A fully enclosed biodetection microfluidic chip and its application method
The fully enclosed biodetection microfluidic chip solves the problems of scenario applicability and contamination risk of existing biodetection through integrated operation and automated sample transfer, and realizes rapid and simplified nucleic acid detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING GENXIN TECH CO LTD
- Filing Date
- 2023-11-02
- Publication Date
- 2026-05-26
Smart Images

Figure CN117483017B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical detection, specifically relating to a fully enclosed biodetection microfluidic chip and its application method. Background Technology
[0002] Currently, the process of disease diagnosis using biological detection includes sample collection, storage and transportation, and laboratory testing. Sample pretreatment, analyte extraction, and detection are all completed in the laboratory. The process is complex, especially the sample pretreatment, which has stringent requirements. Therefore, it places strict demands on the operating environment and personnel. On the one hand, it needs to be completed in a dedicated laboratory; on the other hand, it requires specialized operators. These limitations restrict the application of biological detection methods in different scenarios.
[0003] Conventional biological testing has the following shortcomings: 1. Samples and reagents need to be manually mixed and added to the instrument, which poses a risk of contamination; 2. Experiments need to be conducted in different areas, which places strict requirements on the site; 3. Experiments are complex and involve many steps, requiring trained professional operators to carry out the tests.
[0004] Meanwhile, the existing laboratory nucleic acid testing steps are divided into sample pretreatment, nucleic acid extraction, nucleic acid amplification and detection. The operation process is complex and involves sample pretreatment, nucleic acid amplification and detection. Therefore, it puts forward strict requirements on the operating environment and personnel. A fully enclosed nucleic acid testing environment can expand the operation scenario of nucleic acid testing and facilitate the rapid and efficient completion of nucleic acid testing.
[0005] Microfluidic chip technology integrates sample preparation, enrichment, reaction, separation, and detection units in biological, chemical, and medical analysis processes onto a single chip through microscale fluid control. It features miniaturization, low cost, controllable fluid dynamics, low reagent consumption, high analysis speed, and ease of integration and scalability, and has been widely applied in biological and medical research. Through the design of various structural units, such as microvalves, micropumps, and concentration gradient generators, it is possible to better simulate the in vivo physiological environment, enabling the integration of various cell culture studies for automated analysis.
[0006] Therefore, there is an urgent need for a fully enclosed biological detection chip that integrates operations, reduces manual intervention, and improves detection efficiency. Summary of the Invention
[0007] To overcome the problems of existing technologies, this invention provides a fully enclosed bio-detection microfluidic chip and its application method. The internal environment of the microfluidic chip is isolated from the external environment. After adding a sample, there is no need to open the cap again, eliminating the risk of contamination, shortening the detection time, improving detection efficiency, and featuring multi-detection capabilities.
[0008] This invention provides the following technical solutions:
[0009] A fully enclosed microfluidic chip for biodetection includes a base plate, a liquid storage rotor, and a top cover. The base plate has a biodetection reaction chamber and several channels. The biodetection reaction chamber is pre-sealed with the reaction reagents required for biodetection. The liquid storage rotor has several cavities, and the bottom of each cavity has a liquid outlet channel. Biodetection samples are added to the cavities and transferred through the cavities. A piston is provided in each cavity. The top cover has protrusions corresponding to the positions of the channels. A motor drives the liquid storage rotor to rotate. When the piston rod passes through the protrusions on the top cover, it drives the piston to move within the cavities, pushing the liquid to transfer, so that the biodetection sample completes biodetection within the biodetection reaction chamber.
[0010] Furthermore, the cavity includes a sample cavity and a transfer cavity. The piston in the sample cavity is connected to a detachable push rod. The bottom plate is provided with a transfer channel that corresponds to the position of the liquid outlet channel of the sample cavity and the transfer cavity. The piston in the transfer cavity is connected to a flat-head piston rod. The bottom plate is provided with a sample inlet channel that can communicate with the biodetection reaction chamber. The top cover is provided with a sloping protrusion at the position corresponding to the sample inlet channel. The top cover is also provided with a sealing cap to seal the sample cavity.
[0011] Furthermore, the piston inside the sample chamber is connected to a flat-headed piston rod, and the top cover is provided with a sloping protrusion that corresponds to the position of the transfer channel.
[0012] Furthermore, the cavity also includes an overflow cavity, which is connected to the sample cavity through an overflow channel. The overflow channel is a sloping channel with the sample cavity end higher than the overflow cavity end. The opening height of the overflow channel on the sample cavity is 3-4 mm, and the diameter of the sample cavity is 8-10 mm.
[0013] Furthermore, the sample inlet channel is connected to the main liquid channel, and the main liquid channel is connected to the biodetection reaction chamber through branch liquid channels. The branch liquid channels are divided into inlet branch channels and outlet branch channels. The liquid in the biodetection reaction chamber enters from the bottom and exits from the top. The upper end of the biodetection reaction chamber is a slope, and the top of the slope converges at the port of the drain pipe. The drain pipe is connected to the outlet branch channel.
[0014] Furthermore, the lower port of the drain pipe is connected to the breathable membrane on the chip substrate.
[0015] A method for biological detection using a fully enclosed biodetection microfluidic chip, characterized by comprising the following steps:
[0016] Step 1: The biological sample liquid to be tested is added into the sample chamber, and the transfer channel is connected to the liquid outlet channel of the sample chamber and the liquid outlet channel of the transfer chamber.
[0017] Step 2: Press down the push rod connected to the piston in the sample chamber. The biological sample liquid to be tested in the sample chamber is pressed into the transfer chamber through the transfer channel. The piston in the transfer chamber is pushed up, and the excess liquid flows into the overflow chamber through the overflow groove.
[0018] Step 3: The storage rotor rotates, and the liquid outlet of the transfer chamber is connected to the sample inlet channel. When the piston in the transfer chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the liquid of the biological sample to be tested in the transfer chamber is forced into the sample inlet channel.
[0019] Step 4: The biological sample liquid to be tested enters the biological detection reaction chamber through the liquid path, and undergoes a biological reaction with the pre-sealed reaction reagent in the reaction chamber to complete the biological detection.
[0020] A method for biological detection using a fully enclosed biosensing microfluidic chip includes the following steps:
[0021] Step 1: Add the liquid biological sample to be tested into the sample chamber, rotate the liquid storage rotor, and connect the transfer channel with the liquid outlet channel of the sample chamber and the liquid outlet channel of the transfer chamber.
[0022] Step 2: When the flat-headed piston rod connected to the piston in the sample chamber is pressed down by the inclined protrusion on the top cover, the biological sample liquid to be tested in the sample chamber is pressed into the transfer chamber through the transfer channel, the piston in the transfer chamber is pushed up, and the excess liquid flows into the overflow chamber through the overflow groove.
[0023] Step 3: The storage rotor rotates, and the liquid outlet of the transfer chamber is connected to the sample inlet channel. When the piston in the transfer chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the liquid of the biological sample to be tested in the transfer chamber is forced into the sample inlet channel.
[0024] Step 4: The biological sample liquid to be tested enters the biological detection reaction chamber through the liquid path, and undergoes a biological reaction with the pre-sealed reaction reagent in the reaction chamber to complete the biological detection.
[0025] A fully enclosed biodetection microfluidic chip, the cavity including a lysis chamber, a sample loading chamber and a mixing chamber, the bottom plate is provided with a lysis buffer transfer channel that corresponds to the liquid outlet channel of the sample loading chamber and the lysis chamber, the piston in the lysis chamber is connected to a flat-head piston rod, and the top cover is provided with a sloping protrusion at the position corresponding to the lysis buffer transfer channel.
[0026] The base plate is provided with a sample transfer channel that corresponds to the position of the liquid outlet channel of the sample addition chamber and the mixing chamber. The piston in the mixing chamber is connected to the ball-head piston rod. The top cover is provided with a sloping groove-shaped protrusion at the position corresponding to the sample transfer channel.
[0027] The base plate is equipped with a sample inlet channel that can communicate with the biodetection reaction chamber. The sample inlet channel and the lysis buffer transfer channel are concentric arc-shaped channels. The sample inlet channel can correspond to the position of the inclined protrusion. The top cover is also equipped with a sealing cap for sealing the sample addition chamber.
[0028] A method for nucleic acid detection using a fully enclosed biodetection microfluidic chip includes the following steps:
[0029] Step 1: Pre-seal primers, Bst DNA polymerase, dNTPs, reaction buffer, Mg2+, and EvaGreen lyophilized reagent in the biodetection reaction chamber. Add nucleic acid lysis buffer to the lysis chamber, add the nucleic acid sample to be tested into the sample chamber, and close the cap on the top cover.
[0030] Step 2: The storage rotor rotates, connecting the lysis buffer transfer channel with the outlet channels of the lysis chamber and the sample loading chamber. When the piston in the lysis chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the lysis liquid in the lysis chamber is forced into the lysis buffer transfer channel. The lysis liquid enters the sample loading chamber for nucleic acid lysis.
[0031] Step 3: The storage rotor rotates, and the sample transfer channel connects with the outlet channel of the sample addition chamber and the outlet channel of the mixing chamber. The piston in the mixing chamber is connected to the ball head piston rod and enters the groove of the inclined groove protrusion on the top cover. The ball head piston is lifted upward under the action of the groove protrusion, and the sample liquid in the sample addition chamber is sucked into the mixing chamber.
[0032] Step 4: The storage rotor rotates, connecting the sample inlet channel to the outlet channel of the mixing chamber. When the piston connecting the ball head piston rod in the mixing chamber is pressed down through the inclined protrusion on the top cover, the mixed sample liquid in the mixing chamber is forced into the sample inlet channel and enters the biodetection reaction chamber through the liquid path, where nucleic acid detection is completed.
[0033] Furthermore, in step three, the liquid storage rotor is rotated in both the forward and reverse directions, and the ball-head piston connecting rod is repeatedly lifted and pressed down in the groove of the inclined groove to mix the liquid in the mixing chamber.
[0034] By adopting the above technical solution, the present invention has the following beneficial effects:
[0035] 1. It uses a microfluidic chip as a reaction carrier, with built-in lyophilized reagents, small size, and flexible use.
[0036] 2. The microfluidic chip has a fully sealed structure, so there is no need to open the cap again after adding the sample, which isolates the internal environment of the chip from the external environment, eliminating the risk of contamination and eliminating the need for a dedicated partitioned laboratory; the chip is fully integrated, reducing manual operation steps, and only the original sample needs to be added, and the nucleic acid release and amplification will be completed within the chip.
[0037] 3. Single chip, single sample, combined with portable amplification equipment, allows for sample testing on demand in different scenarios. Attached Figure Description
[0038] Figure 1 This is a schematic diagram of the structure of the fully enclosed biodetection microfluidic chip in an embodiment of the present invention;
[0039] Figure 2 This is a schematic diagram of the liquid storage rotor in an embodiment of the present invention;
[0040] Figure 3 This is a schematic diagram of the top cover's tilt and elevation structures in an embodiment of the present invention;
[0041] Figure 4 This is a schematic diagram of the overflow cavity connecting to the sample cavity in an embodiment of the present invention;
[0042] Figure 5 This is a schematic diagram of the structure of the liquid channel in the bottom plate in another embodiment of the present invention;
[0043] Figure 6 This is a schematic diagram of the structure of the bottom plate breathable membrane in another embodiment of the present invention;
[0044] Figure 7 This is a schematic diagram showing the connection between the drain pipe and the biological detection reaction chamber in another embodiment of the present invention;
[0045] Figure 8 This is a schematic diagram of the structure of a fully enclosed biodetection microfluidic chip in another embodiment of the present invention;
[0046] Figure 9 This is a schematic diagram of the connection between the ball-head piston connecting rod and the inclined groove protrusion in another embodiment of the present invention.
[0047] Figure 10 This is a diagram showing the results of nucleic acid detection experiments in an embodiment of the present invention.
[0048] The attached diagram is labeled as follows: 1-Base plate, 101-Biodetection reaction chamber, 102-Transfer channel, 103-Sample inlet channel, 104-Main liquid channel, 105-Inlet branch channel, 106-Outlet branch channel, 107-Drainage pipe, 108-Vacuum membrane, 109-Lysate transfer channel, 110-Sample transfer channel, 2-Storage rotor, 201-Sample chamber, 202-Transfer chamber, 203-Push rod, 204-Outlet channel, 205-Flat-head piston rod, 206-Overflow chamber, 207-Overflow groove, 208-Lysate chamber, 209-Sample loading chamber, 210-Mixing chamber, 211-Ball-head piston rod, 3-Top cover, 301-Sloping protrusion, 302-Sealing cap, 303-Sample loading hole, 304-Sloping groove protrusion. Detailed Implementation
[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the structural diagrams and specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.
[0050] This invention provides a fully enclosed microfluidic chip for biodetection, comprising a base plate, a liquid storage rotor, and a top cover, with the liquid storage rotor rotated by a motor. The base plate has a biodetection reaction chamber and several channels. The biodetection reaction chamber is equipped with a temperature control module and a detection module. The temperature control module provides the temperature environment required for the biodetection within the reaction chamber, and the detection module collects biological signals during the reaction process. The biodetection reaction chamber is pre-sealed with the necessary reaction reagents for biodetection. The liquid storage rotor has several cavities, each with an outlet channel.
[0051] Biological samples are added to and transferred within the chamber, which contains a piston. The top cover has protrusions corresponding to the channel positions. When the outlet channel of the chamber rotates to connect with the channel, the piston rod moves through the protrusion on the top cover, causing displacement of the piston rod and moving the piston within the chamber. This propels the liquid between chambers, ultimately allowing it to enter the biological detection reaction chamber through the channel, where the biological sample undergoes biological detection.
[0052] The microfluidic chip is designed with multiple biodetection reaction chambers. A microchannel network allows a single sample to be simultaneously distributed to multiple reaction units, while each unit is isolated from the others, ensuring no interference between reactions. Therefore, multiple tests can be performed on the same sample as needed. Compared to conventional individual testing, this significantly reduces testing time and improves efficiency, offering the advantage of multi-stage testing. Once sealed, the chip prevents gas and liquid exchange with the external environment. A downward-pressing piston pushes liquid from the reservoir rotor into the biodetection reaction chambers. Simultaneously, the air inside the original biodetection reaction chambers flows back to the sealed space of the top cover through the degassing membrane and microchannels on the chip, filling the space created by the liquid outflow and maintaining the internal pressure balance of the chip.
[0053] Example 1
[0054] like Figure 1-3 As shown, this invention provides a fully enclosed biodetection microfluidic chip, including a base plate 1, a liquid storage rotor 2, and a top cover 3, with the liquid storage rotor rotated by a motor. The base plate is provided with a biodetection reaction chamber 101 and several channels, in which the biodetection reaction chamber is pre-sealed with the reaction reagents required for biodetection, and a liquid outlet channel 204 is provided at the bottom of the chamber.
[0055] The cavity includes a sample cavity 201 and a transfer cavity 202. The piston in the sample cavity is connected to a detachable push rod 203. The bottom plate is provided with a transfer channel 102 that corresponds to the position of the liquid outlet channel 204 of the sample cavity and the transfer cavity. The top cover is also provided with a sealing cap 302 to seal the sample cavity.
[0056] Different liquid flow methods can be selected for the sample chamber. The piston in the sample chamber can be connected to a detachable push rod 203. The sample is added into the sample chamber through the sample addition hole 303 on the top cover. By manually pressing down the push rod, the liquid in the sample chamber is pushed into the transfer chamber. After removing the push rod, the cover is closed to seal the sample chamber.
[0057] The piston inside the sample chamber can also be connected to a flat-head piston rod 205, and a beveled protrusion is provided on the top cover at the corresponding position of the transfer channel. The sample is added into the sample chamber through the sample inlet 303 of the top cover. The bottom cover seals the sample chamber, the liquid storage rotor rotates, and the flat-head piston rod moves downward under the action of the beveled protrusion, pressing down the piston and pushing the liquid in the sample chamber into the transfer chamber.
[0058] Preferred, such as Figure 4 As shown, the cavity also includes an overflow cavity 206, which is connected to the sample cavity via an overflow channel 207. The overflow channel is a sloping channel with the sample cavity end higher than the overflow cavity end. The opening height of the overflow channel on the sample cavity is 3–4 mm, and the diameter of the sample cavity is 8–10 mm. This ensures that the liquid volume in the sample cavity is quantitatively measured at 200–300 μL. When the opening height of the overflow channel on the sample cavity is 3.76 mm and the diameter of the sample cavity is 9.2 mm, 250 μL can be quantitatively measured in the sample cavity. Excess liquid flows into the overflow cavity through the overflow channel and is stored therein. This structure allows for accurate quantitative measurement of sample liquid, simplifying the sample addition process and eliminating the need for a quantitative pipette.
[0059] The piston inside the transfer chamber is connected to a flat-head piston rod 205. The bottom plate is provided with an inlet channel 103 that communicates with the biodetection reaction chamber. The top cover is provided with a sloping protrusion 301 that corresponds to the inlet channel. When the liquid storage rotor is rotated, when the liquid outlet channel 204 of the transfer chamber is connected to the inlet channel, the piston inside the transfer chamber is connected to the flat-head piston rod 205 and moves downward under the action of the sloping protrusion, forcing the liquid in the transfer chamber into the inlet channel 103 and finally into the biodetection reaction chamber.
[0060] Example 2
[0061] like Figure 5-7As shown, this invention designs a liquid path connecting the storage rotor's central cavity to the bottom plate of the biological detection reaction chamber. The sample inlet channel is connected to the main liquid channel 104, which is connected to the biological detection reaction chamber 101 via branch liquid channels. The branch liquid channels are divided into an inlet branch channel 105 and an outlet branch channel 106. The liquid in the biological detection reaction chamber flows from bottom to top. The upper end of the biological detection reaction chamber is an inclined surface, and the top of the inclined surface converges at the upper port of the drain pipe 107. The drain pipe is connected to the outlet branch channel, which ensures that during the liquid addition process, the air bubbles inside the reaction chamber are always at the top drain pipe position and are completely discharged from the reaction chamber.
[0062] The lower end of the drain pipe is connected to the vent membrane 108 on the chip substrate, which ensures that the gas generated during the liquid filling process can be discharged smoothly.
[0063] Various biological detections can be performed in the biological detection reaction chamber, such as chemiluminescence reaction, immunochromatographic reaction, and turbidity change reaction.
[0064] Example 3
[0065] This invention provides a method for biological detection using a fully enclosed biodetection microfluidic chip, comprising the following steps:
[0066] Step 1: The biological sample liquid to be tested is added into the sample chamber, and the transfer channel is connected to the liquid outlet channel of the sample chamber and the liquid outlet channel of the transfer chamber.
[0067] Step 2: Press down the push rod connected to the piston in the sample chamber. The liquid of the biological sample to be tested in the sample chamber is forced into the transfer chamber. The piston in the transfer chamber is pushed up, and the excess liquid flows into the overflow chamber through the overflow groove.
[0068] Step 3: The storage rotor rotates, and the liquid outlet of the transfer chamber is connected to the sample inlet channel. When the piston in the transfer chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the liquid of the biological sample to be tested in the transfer chamber is forced into the sample inlet channel.
[0069] Step 4: The biological sample liquid to be tested enters the reaction chamber through the liquid path, where it undergoes a biological reaction with the pre-sealed reaction reagents in the reaction chamber to complete the biological detection.
[0070] Because the pistons in the sample chambers are connected differently, when the piston in the sample chamber is connected to the flat-head piston rod 205, in step two, rotating the liquid storage rotor causes the flat-head piston rod connected to the piston in the sample chamber to press down through the inclined protrusion on the top cover. The biological sample liquid in the sample chamber is forced into the transfer channel, and the piston in the transfer chamber is lifted. Excess liquid flows into the overflow chamber through the overflow groove. The structure of this invention can quantitatively measure the sample volume through the transfer chamber, eliminating the need for manual sample addition.
[0071] Example 4
[0072] like Figure 8 , 9 As shown, this invention provides another fully enclosed biodetection microfluidic chip, including a base plate 1, a liquid storage rotor 2, and a top cover 3, with the liquid storage rotor rotated by a motor. The base plate is provided with a biodetection reaction chamber 101 and several channels, in which the biodetection reaction chamber is pre-sealed with the reaction reagents required for biodetection, and a liquid outlet channel 204 is provided at the bottom of the chamber.
[0073] The cavity includes a lysis chamber 208, a sample loading chamber 209 and a mixing chamber 210. The bottom plate is provided with a lysis liquid transfer channel 109 that corresponds to the position of the liquid outlet channel 204 of the sample loading chamber and the lysis chamber. The piston in the lysis chamber is connected to a flat-head piston rod 205. The top cover is provided with a sloping protrusion 301 at the position corresponding to the lysis liquid transfer channel.
[0074] The bottom plate is provided with a sample liquid transfer channel 110 that corresponds to the position of the liquid outlet channel of the sample addition chamber and the mixing chamber. The piston in the mixing chamber is connected to the ball head piston rod 211. The top cover is provided with a sloping groove protrusion 304 at the position corresponding to the sample liquid transfer channel.
[0075] The base plate is provided with a sample inlet channel 103 that can communicate with the biological detection reaction chamber. The sample inlet channel and the lysis buffer transfer channel are concentric arc-shaped channels. The sample inlet channel can also correspond to the position of the inclined protrusion 301. The top cover is also provided with a sealing cap 302 to seal the sample loading chamber.
[0076] A method for nucleic acid detection using a fully enclosed biodetection microfluidic chip includes the following steps:
[0077] Step 1: Pre-seal primers, Bst DNA polymerase, dNTPs, reaction buffer, Mg2+, and EvaGreen lyophilized reagent in the biodetection reaction chamber. Add nucleic acid lysis buffer to the lysis chamber, add the nucleic acid sample to be tested into the sample chamber, and close the cap on the top cover.
[0078] Step 2: The storage rotor rotates, connecting the lysis buffer transfer channel with the outlet channels of the lysis chamber and the sample loading chamber. When the piston in the lysis chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the lysis liquid in the lysis chamber is forced into the lysis buffer transfer channel. The lysis liquid enters the sample loading chamber for nucleic acid lysis.
[0079] Step 3: The storage rotor rotates, and the sample transfer channel connects with the outlet channel of the sample addition chamber and the outlet channel of the mixing chamber. The piston in the mixing chamber is connected to the ball head piston rod and enters the groove of the inclined groove protrusion on the top cover. The ball head piston is lifted upward under the action of the groove protrusion, and the sample liquid in the sample addition chamber is sucked into the mixing chamber.
[0080] Step 4: The storage rotor rotates, connecting the sample inlet channel to the outlet channel of the mixing chamber. When the piston connecting the ball head piston rod in the mixing chamber is pressed down through the inclined protrusion on the top cover, the mixed sample liquid in the mixing chamber is forced into the sample inlet channel and enters the reaction chamber through the liquid path, where nucleic acid detection is completed.
[0081] Preferably, in step three, the liquid storage rotor is rotated in both the forward and reverse directions, and the ball-head piston connecting rod is repeatedly lifted and pressed down in the groove of the inclined groove to mix the liquid in the mixing chamber.
[0082] The chip used in this embodiment is used for SARS-CoV-2 nucleic acid detection. The bioreactor reaction chamber is designed with four chambers: a positive control chamber, a SARS-CoV-2 open reading frame gene detection chamber, a SARS-CoV-2 nucleocapsid protein gene detection chamber, and a negative control chamber. The first reaction chamber pre-sealed lyophilized reagents include SARS-CoV-2 pseudovirus, Bst DNA polymerase, open reading frame gene primers, dNTPs, Mg2+, and EvaGreen; the second reaction chamber pre-sealed lyophilized reagents include Bst DNA polymerase, open reading frame gene primers, dNTPs, Mg2+, and EvaGreen; the third reaction chamber pre-sealed lyophilized reagents include Bst DNA polymerase, nucleocapsid protein gene primers, dNTPs, Mg2+, and EvaGreen; and the fourth reaction chamber pre-sealed lyophilized reagents include Bst DNA polymerase, dNTPs, Mg2+, and EvaGreen. The primer sequences are shown in the table below.
[0083] Open reading frame gene primers
[0084] O-F3 ATCCTAAAGGATTTTGTGACTT O-B3 CCGTTTAAAAACGATTGTGCA O-FIP TGTTTTTAAGTGTAAAACCCACAGGAAGGTAAGTATGTACAAATACCTAC O-BIP AGTCTGTACCGTCTGCGGTACAGCTGACTGAAGCATGG
[0085] nucleocapsid protein gene primers
[0086] Primer name sequence N-F3 TCAAGCCTCTTCTCGTTCCT N-B3 AGTGACAGTTTGGCCTTGTT N-FIP GCAGGAGAAGTTCCCCTACTGCCATCACGTAGTCGCAACAGT N-BIP GCGGTGATGCTGCTCTTGCTTTGTTGGCCTTTACCAGACA N-LF TGCCTGGAGTTGAATTTCTTG N-LB TTGCTGCTGCTTGACAGA
[0087] Using SARS-CoV-2 nucleic acid fragments as samples, after adding them to the chip sample chamber, the procedure was performed according to the above-described nucleic acid detection method. The reaction was conducted at a constant temperature of 65℃, followed by fluorescence detection. The experimental results are as follows: Figure 10 As shown in the figure, the positive control (red line), open reading frame gene (orange line), and nucleocapsid protein gene (green line) all amplified, with increased fluorescence intensity and an S-shaped curve. The negative control (blue line) did not amplify, and the fluorescence signal did not increase, showing a straight line. This indicates that the reaction within the chip is consistent with the actual results.
[0088] This invention enables the entire nucleic acid detection reaction process to be encapsulated within a single chip, automating sample extraction, amplification, and detection in one integrated operation. This significantly simplifies the personnel requirements and site limitations associated with nucleic acid detection. The reaction utilizes isothermal amplification, simplifying external temperature control equipment; simultaneously, the combination of fluorescence detection ensures excellent detection sensitivity.
[0089] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.
Claims
1. A fully enclosed biodetection microfluidic chip, comprising a base plate, a liquid storage rotor, and a top cover, characterized in that, The base plate is provided with a biodetection reaction chamber and several channels. The biodetection reaction chamber is pre-sealed with the reaction reagents required for biodetection. The liquid storage rotor is provided with several cavities, and the bottom of the cavity is provided with a liquid outlet channel. The biodetection sample is added into the cavity and transferred through the cavity. A piston is provided in the cavity. The top cover is provided with a protrusion corresponding to the position of the channel. The liquid storage rotor is driven by a motor to rotate. When the piston rod passes through the protrusion of the top cover, it drives the piston to move in the cavity and push the liquid transfer, so that the biodetection sample can complete the biodetection in the biodetection reaction chamber. The cavity includes a sample cavity and a transfer cavity. The piston in the sample cavity is connected to a detachable push rod. The base plate is provided with transfer channels that correspond to the positions of the liquid outlet channels of the sample cavity and the transfer cavity. The piston inside the transfer chamber is connected to a flat-headed piston rod. The bottom plate has a sample inlet channel that can communicate with the biodetection reaction chamber. The top cover has a sloping protrusion at the corresponding position of the sample inlet channel, and the top cover also has a sealing cap for sealing the sample chamber. The chamber also includes an overflow chamber, which is connected to the sample chamber through an overflow groove. The overflow groove is a sloping channel with the sample chamber end higher and the overflow chamber end lower. The opening height of the overflow groove on the sample chamber is 3~4mm, and the diameter of the sample chamber is 8~10mm. The piston inside the sample chamber is connected to a flat-headed piston rod, and the top cover has a sloping protrusion that corresponds to the position of the transfer channel. When the liquid storage rotor rotates, the flat-headed piston rod moves downward under the action of the sloping protrusion, pressing down the piston and pushing the liquid in the sample chamber into the transfer chamber.
2. The fully enclosed biodetection microfluidic chip according to claim 1, characterized in that, The sample inlet channel is connected to the main liquid channel. The main liquid channel is connected to the biodetection reaction chamber through branch liquid channels. The branch liquid channels are divided into inlet branch channels and outlet branch channels. The liquid in the biodetection reaction chamber enters from the bottom and exits from the top. The upper end of the biodetection reaction chamber is a slope. The top of the slope converges at the port of the drain pipe. The drain pipe is connected to the outlet branch channel.
3. The fully enclosed biodetection microfluidic chip according to claim 2, characterized in that, The lower port of the drain pipe is connected to the breathable membrane on the chip substrate.
4. A method for biological detection using the fully enclosed biodetection microfluidic chip as described in claim 1, characterized in that, Includes the following steps: Step 1: The biological sample liquid to be tested is added into the sample chamber, and the transfer channel is connected to the liquid outlet channel of the sample chamber and the liquid outlet channel of the transfer chamber. Step 2: Press down the push rod connected to the piston in the sample chamber. The biological sample liquid to be tested in the sample chamber is pressed into the transfer chamber through the transfer channel. The piston in the transfer chamber is pushed up, and the excess liquid flows into the overflow chamber through the overflow groove. Step 3: The storage rotor rotates, and the liquid outlet of the transfer chamber is connected to the sample inlet channel. When the piston in the transfer chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the liquid of the biological sample to be tested in the transfer chamber is forced into the sample inlet channel. Step 4: The liquid biological sample to be tested enters the biological detection reaction chamber through the liquid path, where it undergoes a biological reaction with the pre-sealed reaction reagents in the reaction chamber to complete the biological detection.
5. A method for biological detection using the fully enclosed biodetection microfluidic chip as described in claim 1, characterized in that, Step 1: Add the liquid biological sample to be tested into the sample chamber, rotate the liquid storage rotor, and connect the transfer channel with the liquid outlet channel of the sample chamber and the liquid outlet channel of the transfer chamber. Step 2: When the flat-headed piston rod connected to the piston in the sample chamber is pressed down by the inclined protrusion on the top cover, the biological sample liquid to be tested in the sample chamber is pressed into the transfer chamber through the transfer channel, the piston in the transfer chamber is pushed up, and the excess liquid flows into the overflow chamber through the overflow groove. Step 3: The storage rotor rotates, and the liquid outlet of the transfer chamber is connected to the sample inlet channel. When the piston in the transfer chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the liquid of the biological sample to be tested in the transfer chamber is forced into the sample inlet channel. Step 4: The liquid biological sample to be tested enters the biological detection reaction chamber through the liquid path, where it undergoes a biological reaction with the pre-sealed reaction reagents in the reaction chamber to complete the biological detection.
6. A fully enclosed bio-detection microfluidic chip according to claim 1, characterized in that, The cavity includes a lysis chamber, a sample loading chamber, and a mixing chamber. The bottom plate is provided with a lysis liquid transfer channel that corresponds to the position of the liquid outlet channel of the sample loading chamber and the lysis chamber. The piston in the lysis chamber is connected to a flat-head piston rod. The top cover is provided with a sloping protrusion at the position corresponding to the lysis liquid transfer channel. The base plate is provided with a sample transfer channel that corresponds to the position of the liquid outlet channel of the sample addition chamber and the mixing chamber. The piston in the mixing chamber is connected to the ball-head piston rod. The top cover is provided with a sloping groove-shaped protrusion at the position corresponding to the sample transfer channel. The base plate is equipped with a sample inlet channel that can communicate with the biodetection reaction chamber. The sample inlet channel and the lysis buffer transfer channel are concentric arc-shaped channels. The sample inlet channel can correspond to the position of the inclined protrusion. The top cover is also equipped with a sealing cap for sealing the sample addition chamber.
7. A method for nucleic acid detection using the fully enclosed biodetection microfluidic chip as described in claim 6, characterized in that, Includes the following steps: Step 1: Pre-seal primers, Bst DNA polymerase, dNTPs, reaction buffer, Mg2+, and EvaGreen lyophilized reagent in the biodetection reaction chamber. Add nucleic acid lysis buffer to the lysis chamber, add the nucleic acid sample to be tested into the sample chamber, and close the cap on the top cover. Step 2: The storage rotor rotates, connecting the lysis buffer transfer channel with the outlet channels of the lysis chamber and the sample loading chamber. When the piston in the lysis chamber is connected to the flat-head piston rod, it is pressed down through the inclined protrusion on the top cover, and the lysis liquid in the lysis chamber is forced into the lysis buffer transfer channel. The lysis liquid enters the sample loading chamber for nucleic acid lysis. Step 3: The storage rotor rotates, and the sample transfer channel connects with the outlet channel of the sample addition chamber and the outlet channel of the mixing chamber. The piston in the mixing chamber is connected to the ball head piston rod and enters the groove of the inclined groove protrusion on the top cover. The ball head piston is lifted upward under the action of the groove protrusion, and the sample liquid in the sample addition chamber is sucked into the mixing chamber. Step 4: The storage rotor rotates, connecting the sample inlet channel to the outlet channel of the mixing chamber. When the piston connecting the ball head piston rod in the mixing chamber is pressed down through the inclined protrusion on the top cover, the mixed sample liquid in the mixing chamber is forced into the sample inlet channel and enters the biodetection reaction chamber through the liquid path, where nucleic acid detection is completed.
8. The method for nucleic acid detection according to claim 7, characterized in that, In step three, the liquid storage rotor is rotated in both the forward and reverse directions, and the ball-head piston connecting rod is repeatedly lifted and pressed down in the groove of the inclined groove to mix the liquid in the mixing chamber.
Citation Information
Patent Citations
CN218811744U
CN221566155U