Tomato glandular trichome type epidermal hair regulation gene slwrky42 and application thereof

By regulating the overexpression of the tomato glandular trichome gene SlWRKY42, the density of glandular trichomes and the synthesis of terpenoids were increased, which solved the problem of unclear regulatory mechanism of tomato trichomes and improved the insect resistance of the plant.

CN116536332BActive Publication Date: 2026-05-08NORTHWEST A & F UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310523058.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-10
Publication Date
2026-05-08
Estimated Expiration
2043-05-10

AI Technical Summary

Technical Problem

In the existing technology, the multicellular secretory regulatory mechanism of tomato epidermal hairs is unclear, and there is little research on the application of terpene synthesis in pest defense, resulting in insufficient plant resistance to pests.

Method used

We provide the tomato glandular epidermal trichome regulatory gene SlWRKY42 and its overexpression vector. By regulating the expression of the SlWRKY42 gene in tomato plants, we can increase glandular trichome density and promote the synthesis of terpenoids.

Benefits of technology

It significantly increased the density of tomato glandular hairs and the content of terpenoids, improved the plant's insect resistance, reduced reliance on pesticides, and provided a new insect control strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116536332B_ABST
    Figure CN116536332B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of plant molecular biology, and particularly discloses a tomato gland-type epidermal hair regulating gene SlWRKY42 and application thereof, wherein the ORF sequence of the gene SlWRKY42 is shown as SEQ ID NO. 1. By regulating the overexpression of the SlWRKY42 gene in a tomato plant, the density of tomato gland hairs is significantly increased, the transcription and expression of an eneyterpene synthase gene (SlTPS12) and a precursor synthesis pathway transgene are significantly up-regulated, and the content of eneyterpene substances is significantly increased. The gene SlWRKY42 provided by the application can regulate the growth and development of tomato gland-type epidermal hairs, and simultaneously regulate the synthesis of eneyterpene substances.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, specifically to a tomato glandular epidermal trichome regulatory gene SlWRKY42 and its applications. Background Technology

[0002] Tomato (Solanum lycopersicum L.) is a popular economic crop due to its high nutritional value, containing lycopene, carotene, and various vitamins. It is also an important model plant for gene function research. Currently, the growth, development, and regulatory mechanisms of epidermal trichomes in the model plant Arabidopsis thaliana are relatively well understood. However, the epidermal trichomes in Arabidopsis are mostly single-celled, non-secreting types, which differ significantly from those in tomatoes. Tomatoes have various types of epidermal trichomes, among which the regulatory mechanisms of multicellular, secretory epidermal trichomes remain unclear. Non-secreting epidermal trichomes on the surface of tomato plants act as physical barriers to the activity of phytophagous pests, while secretory epidermal trichomes can secrete chemical substances with insect-resistant properties. Therefore, studying the formation and development mechanisms of epidermal trichomes on the leaf surface of this important economic crop, tomato, and the role of epidermal trichomes in insect resistance, is of great significance for enhancing the plant's resistance to biotic stress and providing a novel insect-resistant strategy.

[0003] Terpenes are known to serve as a defense mechanism. Sustainable agricultural development requires that pest control efforts rely on increasing the plant's own defense mechanisms rather than relying on pesticides. WRKY transcription factors play a crucial role in plant responses to biotic and abiotic stresses; however, research on their regulation of epidermal trichome development and terpene synthesis in tomatoes is still limited. Research on genes regulating epidermal trichome formation and terpene synthesis on tomato leaf surfaces is of great significance for applied research on tomato pests and diseases. Summary of the Invention

[0004] To obtain a gene that regulates the formation of epidermal trichomes and the synthesis of terpenoids on the surface of tomato leaves, this invention provides a tomato glandular epidermal trichome regulatory gene SlWRKY42 and its application. The gene SlWRKY42 provided by this invention can regulate the growth and development of tomato glandular epidermal trichomes, and at the same time regulate the synthesis of terpenoids.

[0005] This invention provides a tomato glandular epidermal trichome regulatory gene SlWRKY42, the full-length ORF sequence of which is shown in SEQ ID NO.1.

[0006] The present invention also provides an overexpression vector for the SlWRKY42 gene, wherein the overexpression vector for the SlWRKY42 gene contains the target fragment of the full-length ORF sequence of the SlWRKY42 gene.

[0007] Furthermore, the backbone vector of the overexpression vector of the SlWRKY42 gene is the pHellsgate8 vector.

[0008] This invention also provides a method for constructing an overexpression vector of the SlWRKY42 gene, comprising the following steps:

[0009] S1, using cDNA reverse transcribed from total RNA of tomato tissue as a template, the ORF region of the SlWRKY42 gene was amplified using amplification primers to obtain the target gene fragment;

[0010] S2, the target gene fragment is ligated into a linearized pHellsgate8 backbone vector, and after transformation, the SlWRKY42 gene overexpression vector is obtained.

[0011] Further, in S1, the amplification primers include an upstream primer FW with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer RV with a nucleotide sequence as shown in SEQ ID NO.3.

[0012] The present invention also provides an application of the gene SlWRKY42 in the prevention and control of tomato diseases and pests. The gene SlWRKY42 is used to regulate the growth and development of tomato glandular epidermal hairs and the synthesis of terpenoids to achieve the purpose of preventing and controlling tomato diseases and pests.

[0013] Furthermore, by regulating the overexpression of the SlWRKY42 gene in tomato plants, the density of tomato glandular hairs was increased.

[0014] Furthermore, by regulating the overexpression of the SlWRKY42 gene in tomato plants, the content of terpenoids was increased.

[0015] The present invention also provides an application of the SlWRKY42 gene overexpression vector in the defense against tomato diseases and pests, which achieves the purpose of defending against tomato diseases and pests by regulating the growth and development of tomato glandular epidermal hairs and the synthesis of terpenoid substances.

[0016] This invention provides the application of the tomato glandular epidermal trichome regulatory gene SlWRKY42 or the SlWRKY42 gene overexpression vector in tomato breeding.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] 1. The SlWRKY42 gene provided by this invention can be used to regulate the development of epidermal hairs and the synthesis of terpenoids in tomatoes. By regulating the overexpression of the SlWRKY42 gene in tomato plants, the density of tomato glandular hairs is significantly increased, the transgenic transcriptional expression of the terpenoid synthase gene (SlTPS12) and its precursor pathway is significantly upregulated, and the content of terpenoids is significantly increased. The SlWRKY42 gene knockout line (slwrky42) is also shown to be effective. CR The expression showed an opposite trend to the overexpression line (SlWRKY42-OE), indicating that SlWRKY42 affects the density of glandular hairs and the synthesis of terpenoid compounds in tomatoes. This invention has important guiding significance and application value for reducing the use of harmful pesticides in actual production and for the selection and breeding of tomatoes.

[0019] 2. This invention constructs an overexpression vector WRKY42-pHellsgate8 for the SlWRKY42 gene, which enables overexpression of the SlWRKY42 gene in tomatoes, thereby increasing the number of glandular epidermal hairs in tomato plants. After transformation, transgenic tomatoes are obtained. The results show that the relative expression level of SlWRKY42 is significantly increased, and the number of glandular epidermal hairs in plants overexpressing SlWRKY42 is significantly greater than that in control AC plants. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The results show the transcriptional expression levels of the SlWRKY42 gene in the transgenic line (WRKY42-OE) and the wild-type plant (AC).

[0022] Figure 2 The plants were classified as wild-type (AC), transgenic line (WRKY42-OE), and SlWRKY42 gene knockout line (slwrky42). CR The results of transcriptional expression testing of the terpene synthase gene SlTPS12.

[0023] Figure 3 The plants were wild-type (AC), transgenic line (WRKY42-OE), and SlWRKY42 gene knockout line (slwrky42). CR Comparison results of leaf and stem glandular epidermal hairs;

[0024] In the figure, a represents the wild-type plant (AC), the transgenic line (WRKY42-OE), and the SlWRKY42 gene knockout line (slwrky42). CR Comparison results of glandular epidermal trichomes on leaves;

[0025] b represents wild-type plants (AC), transgenic lines (WRKY42-OE), and SlWRKY42 gene knockout lines (slwrky42). CR Comparison results of epidermal hairs of the stem gland type.

[0026] Figure 4 The plants were wild-type (AC), transgenic line (WRKY42-OE), and SlWRKY42 gene knockout line (slwrky42). CR Leaf terpene content;

[0027] In the figure, a represents the wild-type plant (AC), the transgenic line (WRKY42-OE), and the SlWRKY42 gene knockout line (slwrky42). CR Comparison of α-Humulene content in leaves;

[0028] b represents wild-type plants (AC), transgenic lines (WRKY42-OE), and SlWRKY42 gene knockout lines (slwrky42). CR Comparison of leaf terpenoid (4-Carene) content.

[0029] Figure 5 Insect resistance of leaves of transgenic line (WRKY42-OE) and wild-type plant (AC);

[0030] In the figure, a represents the insect resistance of the leaves of the wild-type plant (AC);

[0031] b shows the insect resistance of leaves from the transgenic line (WRKY42-OE). Detailed Implementation

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0033] This invention provides a tomato glandular epidermal trichome regulatory gene SlWRKY42 and its application.

[0034] The ORF sequence of the gene SlWRKY42 is shown in SEQ ID NO.1. By regulating the overexpression of the SlWRKY42 gene in tomato plants, the density of tomato glandular trichomes significantly increased, the transgenic transcriptional expression of the terpene synthase gene (SlTPS12) and its precursor pathway was significantly upregulated, and the content of terpene substances significantly increased. The gene SlWRKY42 provided by this invention can regulate the growth and development of tomato glandular epidermal trichomes and simultaneously regulate the synthesis of terpene substances.

[0035] Example 1: SlWRKY42 gene overexpression vector and its construction method.

[0036] I. Cloning of the SlWRKY42 gene

[0037] 1. Using primers FW (nucleotide sequence shown in SEQ ID NO.2) and RV (nucleotide sequence shown in SEQ ID NO.3), the SlWRKY42 gene was cloned using cDNA reverse transcribed from total RNA of various tissues (roots, stems, leaves, flowers, and fruits) of cultivated tomato Ailsa Craig (abbreviated as "AC", purchased from the Tomato Genetic Resource Center TGRC (https: / / tgrc.ucdavis.edu / )) as a template. The PCR amplification system is shown in Table 1, and the PCR amplification program is shown in Table 2. The target fragment was obtained. After amplification, the target fragment was recovered by gel excision.

[0038] SEQ ID NO.2:

[0039] 5'-CATTTGGAGAGGACACGCTCGAGATGGAGAAAGTTAAAGTTTGGAAT-3';

[0040] SEQ ID NO.3:

[0041] 5'-TCTCATTAAAGCAGGACTCTAGAGGTGAAATATTCAGAAATGTCGAT-3'.

[0042] Table 1 PCR amplification system

[0043] Element Volume (total 50 μL) 2X Phanta Max Buffer 25 Phanta Max Super-Fidelity DNA Polymerase 1 dNTP Mix (10 mmol / L) 1 FW (10 μmol / L) 2 RV (10 μmol / L) 2 Template DNA 1 <![CDATA[ddH2O]]> 18

[0044] Table 2 PCR amplification program

[0045]

[0046] II. SlWRKY42 gene overexpression vector and its construction method

[0047] The pHellsgate8 vector (gifted by the College of Horticulture, Huazhong Agricultural University) was double-digested with XhoI and XbaI, and the linearized vector was recovered by gel digestion. Homologous recombination was performed on the recovered target fragment and the linearized vector. The concentrations of the inserted fragment and the linearized vector were adjusted. The homologous recombination system was a 10 μL system: 2 μL of 5X CE II Buffer, 1 μL of Exnase II, 3 μL of the target fragment, and 2 μL of the linearized vector, with the remainder made up using dd H2O. All components (reaction solutions) were added in sequence, and the reaction solution was gently aspirated and mixed. The system was then placed in a PCR instrument and reacted at 37°C for 30 min for homologous recombination.

[0048] The ligation product was transferred into E. coli, and the E. coli clones with correct sequencing results were amplified. The plasmid was extracted using a DNA mini-extraction kit to obtain the overexpression vector WRKY42-pHellsgate8 for the WRKY42 gene.

[0049] For the positive detection of Escherichia coli, Taq-PCR was used with primer pairs containing SEQ ID NO.4 and SEQ ID NO.5. The Taq-PCR detection system is shown in Table 3, and the Taq-PCR reaction procedure is shown in Table 4.

[0050] SEQ ID NO.4: 5'-ACGCACAATCCCACTATCCTTC-3';

[0051] SEQ ID NO. 5: 5'-TTAGGTGAAATATTCAGAAATGTCG-3'.

[0052] Table 3 Taq-PCR detection system

[0053]

[0054]

[0055] Table 4 Taq-PCR reaction procedure

[0056]

[0057] Example 2: Genetic transformation for overexpression of the SlWRKY42 gene.

[0058] I. Obtaining positive transgenic lines through genetic transformation for overexpression of the SlWRKY42 gene

[0059] The specific steps are as follows:

[0060] 1. Transform the correctly sequenced recombinant vector into Agrobacterium competent cells (C58) for later use.

[0061] 2. Agrobacterium containing the WRKY42-pHellsgate8 vector was used to infect cotyledonary explants of tomato variety AC.

[0062] 3. Dark culture of infected explants.

[0063] 4. Select explants until callus tissue grows.

[0064] 5. Callus continues to grow until a growth point emerges.

[0065] 6. Transfer the newly grown growth points to the rooting medium to allow them to root.

[0066] 7. After rooting, the plants are transplanted into nutrient soil to grow, resulting in positive transgenic lines;

[0067] DNA was extracted from the positive transgenic lines, and PCR was performed using sequencing primer pairs (sequences shown in SEQ ID NO.4 and SEQ ID NO.5). If the PCR product bands matched the length of the SlWRKY42 gene, then the positive transgenic lines were successfully constructed.

[0068] Three positive transgenic lines (overexpression lines) were constructed using the above method and were designated as WRKY42-OE-3, WRKY42-OE-5, and WRKY42-OE-22, respectively.

[0069] The methods for extracting DNA from plant tissues are as follows:

[0070] (1) Take 0.1g of tender leaves of the plant seedlings and put them into a 2mL centrifuge tube. Grind them in about 750μL of CTAB extraction solution (with β-mercaptoethanol added). After grinding, place them in a 65℃ water bath for more than half an hour.

[0071] (2) After the water bath, add about 750 μL of a mixture of chloroform and isoamyl alcohol (volume ratio of 24:1) to the centrifuge tube, invert it 100 times, and centrifuge at 10000 r / min for 10 min.

[0072] (3) Take 450-500 μL of the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of cold isopropanol, mix well and place in a -20℃ freezer. After 10 min, centrifuge at 12000 r / min for 10 min.

[0073] (4) Discard the supernatant, add 800 μL of 75% ethanol to wash the precipitate, centrifuge briefly, discard the ethanol, and dry until colorless and transparent;

[0074] (5) Add 200 μL ddH2O (the amount varies depending on the purpose) to dissolve the DNA and store at -20℃ for later use.

[0075] In this embodiment, the positive transgenic lines and Agrobacterium tumefaciens were detected using Taq-PCR. The nucleotide sequences of the primer pairs used for detection are shown in SEQ ID NO.4 and SEQ ID NO.5. The Taq-PCR detection system is shown in Table 3, and the Taq-PCR reaction procedure is shown in Table 4.

[0076] The sequence of the sequencing fragment of the positive transgenic line is shown in SEQ ID NO.1:

[0077] SEQ ID NO.1:

[0078] atggagaaagttaaagtttggaataaagaaagtctaattactgagcttactcaagggaaagagtttgtaaaccaatttgatcctctggcttcaccagaggaaaatgattttcttcttgagaaaatactttcctctatagacaaatcattgtcaattttgaattgtgaagtttataatggaacaaatgatccttttcctttgagggatcaaggccaaaataagaaaagaaagaaaatgcagcaatggagcaaacaagttagagtacatgggacagagcttgaaagttttaatcatgatgatggttatagttggagaaaatatgggcaaaaaaacattttaggagctattcatccaagggcttattataggtgcactcacaggaatacacaaggctgcttagcaacaaaacaagttcaaaaatcagaacaagatcctttagtctttgatgtgacatataaaggaatgcatagttgcaaaacctcacactcatcaacattcatttcatatgaaaagcaaaagccaaatcagtgtcaaataaagaaacaaagagttgaaaacttgaatacaatcaaagaagaaactgttcctttcactccactacaatgtgaaagccacaatgcccaatgctttgtcaattccatagagccacttgcatcagaatccatgtacttatcattgttgccatatcaagaagaggagtttgagatggacaagattcttcagagctcagaatcggatcgtattgtgttcagctcaacaccaacttcaataattgattcgccattttctagagattgggatttatcagtgaatgatcaacttgatgttcatgatcctaacttgatgatcgacatttctgaatatttcacctaa

[0079] Example 3: Testing and application of SlWRKY42 gene expression.

[0080] I. Detection of SlWRKY42 gene expression level in positive transgenic lines (WRKY42-OE-3, WRKY42-OE-5, and WRKY42-OE-22)

[0081] RNA was extracted from young leaves of transgenic plants, reverse transcribed, and then its expression level was determined.

[0082] 1. RNA extraction method:

[0083] (1) Grind plant tissue with liquid nitrogen, take about 100 mg of sample into a 2.0 mL centrifuge tube frozen with liquid nitrogen, add 1 mL of Trizol and extract by inversion for a few minutes, then let stand for 5 min;

[0084] (2) Add 200 μL of chloroform, extract by vigorous inversion for 15 seconds, and let stand at room temperature for 2-3 minutes;

[0085] (3) Centrifuge at 4℃ and 13000r / min for 10min;

[0086] (4) Transfer 300-400 μL of supernatant to a new 1.5 ml centrifuge tube (try not to aspirate the lower layer; reduce the amount of supernatant to maintain purity), add an equal volume of ice-cold isopropanol (placed at -20℃), invert to mix, and place at -20℃ for 10 min.

[0087] (5) Centrifuge at 4℃ and 13000r / min for 10min;

[0088] (6) Discard the supernatant, add 1 mL of 75% ethanol (diluted with DEPC water), and suspend the precipitate;

[0089] (7) Centrifuge at 12000 r / min for 1 min;

[0090] (8) Discard the supernatant (6 and 7 can be repeated once to improve RNA purity), and place the centrifuge tube in a fume hood to air dry for 5-10 minutes;

[0091] (9) Add about 20 μL of DEPC water (adjust the amount according to the amount of extracted RNA) to dissolve;

[0092] (10) RNA quality was detected by agarose gel electrophoresis, and RNA concentration was determined by absorbance method. Then it was stored at -80℃ for later use.

[0093] 2. RNA reverse transcription step:

[0094] Based on the determined concentration of the RNA samples, the RNA samples were uniformly diluted to a specific concentration using DEPC water. Reverse transcription was then performed using a reverse transcription kit. The reverse transcription process is as follows:

[0095] 1) Genomic DNA removal

[0096] Prepare the following mixture in RNase-free centrifuge tubes (formulations are shown in Table 5):

[0097] Table 5 Mixture Formulation

[0098] <![CDATA[RNase-free ddH2O]]> to 16μL 4X gDNAwiper Mix 4μL Oligo(dT)23VN(50μM) 1μL Random hexamers (50 ng / μl) 1μL Total RNA 10pg-5μg or RNA with ployA 10pg-500ng

[0099] After gently mixing with a pipette, place in a PCR instrument at 42°C for 2 minutes.

[0100] 2) First-strand cDNA synthesis

[0101] Add 2 μL of 10X RT Mix and 2 μL of HiScript II Enzyme Mix to the previous mixing solution.

[0102] Gently pipette the mixture and place it in the PCR instrument. Set the PCR instrument reaction program as follows: 50℃, 15 min; 85℃, 2 min.

[0103] The product can be used immediately for qPCR after the reaction procedure is completed, or stored at -20℃.

[0104] 3. Determination of the relative expression level of SlWRKY42

[0105] The relative expression level of SlWRKY42 was determined using the selected internal reference gene, Solyc03g078400. The upstream primer for detecting the internal reference gene was Q_FW (gene sequence shown in SEQ ID NO. 6), and the downstream primer was Q_RV (gene sequence shown in SEQ ID NO. 7). The upstream primer sequence for detecting SlWRKY42 gene expression was shown in SEQ ID NO. 8, and the downstream primer sequence was shown in SEQ ID NO. 9. The relative gene expression level was measured using conventional methods in the art. The reaction system is shown in Table 6.

[0106] SEQ ID NO.6:5'-GGGATGGAGAAGTTTTGGTGGTGG-3';

[0107] SEQ ID NO. 7: 5'-CTTCGACCAAGGGATGGTGTAGC-3'.

[0108] SEQ ID NO.8: 5'-GCAAAAGCCAAATCAGTGTCA-3';

[0109] SEQ ID NO. 9: 5'-AAGCATTGGGCATTGTGGC-3'.

[0110] Table 6. Relative expression levels of SlWRKY42 in the reaction system.

[0111] 10μL SYBR mix(2x) 5 Q_Fw(10μmol / L) 0.4 Q_Rv(10μmol / L) 0.4 cDNA (80-200 ng / μl) 4.2

[0112] The SYBR mix system is shown in Table 7;

[0113] Table 7 SYBR mix system formulation

[0114] 5ml Remark 10X PCR Buffer 1ml 100mM dNPs 120μl SYBR 333μl Store away from light <![CDATA[ddH2O]]> 3.45ml EASY-Taq (5U / μl) 100μl Add 0.1g per hole when using.

[0115] II. Expression of the terpene synthase gene SlTPS12 in different plants

[0116] Wild-type plants (AC), transgenic lines (WRKY42-OE), and SlWRKY42 gene knockout lines (slwrky42) were compared. CR When the cells reached the five-leaf stage, RNA was extracted from the third leaf and reverse transcribed into cDNA to determine the expression level of the terpene synthase gene SlTPS12. The upstream primer sequence for detecting SlTPS12 gene expression was SEQ ID NO.10, and the downstream primer sequence was SEQ ID NO.11. The reaction system is shown in Tables 6 and 7.

[0117] SEQ ID NO.10: 5'-CGTTACTGGTTGAGTCTGTCG-3'

[0118] SEQ ID NO.11: 5'-CTTGATTATTTGAAATATTCCGGAGG-3'

[0119] III. Changes in the number of glandular epidermal hairs in positive transgenic lines

[0120] 1. SlWRKY42 gene knockout line (slwrky42) CR ) Build:

[0121] The target sequence (TTCTGATGTCGTCGTCGCTACGG) was designed using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). After annealing, the synthesized target sequence was ligated to the Bbs I site of the vector AtU6-sg RNA-AtUBQ-Cas9. The resulting AtU6-sg RNA-AtUBQ-Cas9 fragment was then ligated to the Hind III / Kpn I site of the plant transformation vector pCAMBIA1301. Finally, the resulting plasmid was transformed into Agrobacterium tumefaciens strain EHA105. Subsequently, tomato cotyledons were transformed using Agrobacterium-mediated transgenic methods to obtain regenerated seedlings. Through self-pollination, tomato plants that had isolated Cas9 were selected from the F1 generation and sequenced. Based on sequence alignment analysis and sequencing results, three homozygous wrky42 sequences were obtained. CR The mutant strain used in the experiment was wrky42. CR -1,wrky42 CR -3,wrky42 CR -18, of which wrky42 CR -1 indicates a missing base at the target site, wrky42 CR -3 has one base inserted at the target site, wrky42 CR -18, a two-base deletion at the target site, caused a frameshift mutation in all three strains, leading to premature translation termination. Background material is by Ailsa Craig.

[0122] Ultimately, three SlWRKY42 gene knockout lines were obtained, which are wrky42. CR -1,wrky42 CR -3, Wwrky42 CR -18.

[0123] Wild-type tomato plants (AC), positive transgenic lines WRKY42-OE (WRKY42-OE-3, WRKY42-OE-5 and WRKY42-OE-22), and the SlWRKY42 gene knockout line obtained above (slwrky42) were used to compare the results. CR The number of glandular epidermal trichomes was observed under a stereomicroscope (MZ10F) at 8X magnification, and the number of glandular epidermal trichomes was analyzed using ImagJ software. IV. Changes in the content of terpenoids in positive transgenic lines.

[0124] Wild-type tomato (AC) and SlWRKY42 gene knockout line (slwrky42) were respectively taken. CRTomato leaves from the third leaf position of the positive transgenic lines WRKY42-OE (WRKY42-OE-3, WRKY42-OE-5, and WRKY42-OE-22), weighing 1g each, were flash-frozen in liquid nitrogen and ground. The content of terpenoids was then determined using ultra-high performance liquid chromatography (GC-MS). The terpenoids included α-Humulene and 4-Carene.

[0125] V. Insect resistance of leaves from different plants

[0126] To investigate the effect of SlWRKY42 gene overexpression on insect resistance in tomato leaves, this study selected wild-type tomato lines (AC) and the positive transgenic line WRKY42-OE (WRKY42-OE-3) after they reached the five-leaf stage and placed them at the same distance in greenhouse D03 of the South Campus of Northwest A&F University for a natural insect resistance experiment. The whitefly infestation status of each line was observed daily. After three weeks of natural infection, the third leaf of both wild-type (AC) and positive transgenic lines WRKY42-OE (WRKY42-OE-3) was examined under a stereomicroscope (MZ10F) at 8X magnification, primarily observing the number of whiteflies on the leaf surface.

[0127] VI. Experimental Results

[0128] 1. Relative expression level of the SlWRKY42 gene

[0129] Test results as follows Figure 1 As shown, the relative expression level of the SlWRKY42 gene in the transgenic lines WRKY42-OE (WRKY42-OE-3, WRKY42-OE-5, and WRKY42-OE-22) was significantly increased compared to the wild-type plant (AC); and compared to the SlWRKY42 gene knockout line slwrky42... CR Compared with (WRKY42-CR-1, WRKY42-CR-3 and WRKY42-CR-18), the relative expression level of the SlWRKY42 gene in the transgenic lines was significantly increased. The specific relative expression level of the SlWRKY42 gene is shown in Table 8.

[0130] Table 8. Results of relative expression level test of SlWRKY42 gene

[0131] Plant number average value Standard deviation (SD) AC 1 0.141 WRKY42-OE-3 19.311 1.421 WRKY42-OE-5 22.236 2.830 WRKY42-OE-22 24.428 1.426 WRKY42-CR-1 0.1078 0.029 WRKY42-CR-3 0.1634 0.055 WRKY42-CR-18 0.1151 0.021

[0132] 2. Expression of the terpene synthase gene SlTPS12 in different plants

[0133] The results are as follows Figure 2As shown, the expression level of the SlTPS12 gene in the transgenic line (WRKY42-OE) was significantly higher than that in the wild-type plant (AC), and the expression level of the SlTPS12 gene in the wild-type plant (AC) was significantly higher than that in the SlWRKY42 gene knockout line (slwrky42). CR ).

[0134] 3. Statistical analysis of the number of epidermal hairs in the transgenic line WRKY42-OE with glandular type.

[0135] The number of glandular epidermal hairs in positive transgenic lines was detected, and the results were as follows: Figure 3 As shown in Tables 9 and 10, a is a detection image of leaf glandular epidermal hairs and b is a detection image of stem glandular epidermal hairs.

[0136] Table 9. Statistical results of epidermal hairs on type VI glands in tomato stems.

[0137] Plant number <![CDATA[Average value (0.5mm 2 )]]> Standard deviation (SD) AC 21.241 1.472 WRKY42-OE-3 47.335 1.118 WRKY42-OE-5 42.513 0.741 WRKY42-OE-22 40.166 1.815 WRKY42-CR-1 11.532 1.884 WRKY42-CR-3 13.127 2.950 WRKY42-CR-18 15.373 2.181

[0138] Table 10 Statistical results of epidermal hairs on type VI glands in tomato leaves

[0139] Plant number <![CDATA[Average value (0.5mm 2 )]]> Standard deviation (SD) AC 17.257 1.472 WRKY42-OE-3 51.332 2.857 WRKY42-OE-5 54.135 2.829 WRKY42-OE-22 56.711 2.241 WRKY42-CR-1 4.677 0.720 WRKY42-CR-3 3.259 0.409 WRKY42-CR-18 5.136 0.799

[0140] According to Tables 9-10 and Figure 3 The results showed that the number of glandular epidermal hairs in plants overexpressing SlWRKY42 was significantly increased compared to the control AC plants, indicating that the SlWRKY42 gene can promote the growth and development of tomato glandular hairs and increase their density.

[0141] 4. Effects of the SlWRKY42 gene on the content of terpenoids in tomato plants

[0142] Gas chromatography (GC-MS) was used to determine the genetic characteristics of wild-type tomato (AC) and the SlWRKY42 gene knockout line (slwrky42). CR The content of terpenoids in the positive transgenic lines WRKY42-OE and WRKY42-OE was measured. The content of terpenoids in the positive transgenic lines WRKY42-OE-3, WRKY42-OE-5 and WRKY42-OE-22 was measured and the average value was taken. The content of terpenoids in the SlWRKY42 gene knockout lines WRKY42-CR-1, WRKY42-CR-3 and WRKY42-CR-18 was measured and the average value was taken.

[0143] The results are as follows Figure 4As shown, the contents of α-Humulene and 4-Carene in the positive transgenic line WRKY42-OE were significantly higher than those in wild-type tomato (AC) and the SlWRKY42 gene knockout line (slwrky42). CR This indicates that the SlWRKY42 gene can promote the synthesis of terpenoid compounds.

[0144] 5. Insect resistance of leaves from different plants

[0145] The results are as follows Figure 5 As shown in Figure a, wild-type tomatoes are susceptible to whitefly infestation due to the sparse number of glandular epidermal hairs and the reduced content of terpenoids in their leaves. In Figure b, the WRKY42-OE (WRKY42-OE-3) strain has an increased number of glandular epidermal hairs and a higher content of terpenoids in its leaves, resulting in a significant reduction in the number of whiteflies.

[0146] Therefore, the insect resistance of the leaves of the transgenic tomato line (WRKY42-OE) was significantly better than that of the wild-type line. This indicates that overexpression of the SlWRKY42 gene can increase the insect resistance of tomatoes.

[0147] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0148] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A kind SlWRKY42 The application of genes in the prevention and control of tomato diseases and pests is characterized by, Through regulation SlWRKY42 The gene is overexpressed in tomato plants, increasing the density of tomato glandular hairs and regulating... SlWRKY42 The gene is overexpressed in tomato plants, promoting an increase in the content of terpenoids to achieve the purpose of defending against tomato pests and diseases, namely, whiteflies; the gene... SlWRKY42 The full-length ORF sequence is shown in SEQ ID NO.

1.

2. A kind SlWRKY42 The application of gene overexpression vectors in the prevention and control of tomato diseases and pests is characterized by, The purpose of preventing tomato diseases and pests is to promote the growth and development of glandular epidermal hairs and the synthesis of terpenoids in tomatoes. The tomato disease and pest is the whitefly. SlWRKY42 Gene overexpression vectors are composed of SlWRKY42 The gene was obtained by ligating it into the pHellsgate8 backbone vector; the gene SlWRKY42 The full-length ORF sequence is shown in SEQ ID NO.

1.

3. A gene regulating the glandular epidermal trichomes of tomatoes SlWRKY42 or the aforementioned SlWRKY42 The application of gene overexpression vectors in tomato breeding is characterized by, The gene SlWRKY42 The full-length ORF sequence is shown in SEQ ID NO.

1. SlWRKY42 Gene overexpression vectors are composed of SlWRKY42 The gene was obtained by ligating it into the pHellsgate8 backbone vector. SlWRKY42 Gene or SlWRKY42 Gene overexpression vectors are used to promote the growth and development of tomato epidermal hairs and the secretion of terpenoids.

Citation Information

Patent Citations

  • Application of SlWRKY30 protein in regulation and control of tomato tissue H2O2 accumulation and cell necrosis

    CN116082477A

  • Tomato WRKY transcription factor gene, protein coding sequence and application

    CN116590309A

  • Application of tomato SlAVT6B gene in regulating amino acid transport to affect tetranychus cinnabarinus resistance of tomato

    CN119876240A