention are as follows:

[0007] The present invention utilizes a tobacco T-DNA activation tag insertion mutant library to discover a multi-branched, dwarf mutant plant within the mutant population, named mab1 (more axillary branches 1). Molecular biological studies were conducted on this mutant strain. A candidate gene was identified through tail-PCR, genotype and phenotype co-segregation analysis, and qRT-PCR analysis. Gene cloning and protein structure analysis confirmed that the gene is a transcription factor of the RAV family. Functional studies of the NtMAB1 gene confirmed that NtMAB1 is a positive regulator of tobacco axillary bud growth and development. Detailed research on the gene was conducted, and a tobacco NtMAB1 gene-silenced plant was constructed through genetic engineering methods.

[0008] The above-mentioned genes are nucleotide sequences of SEQ ID No: 1 and SEQ ID No: 2 (NtMAB1-S1 and NtMAB1-T1) or their complementary sequences. Among them, the protein sequence expressed by the sequence NtMAB1-S1 of the present application is as shown in SEQ ID NO: 7.

[0009] In a first aspect, the present invention provides a method for preparing the above-mentioned tobacco NtMAB1 gene silenced plant, the method comprising the following steps:

[0010] S1. Using the sequence of the NtMAB1-S1 gene exon gene as a template, primers were designed and amplified by PCR to obtain the M1Ri1 fragment shown in SEQ ID NO: 8; the M1Ri1 fragment and the pUCC-RNAi vector were double-digested, the fragments were purified, and then ligated. The ligation products were transformed into competent Escherichia coli, and positive clones were picked. The positive clones were tested by PCR and the amplified products were sequenced. The pUCC-Ri1 intermediate vector was extracted from the positive clones with correct sequencing results;

[0011] S2. Double-enzyme digestion and fragment purification were performed on the pUCC-Ri1 vector. The purified pUCC-Ri1 intermediate vector fragment was ligated with the double-enzyme digestion and purified M1Ri1 fragment to obtain the pUCC-M1Ri1 silencing vector. Positive clones were identified by PCR.

[0012] S3. Using a sequence containing NtMAB1-S1 gene exons (e.g., a genome) as a template, primers are designed and PCR amplified to obtain the M1Ri2 fragment shown in SEQ ID NO: 11. The remaining steps are the same as S1 and S2 to construct the pUCC-Ri2 vector and the pUCC-M1Ri2 silencing vector. After transformation into competent cells, positive clones are identified by PCR.

[0013] S4. The pUCC-M1Ri1, pUCC-M1Ri2, and pCAMBIA1300-35S vectors prepared in the above steps are digested with single enzymes and purified, respectively; the pUCC-M1Ri1 and pUCC-M1Ri2 vector fragments after digestion and purification are mixed with the pCAMBIA1300-35S vector after single enzyme digestion and ligated, the ligation products are transformed into competent E. coli, cultured overnight on a resistance medium, and positive clones are identified by PCR; the vector carried by the positive clone is the binary silencing vector of the NtMAB1 gene;

[0014] S5. The two binary silencing vectors of the NtMAB1 gene successfully constructed in the previous step, pCAMBIA1300-35S-M1Ri1 and pCAMBIA1300-35S-M1Ri2, were transformed into Agrobacterium, and the tobacco NtMAB1 gene-silenced plants were obtained by leaf disc infection.

[0015] Preferably, in step S1, the M1Ri1 fragment is amplified using the M1Ri-F1 and M1Ri-R1 primer pairs shown in SEQ ID NO: 9 and SEQ ID NO: 10; in step S3, the M1Ri2 fragment is amplified using the M1Ri-F2 and M1Ri-R2 primer pairs shown in SEQ ID NO: 12 and SEQ ID NO: 13.

[0016] More preferably, the above preparation method specifically comprises the following steps:

[0017] S1. Using the M1Ri-F1 and M1Ri-R1 primer pairs of SEQ ID NO: 9 and SEQ ID NO: 10, the M1Ri1 fragment was amplified by PCR; the M1Ri1 fragment and the pUCC-RNAi vector were double-digested and the fragments were purified using endonucleases BamHI and SalI, respectively; the two purified fragments were mixed in equal proportions, ligated with ligase, and transformed into competent Escherichia coli, cultured overnight in Amp-resistant LB medium, and positive clones were identified using the M1Ri-R1 and Rintron-R1 primer pairs of SEQ ID NO: 10 and SEQ ID NO: 14 and sent for sequencing to obtain the pUCC-Ri1 intermediate vector.

[0018] S2. Double-digest the pUCC-Ri1 vector with XhoI and BglII, and purify the fragment. Ligate the purified pUCC-Ri1 intermediate vector fragment with the purified M1Ri1 fragment double-digested with BamHI and SalI to generate the pUCC-M1Ri1 silencing vector. Identify the vector using the bandless primer pair M1Ri-F1 and M1Ri-R1, and the band-forming primer pair M1Ri-R1 and Rintron-R1.

[0019] S3. Using the primer pairs M1Ri-F2 and M1Ri-R2 of SEQ ID NOs: 12 and 13, amplify the M1Ri2 fragment. The remaining steps are the same as in S1 and S2 to construct the pUCC-Ri2 vector and the pUCC-M1Ri2 silencing vector. Identification was performed using the primer pairs M1Ri-F2 and M1Ri-R2, which lack a band, and M1Ri-R2 and Rintron-R1, which have a band.

[0020] S4. Use the endonuclease PstI or SbfI to digest and purify the pUCC-M1Ri1, pUCC-M1Ri2, and pCAMBIA1300-35S vectors. Mix the pUCC-M1Ri1 and pUCC-M1Ri2 vector fragments with the pCAMBIA1300-35S vector fragments in appropriate proportions. After ligation, transform competent E. coli cells and culture overnight in Kana-resistant LB medium. Identify the fragments using primers M1Ri-R1, M1Ri-R2, and Rintron-R1, respectively.

[0021] S5. The two successfully constructed binary silencing vectors of the NtMAB1 gene, pCAMBIA1300-35S-M1Ri1 and pCAMBIA1300-35S-M1Ri2, were transformed into Agrobacterium, and transgenic plants were obtained by infection through the leaf disc method.

[0022] In a second aspect, the present invention further provides a tobacco NtMAB1 gene silencing recombinant vector, which is the pCAMBIA1300-35S-M1Ri1 and pCAMBIA1300-35S-M1Ri2 binary silencing vector prepared by the aforementioned preparation method.

[0023] In a third aspect, the present invention further provides a recombinant host cell transformed with the aforementioned tobacco NtMAB1 gene silencing recombinant vectors pCAMBIA1300-35S-M1Ri1 and / or pCAMBIA1300-35S-M1Ri2 binary silencing vectors. The host cell can be selected from plant cells or microbial cells, preferably plant cells, and most preferably tobacco cells. The cell can be isolated, in vitro, cultured, or a part of a plant. Preferably, the cell is an Escherichia coli or Agrobacterium cell.

[0024] In a fourth aspect, the present invention further provides the use of the tobacco NtMAB1 gene silenced plants in cultivating high-efficiency tobacco varieties with inhibited axillary bud growth.

[0025] In a fifth aspect, the present invention also provides primers for identifying the tobacco NtMAB1 gene silenced plants as described in claim 1, wherein the primers are M1Ri-R1 and Rintron-R1 as shown in SEQ ID NO: 10 and SEQ ID NO: 14, or M1Ri-R2 and Rintron-R1 as shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0026] In a sixth aspect, the present invention also provides a method for identifying silenced plants of the above-mentioned tobacco NtMAB1 gene, the method comprising: using the extracted genome of the tobacco to be identified as a template, using the primer pair M1Ri-R1 and Rintron-R1 as shown in SEQ ID NO: 10 and SEQ ID NO: 14 or the primer pair M1Ri-R2 and Rintron-R1 as shown in SEQ ID NO: 13 and SEQ ID NO: 14 to perform PCR amplification on two silencing vectors respectively, sequencing the amplified products, and comparing the sequencing results with the sequence of the NtMAB1 gene to obtain the identification result.

[0027] The technical solution of the present invention has the following beneficial effects:

[0028] 1. The present invention screened a multi-branched, late-flowering mutant plant and further identified a novel gene, NtMAB1, in tobacco that regulates axillary bud development. After cloning and verifying the function of NtMAB1, the authors used genetic engineering methods to create NtMAB1-silenced plants. These plants exhibited stable morphology. Compared to wild-type plants, axillary bud and branch growth at all leaf positions was weaker before topping, and axillary bud growth at all leaf positions was significantly inhibited after topping. This approach can reduce or avoid the use of bud inhibitors and manual twig removal in practical applications, thereby reducing labor and increasing efficiency in tobacco production while reducing pesticide residues. The invention possesses important theoretical and practical value.

[0029] 2. The present invention also provides a method for preparing the above-mentioned gene-silenced plants, and further provides a method for identifying the plants and the identification primers used, which facilitates the rapid and accurate identification of tobacco NtMAB1 gene-silenced plants in practical applications, thereby determining whether the target plants need to be sprayed with bud inhibitors or manually pruned. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1Determination of target insertion sites and candidate genes; A: T-DNA activation tag insertion site and possible activated genes upstream and downstream of the insertion site, U (Upstream) and D (Downstream) are upstream (opposite to the direction of the 35S enhancer sequence) and downstream (consistent with the direction of the 35S enhancer sequence) of the insertion site, respectively; BE: Expression of candidate genes in different tissues of HD and mab1 mutants, 1S, stem sample at seedling stage; 1L, leaf sample at seedling stage; 3AB1U, mixed sample of the three upper axillary buds before topping at vigorous growth stage; 3AB1D, mixed sample of the three lower axillary buds before topping at vigorous growth stage;

[0031] Figure 2 Phenotypic characteristics of the F1 generation heterozygous line F1001 and expression analysis of the NtMAB1 gene in F1001 plants; A: Phenotypic characteristics of F1001; B: Quantitative analysis of axillary bud traits in F1001; C, D: Expression analysis of the NtMAB1 and NtBRC1 genes in the upper and lower axillary buds of F1001;

[0032] Figure 3 PCR amplification of NtMAB1 gene in genomic DNA and cDNA of Nicotiana velutipes and Nicotiana tabacum; T: Nicotiana velutipes; S: Nicotiana tabacum; M: Marker;

[0033] Figure 4 Structural analysis of NtMAB1-S1 / T1 protein and RAV family members; the black line marks the AP2 functional domain; the red line marks the B3 functional domain shared by all nine members; the blue line marks the B3 inhibitory functional domain that is highly conserved between tobacco and Arabidopsis;

[0034] Figure 5 Phenotypic analysis of NtMAB1 overexpressing plants; A, B: Photos of NtMAB1 overexpressing plants; C: Quantitative analysis of axillary bud traits in NtMAB1 overexpressing plants; D: Photos of leaves in NtMAB1 overexpressing plants; E, F: Expression levels of the NtMAB1 gene in the upper and lower axillary buds of overexpressing plants. OE: overexpression; U: upper axillary bud or branch; D: lower axillary bud or branch.

[0035] Figure 6 is the expression analysis of NtBRC1 gene in the overexpression line; AB-U: upper axillary bud; AB-D: lower axillary bud;

[0036] Figure 7Phenotypic analysis of RNAi transgenic plants in the mab1 mutant background; AB: Phenotypic characteristics of mKD axillary buds; C: Statistics of mKD axillary bud or branch length; DF: Expression level detection of the NtMAB1 gene in mKD and control lines, 1U is the upper axillary bud of the tobacco plant before topping; 1D is the lower axillary bud of the tobacco plant before topping; L is the leaf;

[0037] Figure 8 Screening of RNAi-silenced plants in HD background; A: PCR identification of RNAi-transgenic positive plants; B: Detection of NtMAB1 expression levels in RNAi-transgenic positive plants;

[0038] Figure 9 Phenotypic analysis of RNAi silenced plants in wild-type background; A: Phenotypic characteristics of axillary buds in KD plants; B: Statistics of axillary bud length in KD plants; CE: Expression levels of the NtMAB1 gene in mKD and control lines, 1U is the upper axillary bud of the tobacco plant before topping; 1D is the lower axillary bud of the tobacco plant before topping; L is the leaf;

[0039] Figure 10 Quantitative analysis of axillary bud lengths of different tobacco plants before and after topping during vigorous growth. A, B: Statistics of axillary bud or branch lengths at each leaf position of different tobacco plants before topping; C, D: Statistics of axillary bud lengths at each leaf position of different tobacco plants 3 days after topping; E, F: Statistics of axillary bud lengths at each leaf position of different tobacco plants 7 days after topping.

[0040] Figure 11 To quantitatively analyze the length of axillary buds of HD, mab1 and transgenic lines after topping;

[0041] Figure 12 The expression level of NtMAB1 gene in tobacco plants was analyzed 3 days after topping. 2U: upper axillary buds or branches after topping; 2D: lower axillary buds or branches after topping. DETAILED DESCRIPTION

[0042] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in this field. The methods in the following embodiments, unless otherwise specified, are conventional methods in this field.

[0043] Example 1 Screening of tobacco branching mutant mab1

[0044] 1. Plant materials:

[0045] The donor parent, Honghua Dajinyuan (abbreviated as Hongda, HD), and the T-DNA activation-tagged T1 mutant line, mab1, were used as experimental materials. Seeds of the wild-type HD and the T-DNA activation-tagged mab1 mutant were provided by the Tobacco Germplasm Resources Sub-Platform of the National Crop Germplasm Resources Platform and the Tobacco Mutant Library of the Tobacco Research Institute, Chinese Academy of Agricultural Sciences. This mutant library was constructed by inserting the T-DNA activation-tagged vector pSKI015. All other experimental materials were obtained through vector construction and genetic transformation of tobacco plants in the HD background.

[0046] Table 1 Strains and vectors used in the experiment

[0047]

[0048] 2. Instruments and equipment: flower pots, seedling medium, Canon 5Ds camera, ruler

[0049] 3. Test methods

[0050] The axillary bud phenotypes of Honghua Dajinyuan and the T1 generation mab1 mutant were observed throughout the plant's growth period, and plant growth was photographed using a Canon 5Ds camera. Five lines of mab1 homozygous mutant plants were counted during the clustering and vigorous growth stages, and the length of axillary buds or branches of Honghua Dajinyuan and the mab1 mutant was measured and recorded using a ruler.

[0051] 4. Results and Analysis

[0052] The laboratory screened a multi-branched late-flowering mutant line from the T1 generation activation tag mutant library. At the cluster stage, axillary branches were clearly visible on all leaves of the entire plant, and the length of branches at each leaf position of the mutant was significantly longer than that of the wild type. We named this gain-of-function mutant mab1.

[0053] During the vigorous growth phase, axillary branches were still prominent on all leaves of the mab1 mutant, and the length of branches at each leaf position was significantly longer than that of the wild type. The mutant's axillary buds continued to grow, eventually becoming branches. They also flowered late, 20 days later than the wild type under greenhouse conditions, with slower flowering and fewer, smaller flowers. Inflorescences appeared on the top two or three branches, but were smaller than those on the main stem. In terms of plant height, the mutant was slightly shorter than the wild type (HD) during the clumping and vigorous growth phases, but during the reproductive growth phase, its plant height matched or even exceeded that of the HD.

[0054] Example 2 Determination of target insertion site and candidate gene NtMAB1

[0055] Reagents and kits:

[0056] CWBIO plant genomic DNA extraction kit, plant RNA extraction kit, reverse transcription kit, rTaq enzyme, KOD enzyme, TAKARA fluorescent quantitative reaction polymerase kit.

[0057] 1. Experimental methods

[0058] (1) Flanking sequence amplification

[0059] This experiment used TAIL-PCR (thermal asymmetric interlaced PCR) to amplify fragments flanking the T-DNA activation tag. Using DNA from a T1-positive plant as a template, three PCR amplifications were performed using pSKI015-specific nested primers SP1, SP2, and SP3, along with random primers AD. Each reaction was performed using the following system:

[0060] Set up the PCR reaction program:

[0061]

[0062] The products obtained by the three-step PCR amplification were subjected to electrophoresis test. Because fragments smaller than 500 bp are mostly vector sequences, it is difficult to analyze effective flanking sequence information. Therefore, products with bands larger than 500 bp were excised and recovered and sent for sequencing. The sequencing results were subjected to Blast comparison analysis in the tobacco genome database to determine the T-DNA insertion position.

[0063] (2) Co-segregation analysis

[0064] A pair of genome-specific primers, GF / GR, was designed based on the 1000-bp genomic sequence upstream and downstream of the insertion site. A specific primer, TP, was designed based on the T-DNA insertion sequence and paired with GR (Table 2). Two PCR reactions were performed to determine whether the plant had a homozygous or heterozygous mutation and to verify the accuracy of the insertion site. The PCR reaction system and procedure followed the same principles as conventional PCR.

[0065] Table 2 Primers for co-segregation experiments

[0066]

[0067] (3) Identification of candidate genes

[0068] The target insertion position was determined by flanking sequence analysis and co-segregation, and the Gbrows tool was used to search for genes within 100 kb upstream and downstream of the insertion site to obtain candidate genes flanking the insertion site.

[0069] (4) Expression of candidate genes

[0070] RNA extraction: The homozygous mutant and red flower daisy were grown in a greenhouse under identical cultivation methods and management conditions. Fresh leaves and axillary buds were collected from each plant during the vigorous growth phase, wrapped in tin foil, and immediately stored in liquid nitrogen. Total RNA was extracted using the TAKARA Plant RNA Mini Kit, following the manufacturer's instructions.

[0071] Synthesis of cDNA chain: This experiment uses Takara PrimeScript TM Reverse transcribe the extracted RNA using the II 1st Strand cDNA Synthesis Kit, following the procedure described in the manufacturer's instructions. Store the reverse-transcribed cDNA at -20°C.

[0072] Target gene identification by quantitative PCR: Primers were designed based on candidate gene sequences according to the principles of real-time quantitative PCR primer design (Table 3). cDNA was diluted fourfold and used as a template for real-time quantitative reverse transcription-PCR (qRT-PCR) reactions. The tobacco housekeeping gene ubiquitin-conjugating enzyme E2 (Ntubc2) was used as an internal control. qRT-PCR amplification was performed using a TAKARA SYBR Premix Ex Taq™ fluorescence quantitative PCR kit. Each reaction was performed in triplicate. The system and reaction procedures were followed exactly as directed in the manufacturer's instructions. Data were analyzed using ABI 7500 fluorescence quantitative analysis software.

[0073] Table 3 Fluorescence quantitative PCR primers

[0074]

[0075] (5) Analysis of the first generation of hybrids between homozygous mab1 mutants and HD

[0076] 2. Experimental results and analysis

[0077] (1) The mutant DNA was amplified using the TAIL-PCR method to obtain two flanking sequences, indicating that the mutant contains at least two insertion sites. According to the gene sequence on both sides of the insertion site and the activation tag vector sequence, a pair of genome-specific primers and a vector-specific primer were designed respectively. The three primers formed two pairs of primer combinations, and the mutant segregation generations were genotyped to obtain the genotype of each individual in the segregation line, and then matched with the individual phenotype. If the homozygous and heterozygous genotypes of the mutant both correspond to the mutant phenotype, and the wild-type genotype corresponds to the wild-type phenotype, then the insertion site is the target insertion site, that is, the genotype and phenotype are co-segregated. The co-segregation analysis of genotype and phenotype showed that only insertion site 1 (C110) met the co-segregation rule of genotype and phenotype, so C110 is the target insertion site.

[0078] (2) Since the effect of 35S enhancer is not directional, after obtaining the target insertion site, we analyzed the genes within 100Kb upstream and downstream of the target insertion site ( Figure 1 A) If Figure 1 As shown, there are 6 genes within 100kb upstream and downstream of the insertion site, including 4 upstream, named U1-U4; and 2 downstream, named D1-D2. All 6 genes within this range may be activated for expression.

[0079] The upper and lower axillary buds of HD and mab1 mutant plants at the vigorous stage, and the stems and leaves of HD and mab1 at the seedling stage were used as samples to perform qRT-PCR analysis on the above six flanking genes ( Figure 1 BE), the results showed that the expression level of gene D1 in the stem and leaf of the mutant mab1 at the seedling stage was 45 and 32 times higher than that in HD, respectively; the expression level of gene D1 in the upper axillary bud AB1U and the lower axillary bud AB1D at the vigorous growth stage was 32 and 116 times higher than that in the upper and lower axillary buds of HD, respectively; the expression level of gene D1 in the lower axillary bud was 3-4 times higher than that in the upper axillary bud, while the expression levels of the other five genes had no significant differences compared with HD, indicating that gene D1 is the candidate gene of this study and it was named NtMAB1.

[0080] (3) To further confirm that the phenotype of the mab1 mutant was caused by the activation of the NtMAB1 gene, we hybridized the homozygous mab1 mutant with HD and found that the axillary branch phenotype of the F1 generation (named F1001) was between the wild type and the homozygous mab1 mutant, and the NtMAB1 gene expression level in the upper and lower axillary buds of the F1001 plants was also between that of HD and the homozygous mab1 ( Figure 2A, B). NtBRC1 is a gene that maintains axillary bud dormancy in many species. The higher the expression level of NtBRC1, the stronger the inhibitory effect on axillary bud activity, and the slower the axillary bud growth. The expression level of the NtBRC1 gene, which maintains axillary bud dormancy in tobacco, was detected. The results showed that the expression level of the NtBRC1 gene in the upper and lower axillary buds of F1001 plants was between HD and mab1, and the expression level of the NtBRC1 gene in mab1 was the lowest. The expression of NtBRC1 and NtMAB1 in the three types of plants showed opposite trends ( Figure 2 C, D).

[0081] Example 3 Cloning and bioinformatics analysis of the NtMAB1 gene

[0082] 1. Experimental methods

[0083] (1) Amplification and purification of target gene fragments

[0084] Nicotiana tabacum is an allotetraploid, with two ancestral species, N. sylvestris and N. tomentosiformis. Similarly, the NtMAB1 gene has two copies, one from N. sylvestris and one from N. tomentosiformis. A pair of primers (Table 4) were designed based on their specificity to amplify the genomic DNA (gDNA) and cDNA sequences of NtMAB1-S1 and NtMAB1-T1, respectively, from N. sylvestris genomic DNA and cDNA. PCR products were purified using the Takara DNA Fragment Purification Kit.

[0085] Table 4 NtMAB1 gene amplification primers

[0086]

[0087] (2) TA cloning and transformation of E. coli

[0088] The purified DNA fragments were subjected to terminal addition "A" reaction and then reacted with pMD TM Add the 19T vector to a centrifuge tube at a 3:1 ratio and mix thoroughly. Add an equal volume of Solution I and mix thoroughly. Ligate at 16°C for 1-2 hours. Transform the ligated vector into E. coli. Once E. coli has grown on LB medium, add 1ml of liquid LB medium and 1μl of ampicillin to a 1.5ml centrifuge tube. Pick a single colony in a clean hood, place it in the same centrifuge tube, number it, and shake it on a shaker at 37°C for 5-6 hours. Perform PCR on the culture to detect the target fragment. Use the same PCR system and procedure as the rTaq enzyme reaction system. Select positive strains and send them to BGI for sequencing.

[0089] 2. Experimental results

[0090] like Figure 3 As shown, the full-length gDNA sequence of NtMAB1-S1 is 2294 bp, and the gDNA fragment of NtMAB1-T1 is 2368 bp. Meanwhile, cDNA sequences of NtMAB1-S1 and NtMAB1-T1 were amplified from tobacco cDNA, with full lengths of 1002 bp and 1187 bp, respectively. Analysis of the gene sequences revealed that the N. vulgaris gene copy contained a stop codon, indicating that it is a pseudogene.

[0091] The NtMAB1-S1 gene was subjected to Blast in NCBI and found to have high similarity with the NGAL1 gene in the RAV subfamily of the B3 superfamily in Arabidopsis thaliana and belonged to the RAV family.

[0092] In addition to the B3 domain, RAV family members may also contain an AP2 domain. Sequence alignment of NtMAB1-S1 with several previously reported RAV proteins in Arabidopsis revealed that NtMAB1-S1 does not contain the AP2 domain and the nuclear localization signal NLS; however, the B3 domain is highly conserved among RAV family members; tobacco and Arabidopsis contain a highly conserved transcriptional repression domain (BRD, B3 repression domain), and its key repression region sequence is "R / KLFGV" (e.g. Figure 4 This suggests that the NtMAB1 gene likely functions as a transcriptional repressor.

[0093] Example 4 Construction of tobacco NtMAB1 gene overexpression vector and genetic transformation

[0094] 1. Experimental methods

[0095] (1) Overexpression vector construction

[0096] The strains with correct sequencing results were propagated in a 15 mL sterile centrifuge tube and the plasmids were extracted using the Tiangen high-purity plasmid extraction kit. The extracted plasmids were double-digested. TM 19T restriction site and the restriction site on the overexpression vector pCAMBIA1300-35s, and the restriction sites were determined to be Sal I and BamH I, respectively. TM The 19T vector and the overexpression vector pCAMBIA1300-35s were double-digested using the NEBCutSmart reaction system. The digestion products were analyzed by electrophoresis, and the correct bands were recovered and their concentrations were measured.

[0097] The obtained double-enzyme digested DNA fragment containing the target gene and the double-enzyme digested DNA fragment of the overexpression vector pCAMBIA1300-35s were subjected to an enzyme ligation reaction. After the reaction was completed, the reaction product was transformed into competent E. coli. The transformed E. coli was tested for positive results and sequenced to confirm the success of the transformation.

[0098] (2) Cultivation of sterile tobacco seedlings

[0099] Agrobacterium-mediated genetic transformation of tobacco leaf discs requires sterile tobacco leaves, so prior to transformation, sterile tobacco seedlings must be cultured. In a clean bench, seeds of Honghua Dajinyuan were sterilized and cultured on MS medium at 25°C for approximately 40 days. Sterile seedlings with dark green leaves and robust growth were selected for use.

[0100] (3) Agrobacterium-mediated tobacco leaf disc transformation

[0101] The recombinant vector was transformed into tobacco using the leaf disc method. Hygromycin should be added to the differentiation medium for resistance screening. The operation steps were completely similar to the existing tobacco leaf disc transformation method.

[0102] (4) Positive identification and phenotypic analysis of transgenic tobacco seedlings

[0103] Use a cut pipette tip as a punch to extract 5-7 mm diameter leaf tissue into a 100 μl centrifuge tube. Add 50 μl of Buffer P1 to the tube. Cap the tube and place it in a PCR instrument. Lyse the cells at 95°C for 10 minutes. Add 50 μl of Buffer P2 and pipette to mix thoroughly. The resulting lysate mixture can be used directly as a template for PCR. Design positive identification primers JC-F and JC-R based on the vector fragment and the ligated gene fragment (Table 5).

[0104] Table 5 Primers for positive identification of transgenic seedlings

[0105]

[0106] PCR reaction system:

[0107]

[0108] The PCR reaction procedure is the same as the conventional PCR procedure.

[0109] 2. Experimental results and analysis

[0110] (1) Compared with wild-type HD, 35Spro:NtMAB1 overexpression lines showed phenotypes such as many and long axillary branches, narrow leaves, short plants and late flowering. Among them, the OE-1 type overexpression plants were very consistent with the phenotype of the activation tag insertion mutant mab1. In order to quantitatively analyze the axillary bud phenotypic characteristics of NtMAB1 overexpression plants, the length of axillary buds or branches at each leaf axil of HD and 35Spro:NtMAB1 was measured. The results showed that the phenotypes of 35Spro:NtMAB1 overexpression OE-1 and mab1 in branching were very similar, with a large number of branches and long axillary branches, while the axillary buds at each leaf position of the control HD were shorter and dormant ( Figure 5 AC). Observations of plant height and leaf width of different tobacco plant types revealed that the NtMAB1 overexpressing plant OE-1 had phenotypes similar to those of the mab1 activation tag mutant, with shorter plants and narrower leaves than the control HD. Furthermore, some phenotypes similar to those of OE-2 plants were found in the 35Spro:NtMAB1 overexpressing line. These plants exhibited extreme dwarfing, with longer axillary branches at each leaf position and narrower leaves than those of OE-1. Furthermore, these plants maintained a dwarfed, multi-branched state during subsequent growth ( Figure 5 C).

[0111] (2) At the transcriptional level, the expression of NtMAB1 in the upper and lower axillary branches (or axillary buds) of HD and two 35Spro:NtMAB1 overexpressing lines was detected. It was found that the expression of NtMAB1 in the upper axillary buds of the two overexpressing lines OE-1 and OE-2 was 120 times higher than that of the control HD, and in the lower axillary buds of OE-1 and OE-2, the expression of NtMAB1 was 200 and 120 times higher than that of the control HD, respectively. Figure 5 E, F), and it was also found that in the OE-1 overexpression line, which is similar to the mab1 activation tag mutant phenotype, the expression level of NtMAB1 in the lower axillary buds is twice that in the upper axillary buds, which is consistent with the expression trend of NtMAB1 in the upper and lower axillary buds of mab1. In the OE-2 line, the expression levels of NtMAB1 genes in the upper and lower axillary buds are similar, and there is no situation where the expression level of NtMAB1 genes in the lower axillary buds is higher than that in the upper axillary buds ( Figure 5 E,F).

[0112] BRC1 is a key gene for maintaining axillary bud dormancy. During the phenotypic investigation of HD and overexpression strains, it was found that the axillary buds in the overexpression strains were very active, and axillary buds began to appear in the seedling stage of the plants. In addition, the axillary buds also grew rapidly during the growth of the tobacco plants. This may be due to the inhibition of BRC1 gene expression, which weakened its role in maintaining dormancy. Therefore, the expression level of the BRC1 gene in the axillary buds of the above three strains was detected, and it was found that in the NtMAB1 overexpression tobacco plants, the expression level of the NtBRC1 gene was significantly lower than that of the control HD, and the expression of the NtBRC1 gene was the lowest in the OE-2 strain with the longest axillary bud length ( Figure 6 ).

[0113] Example 5 Effect of RNAi silencing of the NtMAB1 gene on the phenotype of mab1 axillary buds

[0114] 1. Experimental methods

[0115] (1) Construction of RNAi silencing vector

[0116] The principle is: the M1Ri1 and M1Ri2 sequences are ligated into the pUCCRNAi vector twice to form two RNAi silencing vectors with hairpin structures. These two silencing vectors are then ligated with pCAMBIA1300-35S by enzyme digestion to construct an RNAi binary silencing vector.

[0117] A. Preparation of pUCC-Ri1 intermediate vector:

[0118] The primer pairs M1Ri-F1 / R1 and M1Ri-F2 / R2 were used to amplify the 323 bp sequence M1Ri1 and the 545 bp sequence M1Ri2 from the NtMAB1-S1 gene exon.

[0119] The M1Ri1 fragment and pUCC-RNAi vector were double-digested and purified using the endonucleases BamHI and SalI, respectively. The two purified fragments were mixed in equal proportions, ligated with ligase, and transformed into competent Escherichia coli. The cells were cultured overnight in Amp-resistant LB medium, and positive clones were identified using the M1Ri-R1 and Rintron-R1 primer pairs and sent for sequencing to obtain the pUCC-Ri1 intermediate vector.

[0120] B. Preparation of pUCC-M1Ri1 silencing vector:

[0121] The pUCC-Ri1 vector was double-digested with XhoI and BglII, and the fragments were purified. The purified pUCC-Ri1 intermediate vector fragment was ligated with the purified M1Ri1 fragment double-digested with BamHI and SalI to generate the pUCC-M1Ri1 silencing vector. Identification was performed using a primer pair (M1Ri-F1 and M1Ri-R1) with no bands and a primer pair (M1Ri-R1 and Rintron-R1) with bands.

[0122] C. Preparation of pUCC-M1Ri2 silencing vector:

[0123] The same steps as above were used to construct the pUCC-Ri2 vector and the pUCC-M1Ri2 silencing vector for the M1Ri2 fragment. The fragments were identified using the primer pairs M1Ri-F2 and M1Ri-R2 without a band, and M1Ri-R2 and Rintron-R1 with a band.

[0124] D. Construction of binary silencing vector:

[0125] The pUCC-M1Ri1, pUCC-M1Ri2, and pCAMBIA1300-35S vectors were digested and purified using either the PstI or SbfI restriction enzymes. The purified pUCC-M1Ri1 and pUCC-M1Ri2 vector fragments were mixed with the single-enzyme-digested pCAMBIA1300-35S vector in appropriate proportions. After ligation, the cells were transformed into competent E. coli and cultured overnight in Kana-resistant LB medium. The cells were identified using primers M1Ri-R1, M1Ri-R2, and Rintron-R1, respectively. Using these methods, two binary silencing vectors for the NtMAB1 gene were constructed: pCAMBIA1300-35S-M1Ri1 and pCAMBIA1300-35S-M1Ri2.

[0126] (2) Creation of transgenic silenced plants

[0127] Similar to the above, transgenic silenced lines were generated using the Agrobacterium-mediated leaf disc method. Two RNAi vectors were used to transgene the mab1 mutant, silencing the NtMAB1 gene in the mab1 mutant. These transgenic plants were designated M1Ri1m-1,2,…,n (323 bp) and M1Ri2m-1,2,…,n (545 bp), respectively.

[0128] Table 6 Primers for amplification and identification of RNAi silencing fragments

[0129]

[0130] 2. Experimental results and analysis

[0131] (1) After positive transgenic identification and NtMAB1 gene expression level detection, a total of 10 strains with NtMAB1 gene expression levels lower than the mab1 mutant were screened, including 8 M1Ri1m strains and 2 M1Ri2m strains. We selected three strains with lower expression levels, M1Ri1m-29, 35, and M1Ri2m-27, for phenotypic investigation and named them mKD-1, mKD-2, and mKD-3 in subsequent studies.

[0132] (2) The length of axillary buds at different leaf positions in the three strains mKD-1, mKD-2 and mKD-3 was much shorter than that in mab1, and could even be restored to the level of the control group HD ( Figure 7 AC). The expression levels of the NtMAB1 gene in HD, mab1, and three RNAi lines, mKD-1, mKD-2, and mKD-3, were detected. The results showed that the expression levels of the NtMAB1 gene in the axillary buds of the mKD-1 and mKD-2 lines were slightly higher than those in HD and decreased by more than 40 times compared with mab1. However, the expression level of the NtMAB1 gene in the mKD-3 line was lower than that in mab1 and 8 times higher than that in HD ( Figure 7 E, F). These results indicate that axillary bud growth is affected by the expression of the NtMAB1 gene. The expression levels of the NtMAB1 gene in leaves of several mKD lines were detected. The results showed that the expression trend of the NtMAB1 gene in leaves of the three mKD lines was consistent with the results of the detection in axillary buds compared with HD. The expression level of the NtMAB1 gene in mKD-3 was about 10 times higher than that of the wild type, and the expression of the NtMAB1 gene in the other two lines was slightly higher than that of HD ( Figure 7 D) These results indicate that the phenotypes of mab1 in axillary bud growth and leaf development are affected by NtMAB1 gene expression.

[0133] Example 6 Effect of RNAi silencing of the NtMAB1 gene on the phenotype of wild-type axillary buds

[0134] 1. Experimental methods

[0135] The two RNAi vectors (i.e., binary silencing vectors) constructed in Example 5 were separately transferred into HD to silence the NtMAB1 gene in HD. The transgenic lines were named M1Ri1-1, 2, ..., n and M1Ri2-1, 2, ..., n. These transgenic plants were tested for NtMAB1 gene expression and phenotypic analysis.

[0136] 2. Experimental results and analysis

[0137] (1) RNAi transgenic lines were tested for positive PCR, and NtMAB1 gene expression was detected in transgenic positive lines. Ten lines with expression levels lower than HD were selected, including eight M1Ri1 lines and two M1Ri2 lines. Five of these lines had expression levels more than five times lower than HD, and the remaining five lines had expression levels 30-40% of HD. Figure 8 A, B). Five RNAi lines with low expression levels were selected for subsequent experiments. These five transgenic lines, M1Ri1-9, M1Ri1-23, M1Ri1-29, M1Ri2-1, and M1Ri2-4, were named KD-1, KD-2, KD-3, KD-5, and KD-6, respectively.

[0138] (2) The axillary bud lengths of the five RNAi lines and HD at each leaf position during the vigorous growth period were measured. It was found that the five RNAi lines were consistent with HD, with slower axillary bud growth. During the statistical process of axillary bud length measurement, it was found that the axillary bud lengths of the five RNAi lines at each leaf position were shorter than those of the corresponding leaf positions in HD ( Figure 9 A, B, C). qRT-PCR was performed to detect the expression levels of NtMAB1 gene in the upper and lower axillary buds of the five RNAi lines and HD. The results showed that the expression levels of NtMAB1 gene in the upper and lower axillary buds of the five RNAi lines were lower than those in HD ( Figure 9 D, E), the results of the detection of NtMAB1 gene expression levels in leaves were consistent with those in axillary buds. The expression levels of NtMAB1 gene in the five RNAi lines were lower than that in HD, and the expression level of this gene in KD-6 leaves was the lowest ( Figure 9 C) These results indicate that RNAi silencing of the NtMAB1 gene leads to decreased gene expression, which in turn reduces axillary bud activity.

[0139] Example 7 Effect of Tobacco NtMAB1 Gene on Branch Development under Topping Measures

[0140] Topping is a crucial measure in tobacco cultivation to eliminate apical dominance. After topping, the growth of axillary buds affects leaf quality. However, how the NtMAB1 gene in this study responds to topping, its expression after topping, and its regulation of axillary bud growth remain unclear. Therefore, we conducted a quantitative analysis of axillary bud and branch formation in NtMAB1 overexpressing and mutant lines during the vigorous growth phase.

[0141] 1. Experimental methods

[0142] (1) Count the same number of leaves from the bottom upwards and select the appropriate leaf position for topping. Use a ruler to directly measure the length of the axillary buds or branches of each material, and take the average value of 5 plants for each material.

[0143] 2. Experimental results and analysis

[0144] The results showed that the length of axillary buds and branches at each leaf position of different tobacco lines before topping showed the trend of mab1>mKD≥HD>KO-1>KD, and among the KD lines, the length of axillary buds at each leaf position of KD-6 was the shortest ( Figure 10 A, B). HD represents the wild type; mab1 represents a gain-of-function mutant; mKD represents the mab1 mutant silenced by RNAi; KO-1 represents a knockout line derived from wild-type tobacco by knocking out the NtMAB1 gene using CRISPR-Cas9 technology; and kD represents the wild-type plant silenced by RNAi.

[0145] We measured and statistically analyzed the length of axillary buds and branches three and seven days after topping. The results showed that three days after topping, the length of branches at each leaf position in mab1 was the longest. During the analysis, we found that the length trends of axillary buds at each leaf position in HD and other transgenic lines were more complex. The growth length of the upper axillary buds showed opposite trends to that of the lower axillary buds. The length trend of the upper axillary buds in each line was KD / KO-1 ≥ mKD > HD, while the length trend of the lower axillary buds in each line was mKD ≥ HD ≥ KD / KO-1. The growth trend of the lower axillary buds was consistent with the length trend of axillary buds at different leaf positions in each line before topping ( Figure 10 C, D). The quantitative statistical results of axillary buds at different leaf positions of each strain seven days after topping were similar to those of axillary buds three days after topping ( Figure 10 E and F).

[0146] Table 7 Comparison of axillary bud lengths at each leaf position in different strains three days after topping

[0147]

[0148] Note: Bold squares represent axillary buds longer than the HD control. Shaded squares represent axillary buds shorter than the HD control.

[0149] The results in Table 7 above show that within three days of topping, the growth trend of the axillary buds at each leaf position is mab1>mKD≥KD / KO-1≥HD, while within seven days of topping, the growth trend of the axillary buds in the middle and upper parts is mab1>mKD≥KD / KO-1>HD, and the growth trend of the axillary buds in the lower parts is mab1>mKD≥HD>KD / KO-1. Figure 11 .

[0150] The expression levels of NtMAB1 gene in the upper and lower axillary buds of each tobacco line after topping were detected. The results showed that the expression of NtMAB1 gene in the upper and lower axillary buds of different tobacco lines after topping was consistent with the trend before topping, showing that the expression level of NtMAB1 gene in mab1 was higher than that in HD, and the expression level of NtMAB1 gene in KD line was lower than that in HD ( Figure 12 At the same time, it was found that the expression levels of the NtMAB1 gene in the upper and lower axillary buds of mab1 were consistent after topping, which was consistent with the expression of the NtMAB1 gene in the upper and lower axillary buds of OE-2.

[0151] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solutions and concepts of the present invention, and all these changes or substitutions should fall within the scope of protection of the claims attached to the present invention. Sequence Listing <110> Tobacco Research Institute, Chinese Academy of Agricultural Sciences <120> Preparation method of tobacco NtMAB1 gene silenced plant and application of the plant <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1002 <212> DNA <213> NtMAB1-S1 cDNA( NtMAB1-S1 cDNA) <400> 1 atgtccataa accattgtcc ttcacaactt acagaaccat tctggtgtaa aacaaaacaa 60 cattatatca tggaatcaac tagaaaatcc tcatctccaa atcaccaaaa ccaaactaca 120 cctacttctc tctgtcctaa tagcaaccaa ttagaagaaa atgaaatccc aaaagaacac 180 ttgtttgaaa agccattaac accaagcgat gtagggaagc tcaacagatt agtcatccca 240 aaacaacacg cggaaaata cttccctatt aatggtaccc aaaatgactc gggcgaaaag 300 ggatttttac tgaatttcga ggacgagtta gggaaattat ggacttttag atattcatat 360 tggaatagta gtcaaagtta tgttattact aaaggatgga gccgttttgt gaaggagaaa 420 aaattagacg ctggtgattt tattgttt gagcgccacc ggttagacgg cgaccggaca 480 tttattggggt ggaggaggag gataccgcc gctggagcca ccgttttgga gcaagaaagt 540 ggggttgctc cgccgggagg cggtggtggt gggtggggcc aggtgtacta cggtgggtct 600 gggcatcctt atccgtcggc aggtgttcca taccacctg actgtcttca tgcaggaagt 660 aagtaatgc ahaac agcaagcaat ggaaaaac ahagaa agtaggttg 720 tttgggtga acctagcaga gtgcgaggta gatgagtctt cctggtccga accatcgacc 780 tcagatggtt cgtcgacacc gagccaccac cacagagtc atgagtatca gggtcaagct 840 ggccagccgt attaccaata tcaagtccat tgtcccatc ctcctgctgc ctcttcctat 900 gctaaaaata accatcaca taacatgta cgctctttat tttatttt aaactttaac 960 tttctatgg gattataga tatgactaat ttcccactt ga 1002 <210> 2 <211> 1208 <212> DNA <213> NtMAB1-T1 cDNA(NtMAB1-T1 cDNA) <400> 2 atgtccataa accattgttc ttcacaactt acagaaccat tctagtgtac aaaaaacaa 60 cactatatca tggaatcaac aagaaaatcc tcatctccaa cttacaaaaa ccaactaca 120 cctactctc tctgtcctaa tagcaccga ttagaagaa atgaatccc aaagaacgt 180 ttgtttgaga aaccattaac accaagcgat gtagggaagc tcaatagatt agtcatccca 240 aaacaacacg ccgaaaaaca cttccctt aacgggacac aaaatgactc gggcgaaag 300 ggatttttac tgaatttcga ggacgagtta gggaaattat ggacttttag atattcatat 360 tggaatagta gtcaagtta tgtattaca aaaggatgga gccgtttcgt gaaggagaaa 420 aaattagatg ctggtgattt cgttttgttc gagcgccacc ggttagacgg cgaccggaca 480 tttattgggt gaggaggag gaacgccgcc gctggagcca ccgttttgga gcaagaagt 540 ggtattgctc cgccgggagg cggtggtggt gggtggggcc aggtgtacta cggtgggtct 600 gggcatcctt atccgtcggc aggtgttcca taccacctg actgtcttca tgcagtaaga 660 agaacaatgc aaaacaaac agcaagcaat gggaacaa acggagaca agtagattg 720 tttgggtga acctagcaga gtgcgaagta gacgagtctt tgtggtccga accatcgacc 780 tcagatggtt cgtcgacacc gagccaccac cacagagtc atgagtatca gggtcaagct 840 ggccagctac attaccaata tcaagtccat tgttccatc cttctgcgcc tgcctctcc 900 catgctaaaa ataccatca cataacatg gtacgctacg ctctttatt tattatta 960 aactttaatt actttcttat gcactaa aattacagg aattagcaac aaacgctaaa 1020 taaaaaaatc cgttgctaat tctatttagt gataggttag tgatagatta tcaaaaatt 1080 ctgttaataa tttagcgaca aatcaacgac gaaattcata agtaatttca gtttttta 1140 atagtgatgg gattataga tatgactt ccgatttcca actttgatt tcttgttcc 1200 press 1208 <210> 3 <211> 23 <212> DNA <213> NtMAB1S1-F1(NtMAB1S1-F1) <400> 3 cccattgctc tctctctttc cag 23 <210> 4 <211> 25 <212> DNA <213> NtMAB1S1-R1(NtMAB1S1-R1) <400> 4 cctttactat gacctatttc cgatt 25 <210> 5 <211> 25 <212> DNA <213> NtMAB1T1-F1(NtMAB1T1-F1) <400> 5 gctccattta taacccattg ctctc 25 <210> 6 <211> 24 <212> DNA <213> NtMAB1T1-R1(NtMAB1T1-R1) <400> 6 tgtagggcga ctgtagagtt gtgt 24 <210> 7 <211> 333 <212> PRT <213> NtMAB1-S1 protein sequence(protein of NtMAB1-S1 ) <400> 7 Met Ser Ile Asn His Cys Pro Ser Gln Leu Thr Glu Pro Phe Trp Cys 1 5 10 15 Lys Thr Lys Gln His Tyr Ile Met Glu Ser Thr Arg Lys Ser Ser Ser 20 25 30 Pro Asn His Gln Asn Gln Thr Thr Pro Thr Ser Leu Cys Pro Asn Ser 35 40 45 Asn Gln Leu Glu Glu Asn Glu Ile Pro Lys Glu His Leu Phe Glu Lys 50 55 60 Pro Leu Thr Pro Ser Asp Val Gly Lys Leu Asn Arg Leu Val Ile Pro 65 70 75 80 Lys Gln His Ala Glu Lys Tyr Phe Pro Ile Asn Gly Thr Gln Asn Asp 85 90 95 Ser Gly Glu Lys Gly Phe Leu Leu Asn Phe Glu Asp Glu Leu Gly Lys 100 105 110 Leu Trp Thr Phe Arg Tyr Ser Tyr Trp Asn Ser Ser Gln Ser Tyr Val 115 120 125 Leu Thr Lys Gly Trp Ser Arg Phe Val Lys Glu Lys Lys Leu Asp Ala 130 135 140 Gly Asp Phe Ile Leu Phe Glu Arg His Arg Leu Asp Gly Asp Arg Thr 145 150 155 160 Phe Ile Gly Trp Arg Arg Arg Asn Thr Ala Ala Gly Ala Thr Val Leu 165 170 175 Glu Gln Glu Ser Gly Val Ala Pro Pro Gly Gly Gly Gly Gly Gly Trp 180 185 190 Gly Gln Val Tyr Tyr Gly Gly Ser Gly His Pro Tyr Pro Ser Ala Gly 195 200 205 Val Pro Tyr Gln Pro Asp Cys Leu His Ala Gly Ser Arg Val Met His 210 215 220 Lys Gln Thr Ala Ala Asn Gly Asn Asn Thr Arg Arg Gln Val Arg Leu 225 230 235 240 Phe Gly Val Asn Leu Ala Glu Cys Glu Val Asp Glu Ser Ser Trp Ser 245 250 255 Glu Pro Ser Thr Ser Asp Gly Ser Ser Thr Pro Ser His His Gln Gln 260 265 270 Ser His Glu Tyr Gln Gly Gln Ala Gly Gln Pro Tyr Tyr Gln Tyr Gln 275 280 285 Val His Cys Pro Asn Pro Pro Ala Ala Ser Ser Tyr Ala Lys Asn Asn 290 295 300 His His Asn Asn Met Val Arg Ser Leu Phe Tyr Tyr Leu Asn Phe Asn 305 310 315 320 Phe Ser Met Gly Ile Ile Asp Met Thr Asn Phe Pro Leu 325 330 <210> 8 <211> 323 <212> DNA <213> M1Ri1 fragment (gene of M1Ri1) <400> 8 tagaaaatcc tcatctccaa atcaccaaaa ccaaactaca cctacttctc tctgtcctaa 60 tagcaaccaa ttagaagaaa atgaaatccc aaaagaacac ttgtttgaaa agccattaac 120 accaagcgat gtagggaagc tcaacagatt agtcatccca aaacaacacg cggaaaaata 180 cttccctatt aatggtaccc aaaatgactc gggcgaaaag ggatttttac tgaatttcga 240 ggacgagtta gggaaattat ggacttttag atattcatat tggaatagta gtcaaagtta 300 tgtattaact aaaggatgga gcc 323 <210> 9 <211> 32 <212> DNA <213> M1Ri-F1(M1Ri-F1) <400> 9 cgcggatcct agaaaatcct catctccaaa tc 32 <210> 10 <211> 33 <212> DNA <213> M1Ri-R1(M1Ri-R1) <400> 10 acgcgtcgac ggctccatcc tttagttaat aca 33 <210> 11 <211> 545 <212> DNA <213> M1Ri2 fragment (gene of M1Ri2) <400> 11 tgaaaagcca tcaaccaa gcgatgtagg gaagctcaac agattagtca tccaaaaca 60 acacgcggaa aaatacttcc ctattaatgg acccaaat gactcgggcg aaagggatt 120 tttactgaat tcjaggacg ttxgaatt ttacttt ttacttg 180 tagtagtca agttatgtat taactaaagg atggagccgt ttgtgaagg agaaaaaatt 240 agacgctggt gattttattt tgttgagcg ccaccggtta gacggcgacc ggacatttat 300 tgggtggagg aggaggaata ccgccgctgg agccaccgtt tgggagcaag aaagtggggt 360 tgctccgccg ggaggcggtg gtggtggtg gggccaggtg tactacggtg ggtctgggca 420 tccttatccg tcggcaggtg ttccatacca acctgactgt ctcatgcag gaagtagagt 480 aatgcacaaaacaaaaaatgaaaaaaagg agacagta ggttgttttgg 540 gggtga 545 <210> 12 <211> 30 <212> DNA <213> M1Ri-F2(M1Ri-F2) <400> 12 cgcggatcct gaaaagccat taacaccaag 30 <210> 13 <211> 31 <212> DNA <213> M1Ri-R2(M1Ri-R2) <400> 13 acgcgtcgac tcaccccaaa caaccttact t 31 <210> 14 <211> 25 <212> DNA <213> Rintron-R1(Rintron-R1) <400> 14 tgaaacgaat agagtagtac ggtcc 25

Claims

1. Application of a tobacco NtMAB1 gene silenced plant in cultivating tobacco varieties with inhibited axillary bud growth, the preparation method of the tobacco NtMAB1 gene silenced plant comprising the following steps: S1. Using the sequence of the NtMAB1-S1 gene exon gene as a template, primers are designed to obtain the M1Ri1 fragment shown in SEQ ID NO: 8 by PCR amplification; the M1Ri1 fragment and the pUCC-RNAi vector are double-digested, the fragments are purified, and then connected, and the connection products are transformed into Escherichia coli competent cells, positive clones are picked, PCR detection is performed on the positive clones, and the amplified products are sequenced, and the pUCC-Ri1 intermediate vector is extracted from the positive clones with correct sequencing; S2, double-enzyme digestion and fragment purification of the pUCC-Ri1 vector, ligation of the purified pUCC-Ri1 intermediate vector fragment with the double-enzyme digestion and purified M1Ri1 fragment to obtain the pUCC-M1Ri1 silencing vector, and PCR identification of the positive clones; S3, using the sequence of the NtMAB1-S1 gene exon gene as a template, designing primers, and obtaining the M1Ri2 fragment shown in SEQ ID NO: 11 by PCR amplification; the other steps are the same as S1 and S2, constructing the pUCC-Ri2 vector and the pUCC-M1Ri2 silencing vector, transforming competent cells, and performing PCR identification on the positive clones; S4. The pUCC-M1Ri1, pUCC-M1Ri2 and pCAMBIA1300-35S vectors prepared in the above steps are subjected to single restriction digestion and purification respectively; the pUCC-M1Ri1 and pUCC-M1Ri2 vector fragments after restriction digestion and purification are mixed and connected with the pCAMBIA1300-35S vector after single restriction digestion respectively, and the connection products are transformed into competent Escherichia coli, cultured overnight on a resistant medium, and positive clones are identified by PCR; the vector carried by the positive clone is the binary silencing vector of the NtMAB1 gene; S5. The two binary silencing vectors of the NtMAB1 gene, pCAMBIA1300-35S-M1Ri1 and pCAMBIA1300-35S-M1Ri2, constructed successfully in the previous step were transformed into Agrobacterium, and the tobacco NtMAB1 gene silenced plants were obtained by leaf disc infection.

2. The use of the tobacco NtMAB1 gene silenced plant according to claim 1 in cultivating tobacco varieties with inhibited axillary bud growth, characterized in that: In step S1, the M1Ri1 fragment is amplified using the M1Ri-F1 and M1Ri-R1 primer pairs shown in SEQ ID NO: 9 and SEQ ID NO: 10; in step S3, the M1Ri2 fragment is amplified using the M1Ri-F2 and M1Ri-R2 primer pairs shown in SEQ ID NO: 12 and SEQ ID NO:

13.

3. Use of the tobacco NtMAB1 gene silenced plant according to claim 1 or 2 in cultivating tobacco varieties with inhibited axillary bud growth, characterized in that: The primers used to identify the tobacco NtMAB1 gene silenced plants are M1Ri-R1 and Rintron-R1 as shown in SEQ ID NO:10 and SEQ ID NO:14, or M1Ri-R2 and Rintron-R1 as shown in SEQ ID NO:13 and SEQ ID NO:

14.

4. Use of the tobacco NtMAB1 gene silenced plant according to claim 1 or 2 in cultivating tobacco varieties with inhibited axillary bud growth, characterized in that: The identification method of the tobacco NtMAB1 gene silenced plant is as follows: using the extracted genome of the tobacco to be identified as a template, using the primer pair M1Ri-R1 and Rintron-R1 as shown in SEQ ID NO: 10 and SEQ ID NO: 14 or the primer pair M1Ri-R2 and Rintron-R1 as shown in SEQ ID NO: 13 and SEQ ID NO: 14 to perform PCR amplification on two silencing vectors respectively, sequencing the amplified products, and comparing the sequencing results with the sequence of the NtMAB1 gene to obtain the identification result.

Images