RT-RAA primer probe for detecting influenza A (H1N1) virus, ratiometric fluorescence chromatography kit and application thereof

Abstract

The present invention provides an RT-RAA primer probe, a ratio fluorescence chromatography kit and an application thereof for detecting influenza A (H1N1) virus, and belongs to the field of biological detection technology. The RT-RAA primer probe for detecting influenza A (H1N1) virus provided by the present invention can specifically amplify influenza A (H1N1) virus. The present invention combines the isothermal amplification technology mediated by recombinant polymerase with the nucleic acid fluorescence ratio chromatography test strip color development method. The RT-RAA amplification product flows through the test strip, and the product first combines with the red fluorescent microspheres, and then is captured by the T line. The green fluorescent microspheres carried on the T line are gradually covered by the red fluorescent microspheres, showing a characteristic color tone change. The detection personnel can semi-quantitatively determine the concentration of the analyte according to the color tone. It has the advantages of high sensitivity and strong specificity. It can be judged by naked eyes with a small ultraviolet flashlight. It does not require complex instruments and equipment and is suitable for rapid on-site detection.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to an RT-RAA primer probe for detecting influenza A (H1N1) virus, a ratio fluorescence chromatography kit and applications thereof. Background Art

[0002] Influenza A (H1N1) virus belongs to the family Orthomyxoviridae, and is a single-stranded negative-strand RNA virus with a genome of approximately 13.6 kb, consisting of 8 independent segments of varying sizes. Early diagnosis of pathogens is of great significance to public health and medical health. Commonly used technical means include pathogen isolation, culture and identification, immunological methods (such as direct or indirect immunofluorescence, enzyme-linked immunosorbent assay, immunochromatography, etc.) and nucleic acid detection. Pathogen isolation, culture and identification are not common in practical applications, which is mainly limited by the infrastructure of hospitals; immunological methods are widely used, especially in the past two years, the development of immunochromatographic test strips has rapidly popularized its application in self-testing of various pathogens, but this method has problems such as low sensitivity, poor specificity, and late positive results; molecular diagnosis based on nucleic acid analysis has excellent sensitivity and specificity advantages, and can identify pathogens that grow slowly or are difficult to culture. It has been widely used to detect respiratory pathogens, but it relies on central laboratories and professional technicians, which is not conducive to early on-site rapid screening and detection.

[0003] The combination of immunochromatographic test strip technology and isothermal amplification nucleic acid detection technology provides a new idea for the development of on-site detection tools. The reaction process of nucleic acid isothermal amplification technology can be carried out at the same temperature, and does not require multi-step temperature cycling like the PCR method. Recombinant polymerase-mediated isothermal amplification technology (RT-RAA) has attracted widespread attention due to its mild reaction temperature (37℃-42℃) and fast speed (products with detectable concentrations can be amplified within 10 minutes). The combination of chromatographic test strips and RT-RAA technology integrates immunochromatography, nucleic acid molecular hybridization, and signal labeling technology. The sandwich method is used to capture nucleic acid amplification products containing markers at both ends, and then the color is developed on the chromatographic test strip and directly read by the naked eye, which is very suitable for rapid on-site detection.

[0004] Gold nanoparticles (AuNPs) or fluorescent microspheres are often used as reporter molecules in lateral flow chromatography test strips for optical signal reading. AuNPs-based colorimetric chromatographic detection is easy to prepare and can obtain results directly with the naked eye, but its quantitative ability and sensitivity need to be improved. In contrast, fluorescence-based chromatographic detection (FLFIA) has advantages in sensitivity and can significantly amplify the optical signal by doping quantum dots (QD) in microspheres. Although a variety of commercial FLFIAs have been developed, there are still some challenges. First, similar to AuNPs-based chromatographic detection, the naked eye visual inspection of FLFIA is also based on changes in color intensity (brightness), so it is difficult to qualitatively or semi-quantitatively distinguish low-concentration and weakly colored test lines. Secondly, most reporter molecules produce a single signal response, that is, chromatographic color development is based on only one labeling material. The colloidal gold method and fluorescent immunochromatography commonly used on the market are all of this type. The accuracy and sensitivity of the results are easily affected by many parameters unrelated to the analyte, such as reporter molecule photobleaching, light scattering, excitation light fluctuations, etc. Low sensitivity, low signal-to-noise ratio, and differences in critical point interpretation are still problems that need to be solved in current chromatographic test paper testing. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a RT-RAA primer probe for detecting influenza A (H1N1) virus.

[0006] Another object of the present invention is to provide a kit for qualitatively or quantitatively detecting influenza A (H1N1) virus, which overcomes the problems of low sensitivity, low signal-to-noise ratio and variability in critical point interpretation of existing colloidal gold detection, and can interpret the nucleic acid amount of influenza A (H1N1) virus in the test sample as negative, weakly positive and positive results by color tone.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides an RT-RAA primer probe for detecting influenza A (H1N1) virus, comprising a forward primer, a reverse primer and a probe, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the probe is shown in SEQ ID NO.3.

[0009] Preferably, the 5' end of the reverse primer is labeled with biotin; the 30th base C of the probe is labeled with tetrahydrofuran, the 5' end of the probe is labeled with fluorescein, and the 3' end of the probe is phosphorylated.

[0010] The present invention also provides the use of the RT-RAA primer probe in preparing a product for amplifying or detecting influenza A (H1N1) virus.

[0011] The present invention also provides a kit for qualitatively or quantitatively detecting influenza A (H1N1) virus, the kit comprising the above-mentioned RT-RAA primer probe.

[0012] Preferably, the kit also includes a nucleic acid fluorescence ratio chromatography test strip, which includes a sample pad, a reaction membrane and a water absorbent pad, wherein the sample pad and the water absorbent pad are overlapped at the sample loading end and the chromatography end of the reaction membrane respectively; the reaction membrane is located between the sample pad and the water absorbent pad; a detection line and a quality control line are provided on the reaction membrane, the detection line is coated with green fluorescent quantum dot microspheres labeled with anti-biotin antibodies, and the quality control line is coated with goat anti-mouse IgG.

[0013] Preferably, the concentration of the green fluorescent quantum dot microspheres labeled with anti-biotin antibodies coated on the detection line is 0.125-2 mg / mL, and the spraying amount on the detection line is 0.7-1 μL / cm.

[0014] Preferably, the concentration of goat anti-mouse IgG coated on the quality control line is 1-2 mg / mL, and the spraying amount on the quality control line is 1 μL / cm.

[0015] Preferably, the kit further comprises a chromatography buffer, wherein the chromatography buffer comprises a phosphate buffer and red fluorescent quantum dot microspheres modified with an anti-fluorescein labeled antibody.

[0016] Preferably, the RT-RAA primer probe is used to amplify the viral RNA of the sample to be tested, the amplified product is mixed with the chromatography buffer to obtain a mixed solution, the sample pad of the test strip is inserted into the mixed solution for chromatography, and the sample to be tested is qualitatively or quantitatively determined according to the color of the detection line.

[0017] Preferably, the qualitative analysis is as follows: observing the test strip after chromatography under purple light, if the color of the detection line is still green, it is determined to be negative; if the color of the detection line is orange-red, it is determined to be positive; if the color of the detection line is yellow, it is determined to be weakly positive; the quantitative analysis is as follows: photographing the test strip after chromatography under a 365nm light source, calculating the ratio of red to green R / G, when the R / G value is ≥0.211, it is determined to be positive, when the R / G value is <0.211, it is determined to be negative, and the x value is calculated according to the formula y=2.818x / (12.33+x), wherein x is the nucleic acid concentration of the sample to be tested, and y is the R / G value.

[0018] Beneficial effects of the present invention:

[0019] The RT-RAA primer probe for detecting influenza A (H1N1) virus provided by the present invention can specifically amplify influenza A (H1N1) virus. The present invention combines the isothermal amplification technology mediated by recombinant polymerase with the nucleic acid fluorescence ratio chromatography test strip color development method for detecting influenza A (H1N1) virus, and has the advantages of high sensitivity and strong specificity. It can be judged by naked eyes with a small ultraviolet flashlight, does not require complex instruments and equipment, is simple and quick to operate, and is suitable for rapid on-site detection.

[0020] The present invention uses nucleic acid fluorescence ratio chromatography detection technology. The RT-RAA amplification product flows through the test strip. The product first combines with the red fluorescent microspheres and is then captured by the T line. The green fluorescent microspheres carried on the T line are gradually covered by the red fluorescent microspheres, showing a characteristic hue change. The detection personnel can semi-quantitatively determine the concentration of the analyte based on the hue. The change in hue is easier to be distinguished by the human eye than the change in brightness (grayscale value), and the determination of the critical point concentration is more accurate.

[0021] The kit provided by the present invention reads data and determines the results according to the R / G ratio on the T line in the nucleic acid fluorescence ratio chromatography test strip, has a self-calibration function, is not affected by the light source and the shooting environment, and is more accurate than determining by a single gray value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of the effectiveness verification of the RT-RAA amplification method of the present invention in detecting influenza A (H1N1) virus, wherein the left figure is the sensitivity result and the right figure is the specificity result;

[0023] Figure 2 This is a schematic diagram of the structure of a nucleic acid fluorescence ratio chromatography test strip;

[0024] Figure 3 The results of the optimal concentration of SA-modified green fluorescent quantum dot microspheres in the T-line coating solution are shown in the figure above, where the results of the nucleic acid fluorescence ratio chromatography test strips are shown, and the results of the R / G corresponding to each test strip are shown in the figure below;

[0025] Figure 4 The sensitivity test results are shown in the figure above, where the results of the nucleic acid fluorescence ratio chromatography test strips are shown, and the figures below are the R / G results corresponding to each test strip;

[0026] Figure 5 The sensitivity results of colloidal gold chromatography detection are shown in the figure above, where the upper figure is the colloidal gold chromatography result, and the lower figure is the statistical result corresponding to each test strip;

[0027] Figure 6 The sensitivity results of the single-color quantum dot fluorescence chromatography detection are shown in the figure above, and the corresponding statistical results of each test strip are shown in the figure below;

[0028] Figure 7 is the specific test result, where 1 represents influenza A(H1N1) virus group, and 2-7 represent influenza A(H3N2) virus group, influenza A(H7N9) virus group, influenza B virus group, respiratory syncytial virus group, novel coronavirus group, and Mycoplasma pneumoniae nucleic acid plasmid template group, respectively;

[0029] Figure 8 This is a semi-quantitative test result. DETAILED DESCRIPTION

[0030] The invention provides an RT-RAA primer probe for detecting influenza A (H1N1) virus, comprising a forward primer, a reverse primer and a probe, wherein the nucleotide sequence of the forward primer is 5'-TGCAACCGCAAATGCAGACACATTATGTAT-3' (SEQ ID NO.1), the nucleotide sequence of the reverse primer is 5'-TGTAGGACCATGAGCTTGCTGTGGAGAGTG-3' (SEQ ID NO.2), and the nucleotide sequence of the probe is 5'-ATGTAACAGTAACACACTCTGTTAACCTTCAGAAGACAAGCATAACG-3' (SEQ ID NO.3).

[0031] In the present invention, the 5' end of the reverse primer is preferably labeled with biotin, and the reverse primer labeled with biotin is [5'-biotin]TGTAGGACCATGAGCTTGCTGTGGAGAGTG-3'; the 30th base C of the probe is preferably labeled with tetrahydrofuran, the 5' end of the probe is preferably labeled with fluorescein, and the fluorescein label is preferably a FAM label. The 3' end of the probe is preferably phosphorylated to prevent the probe from self-amplification without binding to the target, and the phosphorylation modification plays a blocking role. The probe obtained after the above labeling and modification is [5'-FAM]ATGTAACAGTAACACACTCTGTTAACCTTC[THF]AGAAGACAAGCATAACG[3'C3Spacer].

[0032] The present invention also provides the use of the above RT-RAA primer probe in preparing a product for amplifying or detecting influenza A (H1N1) virus. In the present invention, the type of the product preferably includes a kit.

[0033] The present invention also provides a kit for qualitatively or quantitatively detecting influenza A (H1N1) virus, the kit comprising the above-mentioned RT-RAA primer probe.

[0034] In the kit described in the present invention, it is preferred that it also includes a nucleic acid fluorescence ratio chromatography test strip, which includes a sample pad, a reaction membrane and a water absorbent pad, and the sample pad and the water absorbent pad are overlapped at the sample loading end and the chromatography end of the reaction membrane respectively; the reaction membrane is located between the sample pad and the water absorbent pad; the reaction membrane is provided with a detection line and a quality control line, the detection line is coated with green fluorescent quantum dot microspheres labeled with anti-biotin antibodies, and the quality control line is coated with goat anti-mouse IgG.

[0035] In the present invention, the anti-biotin antibody is preferably streptavidin, and the concentration of the green fluorescent quantum dot microspheres labeled with the anti-biotin antibody on the detection line is preferably 0.125-2 mg / mL, more preferably 0.2-1 mg / mL, and the green fluorescent quantum dot microspheres labeled with the anti-biotin antibody are preferably diluted to the desired final concentration with 0.01 mol / L phosphate buffer (PBS) with a pH of 7.4. The emission peak of the green fluorescent quantum dot microspheres is preferably 525-535 nm, and the particle size is preferably 120 nm. The spraying amount on the detection line is preferably 0.7-1 μL per centimeter in the length direction of the detection line (T line), and more preferably 0.8-0.9 μL per centimeter in the length direction of the T line area. In the present invention, the concentration of the goat anti-mouse IgG coated on the quality control line (C line) is preferably 1-2 mg / mL, more preferably 1.1-1.8 mg / mL, preferably, the goat anti-mouse IgG is diluted to the desired final concentration with 0.01 mol / L PBS, pH 7.4, and the spraying amount on the C line is preferably 1 μL per centimeter in the length direction of the C line area.

[0036] In the present invention, the sprayed reaction membrane is preferably dried at 37°C for 3 hours for use. In the nucleic acid fluorescence ratio chromatography test strip of the present invention, the absorbent pad, the reaction membrane and the sample pad are adjacent in sequence, and the length of the overlapping area of ​​the adjacent parts is preferably 2mm; the overlapping parts of the absorbent paper, the sample pad and the reaction membrane are located at the upper end of the reaction membrane. The detection line and the quality control line on the reaction membrane are preferably 6mm apart; the width of the test strip is preferably 3mm.

[0037] In the present invention, the kit preferably further comprises a chromatography buffer, and the chromatography buffer preferably comprises a phosphate buffer and red fluorescent quantum dot microspheres modified with an anti-fluorescein labeled antibody. The phosphate buffer is preferably a phosphate buffer containing 1% Tween at 0.01 mol / L and a pH of 7.4. The anti-fluorescein labeled antibody is preferably an anti-FAM antibody. The emission peak of the red fluorescent quantum dot microspheres is preferably 620 to 630 nm, and the particle size is preferably 120 nm. The excitation wavelength of the fluorescent quantum dots in the above green fluorescent quantum dot microspheres and red fluorescent quantum dot microspheres is preferably 365 nm.

[0038] In the present invention, the kit preferably further comprises a constant temperature amplification reagent, and the constant temperature amplification reagent preferably comprises enzyme lyophilized powder, buffer solution, magnesium acetate, PCR grade paraffin oil and ddH2O. The PCR grade paraffin oil is used to form an oil seal to prevent aerosol contamination caused by the amplification process and the opening process after amplification. The present invention has no special restrictions on the specific sources of the above raw materials.

[0039] In the detection kit of the present invention, the RT-RAA primer probe is used to amplify the viral RNA of the sample to be tested, the amplification product is mixed with the chromatography buffer to obtain a mixed solution, the sample pad of the test strip is inserted into the mixed solution for chromatography, and the sample to be tested is qualitatively or quantitatively determined according to the color of the detection line.

[0040] In the present invention, the amplification condition is preferably incubated at 38-42°C for 10 minutes. The qualitative method is preferably: observe the chromatographic test strip under purple light, if the color of the detection line is still green, it is judged as negative; if the color of the detection line is orange-red, it is judged as positive; if the color of the detection line is yellow, it is judged as weakly positive. The quantitative method is preferably: take a picture of the chromatographic test strip under a 365nm light source, calculate the ratio of red to green R / G, when the R / G value is ≥0.211, it is judged as positive, when the R / G value is <0.211, it is judged as negative, and the x value is calculated according to the formula y=2.818x / (12.33+x), where x is the nucleic acid concentration of the sample to be tested, and y is the R / G value.

[0041] The present invention labels biotin at the 5' end of the reverse primer, carries a tetrahydrofuran modification site in the middle of the probe, carries a fluorescent group FAM at the 5' end of the probe, and modifies the 3' end of the probe so that it cannot be extended; when the probe is paired with a target DNA product amplified by a primer with a biotin label at the 5' end, the Nfo enzyme cuts the probe to form a free 3'-OH, which can be used as a primer to continue to extend and synthesize a daughter target DNA sequence; then the daughter target DNA sequence will carry both the FAM fluorescent group and biotin. Anti-FAM antibodies are labeled on quantum dot microspheres; goat anti-mouse IgG is coated on the C line; and anti-biotin antibodies (SA) are coated on the T line, so that a positive complex of anti-biotin antibodies / biotin-target series-FAM / anti-FAM antibodies-quantum dots is formed on the T line. The present invention adopts a ratiometric signal readout mode, that is, as the target nucleic acid increases, the red fluorescent signal will gradually increase to cover the green fluorescent signal fixed on the chromatography test paper. Only using an ultraviolet flashlight, the naked eye can read the change in color tone, so a characteristic nucleic acid colorimetric card can be produced to achieve simple naked eye semi-quantification of target nucleic acid. At present, there is no report on the application of ratio fluorescence chromatography technology for instant detection of nucleic acid isothermal amplification. The present invention can achieve visual semi-quantitative detection of target nucleic acid within 16 minutes, which is very suitable for field application.

[0042] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0043] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0044] The plasmids, primers, and probe sequences used in the following examples were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The viral nucleic acid extraction kit was purchased from Suzhou Beaver Biomedical Engineering Co., Ltd. The recombinase-based constant temperature amplification reagent system was purchased from Weifang Anpu Future Biotechnology Co., Ltd. Quantum dot microspheres were purchased from Wuhan Jiayuan Quantum Dot Technology Development Co., Ltd. Anti-FAM monoclonal antibodies were purchased from Shenzhen Haodi Huatuo Biotechnology Co., Ltd. Streptavidin was purchased from Sigma. Goat anti-mouse IgG was purchased from Shanghai Sangon Biotechnology Co., Ltd., PVC plates, sample pads, and absorbent pads were purchased from Shanghai Jieyi, and reaction membranes (NC membranes) were purchased from Sartorius, Germany. The remaining conventional reagents, consumables, and equipment were purchased from the market.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] Example 1

[0047] The invention discloses an RT-RAA primer probe for detecting influenza A (H1N1) virus, comprising a forward primer, a reverse primer and a probe, wherein the forward primer is 5'-TGCAACCGCAAATGCAGACACATTATGTAT-3', the reverse primer is [5'-biotin]TGTAGGACCATGAGCTTGCTGTGGAGAGTG-3', and the probe is [5'-FAM]ATGTAACAGTAACACACTCTGTTAACCTTC[THF]AGAAGACAAGCATAACG[3'C3Spacer].

[0048] Example 2

[0049] Method for RT-RAA amplification using the primer probe described in Example 1:

[0050] Extract the nucleic acid of the sample to be tested to obtain a template RNA solution; add the premixed system shown in Table 1 to the reaction enzyme freeze-dried powder tube (purchased from Weifang Anpu Future Biotechnology Co., Ltd.), centrifuge at 5000 rpm for 5 seconds after mixing, incubate in a 38°C metal bath for 10 minutes, and place the obtained amplified product at 4°C for use.

[0051] Table 1 RT-RAA amplification premix system

[0052] Composition Volume (μL) Buffer 29.4 <![CDATA[ddH2O]]> 3.5 Forward primer F (10 μM) 2 Reverse primer R (10 μM) 2 Probe (10 μM) 0.6 PCR grade paraffin oil 50 Magnesium acetate 2.5 template 10 Total volume 90

[0053] Example 3

[0054] The conservative fragment of influenza A (H1N1) virus HA gene was selected to synthesize the positive plasmid. The length of the positive plasmid was 957 bp (the nucleotide sequence was shown in SEQ ID NO.4). The connection vector was pUC57. The gradient dilutions were 10 0 , 10 1 , 10 2 , 10 3 10 μL of positive template was used as the positive template, and 10 μL of the positive template was used for RT-RAA amplification in Example 2. To verify the performance of the amplification system, the fluorescence method was used for detection. The primer probe sequence and amplification system of the fluorescence method were consistent with those of Example 1. The results are shown in FIG. Figure 1 As shown in the left figure, the minimum detection line of the detection system for influenza A (H1N1) is 1 copies / μL, with high sensitivity.

[0055] Configuration 10 3 copies / μL influenza A(H3N2), influenza A(H7N9), influenza B, respiratory syncytial virus, novel coronavirus, and Mycoplasma pneumoniae were detected by the RT-RAA amplification method of Example 2, respectively. 3The positive control group was the influenza A (H1N1) virus with 10 copies / μL, and the blank control group was the enzyme-free water. The results are shown in Figure 1 As shown in the right figure, it shows that the RT-RAA amplification method of the present invention has good specificity.

[0056] Example 4

[0057] Nucleic acid fluorescence ratio chromatography test strip for detecting influenza A (H1N1) virus

[0058] The coating solution of the quality control line (C line) is 1 mg / mL goat anti-mouse IgG (diluted to 1 mg / mL with 0.01 mol / L PBS, pH 7.4), and the coating solution of the test line (T line) is 0.5 mg / mL streptavidin (SA) modified green fluorescent quantum dot microspheres (diluted to 0.5 mg / mL with 0.01 mol / L phosphate buffer (PBS), pH 7.4). The T line coating solution and the C line coating solution were sprayed on the nitrocellulose membrane (reaction membrane) at a speed of 1 μL / cm, and dried at 37°C for 3 hours. The absorbent pad, reaction membrane and sample pad were assembled adjacent to each other in sequence, and the length of the overlapping area of ​​the adjacent parts was 2 mm. The overlapping parts of the absorbent pad, sample pad and reaction membrane were located on the upper side of the reaction membrane. The distance between the test line and the quality control line on the reaction membrane was 6 mm; the width of the test strip was 3 mm. The structural schematic diagram of the nucleic acid fluorescence ratio chromatography test strip is shown in Figure 2 .

[0059] The preparation method of green fluorescent quantum dot microspheres modified with streptavidin is as follows: 10 μL quantum dot microspheres (fluorescence emission peak 525 nm) are taken in a centrifuge tube, washed and replaced once with 80 μL 25 mM MES, pH 6.0 buffer, centrifuged at 22000g for 15 min, the supernatant is discarded, and the precipitate is added with 40 μL 25 mM MES, pH 6.0 and ultrasonically dispersed evenly. 10 mg / mL EDC and NHS solutions are prepared, 10 μL of each is taken into the above nanosphere suspension, reacted at room temperature for 30 min, centrifuged at 22000g for 8 min, the supernatant is discarded, and the precipitate is added with 40 μL 25 mM MES, pH 6.0 and ultrasonically dispersed evenly. Add 10 μg of streptavidin to the above suspension, incubate at room temperature for 1 hour, then add 8 μL of 10% BSA solution to block for 30 minutes, centrifuge at 22000g for 8 minutes, discard the supernatant, add 80 μL of 10mM PBS to disperse evenly by ultrasound, and centrifuge at 22000g for 6 minutes. After discarding the supernatant, add 20 μL of PBST to the precipitate, disperse evenly by ultrasound, and place in a 4°C refrigerator for later use.

[0060] Example 5

[0061] A kit for qualitatively or quantitatively detecting influenza A (H1N1) virus comprises the RT-RAA primer probe of Example 1, the nucleic acid fluorescence ratio chromatography test strip of Example 4 and a chromatography buffer, wherein the chromatography buffer is a mixture of 90 μL of 0.01 mol / L pH 7.4 phosphate buffer containing 1% Tween-20 and 2 μL of red fluorescent quantum dot microspheres modified with anti-FAM antibodies.

[0062] The preparation method of anti-FAM monoclonal antibody modified red fluorescent quantum dot microspheres is as follows:

[0063] Take 10 μL of quantum dot microspheres (fluorescence emission peak 620nm) in a centrifuge tube, wash and replace once with 80 μL of 25mM MES, pH 6.0 buffer, centrifuge at 22000g for 15min, discard the supernatant, add 40 μL of 25mM MES, pH 6.0 to the precipitate and disperse it evenly by ultrasound. Prepare 10mg / mL EDC and NHS solutions, take 10 μL of each to the above nanosphere suspension, react at room temperature for 30min, centrifuge at 22000g for 8min, discard the supernatant, add 40 μL of 25mM MES, pH 6.0 to the precipitate and disperse it evenly by ultrasound. Add 10 μg of anti-FAM monoclonal antibody to the above suspension, incubate at room temperature for 1 hour, then add 8 μL of 10% BSA solution to block for 30 minutes, centrifuge at 22000g for 8 minutes, discard the supernatant, add 80 μL of 10mM PBS to disperse evenly by ultrasound, and centrifuge at 22000g for 6 minutes. After discarding the supernatant, add 20 μL of PBST to the precipitate, disperse evenly by ultrasound, and place in a 4°C refrigerator for later use.

[0064] Example 6

[0065] A method for detecting influenza A (H1N1) virus:

[0066] The RNA of the sample to be tested is extracted, and the RT-RAA primer probe of Example 1 is used to amplify the RNA of the sample to be tested. The specific amplification method is the same as that of Example 2 to obtain an amplified product.

[0067] 10 μL of the amplified product was mixed with the chromatography buffer in Example 5 to obtain a mixed solution, and the sample pad of the nucleic acid fluorescence ratio chromatography test strip in Example 4 was inserted into the mixed solution for chromatography, and a qualitative or quantitative judgment was made on the sample to be tested according to the color of the detection line.

[0068] The qualitative judgment is: if the color of the test line is still green under the ultraviolet flashlight, it is judged as negative; if the color of the test line is orange-red, it is judged as positive; if the color of the test line is yellow, it is judged as weakly positive.

[0069] Quantitative determination is as follows: photograph the test strip after chromatography in a dark room with 365nm excitation light, use the color picker software to extract the RGB value, calculate the ratio of red to green R / G, and when the R / G value is ≥0.211, it is determined to be positive, and when the R / G value is <0.211, it is determined to be negative. The x value is calculated according to the formula y=2.818x / (12.33+x), where x is the nucleic acid concentration of the sample to be tested and y is the R / G value.

[0070] Example 7

[0071] The difference between the nucleic acid fluorescence ratio chromatography test strip described in Example 4 is that the T-line coating solution is 0.125, 1, 1.5, and 2 mg / mL of SA-modified green fluorescent quantum dot microspheres, respectively, and the rest is the same as Example 4.

[0072] The positive plasmid synthesized in Example 3 (10 3 The RT-RAA primer probe of Example 1 was used to amplify the analyte. The specific amplification method was the same as that of Example 2 to obtain an amplified product.

[0073] The amplified product was mixed with the chromatography buffer in Example 5 to obtain a mixed solution, and the sample pads of the nucleic acid fluorescence ratio chromatography test strips in Example 4 and this Example 7 were respectively inserted into the mixed solution for chromatography, and the sample to be tested was quantitatively determined according to the color of the detection line. The quantitative determination was as follows: the chromatographic test strip was photographed in a dark room under 365nm excitation light, the RGB value was extracted using the color picker software, and the ratio of red to green R / G was calculated to explore the optimal T line coating solution concentration. The sample was measured three times.

[0074] The results are as follows Figure 3 The concentration of SA-modified green fluorescent quantum dot microspheres in the T-line coating solution affects the R / G results of the nucleic acid fluorescence ratio chromatography test strip. The R / G ratio is the highest when the concentration in the T-line detection area is 0.5 mg / ml, which is the optimal ratio.

[0075] Example 8

[0076] Sensitivity test

[0077] Different concentrations of (10 -1 copies / μL, 10 0 copies / μL, 10 1 copies / μL, 5×10 1 copies / μL, 10 2 copies / μL, 5×10 2 copies / μL, 103 The RT-RAA primer probe of Example 1 was used to amplify the template, and the specific amplification method was the same as that of Example 2 to obtain different amplification products. At the same time, enzyme-free water was used as a negative control group (control, NC).

[0078] Different amplification products are mixed with the chromatography buffer in Example 5 to obtain different mixed solutions. The sample pads of the nucleic acid fluorescence ratio chromatography test strips in Example 4 are respectively inserted into the different mixed solutions for chromatography, and the samples to be tested are qualitatively or quantitatively determined according to the color of the detection line. Qualitative determination: If the color of the detection line is still green under an ultraviolet flashlight, it is determined to be negative; if the color of the detection line is orange-red, it is determined to be positive; if the color of the detection line is yellow-green or yellow, it is determined to be weakly positive. Quantitative determination: The chromatographic test strips are photographed in a dark room with 365nm excitation light, and the RGB values ​​are extracted using the colorpicker color extraction software, and the ratio of red to green R / G is calculated. When the R / G value is ≥0.211, it is determined to be positive, and when the R / G value is <0.211, it is determined to be negative. The sample is measured three times.

[0079] The results are as follows Figure 4 As shown, it is shown that the detection sensitivity of the method of the present invention to influenza A (H1N1) virus is 1 copy / μL.

[0080] Comparative Example 1

[0081] The same amplification product as in Example 8 was used, and colloidal gold was used for color development, and the sample was measured three times. The detection method based on colloidal gold is:

[0082] (1) Prepare gold-labeled antibody. Take 40 μL of 100 OD colloidal gold solution (Linsi Biotechnology) and dilute it to 100 μL with water. Use potassium carbonate to adjust the pH to 9. Add 10 μg of anti-FAM antibody and incubate with shaking for 15 min. Add 10 μL of 10% BSA solution to block for 15 min. Centrifuge (5000 rpm, 6 min) to retain the precipitate and resuspend it with 30 μL of PB solution for later use.

[0083] (2) Prepare chromatography test paper, prepare C-line coating solution goat anti-mouse IgG (Sangong), 1 mg / ml (diluted with PBS); T-line coating solution SA (Sigma), 1 mg / ml; use a film scribing instrument to scribing at a speed of 1 μL / cm; place the sprayed reaction film in a 37°C oven for 3 h to dry for use; attach a sample pad to the sample loading end and an absorbent pad to the other end, overlapping the reaction film by 2 mm; use a chopper to cut into 3 mm test paper strips for use.

[0084] (3) Chromatographic detection: add 2 μL of gold-labeled antibody to 90 μL of PBS solution containing 1% PTween-20, and perform chromatographic detection on 10 μL of amplified product. The results are interpreted within 5 minutes.

[0085] The results are as follows Figure 5 As shown. It shows that the detection sensitivity of the colloidal gold-based detection method for influenza A (H1N1) virus is 10 copise / μL.

[0086] Comparative Example 2

[0087] The same amplification product as in Example 8 was used for color development using a single-color quantum dot fluorescence chromatography detection method, and the sample was measured three times. The detection method based on single-color quantum dot fluorescence chromatography is as follows: (1) The step of linking the quantum dot microspheres to the anti-FAM antibody is the same as in Example 5. (2) The preparation of the test strip is the same as in Comparative Example 1. (3) The detection step is the same as in Example 6.

[0088] The results are as follows Figure 6 As shown. Figure 4 and Figure 6 By comparison, it can be seen that compared with the single-color quantum dot fluorescence chromatography detection, Example 8 has better naked eye detection performance at the critical point, and can realize the determination of positive, weak positive and negative results.

[0089] Example 9

[0090] Specificity test

[0091] Configuration 10 5 copies / μL influenza A(H3N2), influenza A(H7N9), influenza B, respiratory syncytial virus, novel coronavirus, and Mycoplasma pneumoniae nucleic acid plasmid templates were tested using the method of Example 6, respectively. 5 The positive control group was the influenza A (H1N1) virus with 10 copies / μL, and the blank control group (NC) was the enzyme-free water. The results are shown in Figure 7 As shown. No. 1 is the influenza A (H1N1) virus group, and Nos. 2-7 correspond to influenza A (H3N2) virus, influenza A (H7N9) virus, influenza B virus, respiratory syncytial virus, novel coronavirus, and Mycoplasma pneumoniae nucleic acid plasmid template groups, respectively. This indicates that the method of the present invention can specifically detect influenza A (H1N1) virus.

[0092] Example 10

[0093] Semi-quantitative test

[0094] The positive plasmid 10 prepared in Example 3 31000, 500, 100, 50, 10, 1, and 0.1 copies / μL were used as positive templates, and the template RNA was diluted to 1000, 500, 100, 50, 10, 1, and 0.1 copies / μL. The method of Example 6 was used for detection, and after 5 minutes, the images were taken in a dark room under a 365 nm light source. The RGB values ​​were extracted and read using color tone extraction software. Three independent experiments were performed, and the calculated R / G values ​​and the corresponding template concentrations were subjected to nonlinear fitting to obtain the formula y=2.818x / (12.33+x), see Figure 8 , x is the nucleic acid concentration of the sample tested (copies / μL), and y is R / G. When x is in the range of 1 to 10, it is judged as critically positive, and the corresponding R / G value is 0.211 to 1.262; when x is greater than 10, the corresponding R / G value is greater than 1.262, which is judged as positive; when x is less than 1, the corresponding R / G value is less than 0.211, which is judged as negative.

[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for qualitative or quantitative detection of influenza A (H1N1) virus, characterized in that: The kit comprises an RT-RAA primer probe, a nucleic acid fluorescence ratio chromatography test strip and a chromatography buffer; the nucleic acid fluorescence ratio chromatography test strip comprises a sample pad, a reaction membrane and a water absorbent pad, the sample pad and the water absorbent pad are respectively overlapped at the sample loading end and the chromatography end of the reaction membrane; the reaction membrane is located between the sample pad and the water absorbent pad; a detection line and a quality control line are arranged on the reaction membrane, the detection line is coated with green fluorescent quantum dot microspheres labeled with anti-biotin antibodies, and the quality control line is coated with goat anti-mouse IgG; The RT-RAA primer probe comprises a forward primer, a reverse primer and a probe, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the probe is shown in SEQ ID NO.3; the 5' end of the reverse primer is labeled with biotin; the 30th base of the probe is labeled with tetrahydrofuran, the 5' end of the probe is labeled with fluorescein, and the 3' end of the probe is phosphorylated; The chromatography buffer comprises a phosphate buffer and red fluorescent quantum dot microspheres modified with anti-fluorescein labeled antibodies.

2. The kit according to claim 1, characterized in that The concentration of the green fluorescent quantum dot microspheres labeled with anti-biotin antibodies coated on the detection line is 0.125-2 mg / mL, and the spraying amount on the detection line is 0.7-1 μL / cm.

3. The kit according to claim 1, characterized in that The concentration of goat anti-mouse IgG coated on the quality control line is 1-2 mg / mL, and the spraying amount on the quality control line is 1 μL / cm.

4. The kit according to claim 1, characterized in that The RT-RAA primer probe is used to amplify the viral RNA of the sample to be tested, the amplified product is mixed with the chromatography buffer to obtain a mixed solution, the sample pad of the test strip is inserted into the mixed solution for chromatography, and the sample to be tested is qualitatively or quantitatively determined according to the color of the detection line.

5. The kit according to claim 4, characterized in that The qualitative analysis is as follows: observe the test strip after chromatography under purple light, if the color of the detection line is still green, it is determined to be negative; if the color of the detection line is orange-red, it is determined to be positive; if the color of the detection line is yellow, it is determined to be weakly positive; the quantitative analysis is as follows: take a picture of the test strip after chromatography under a 365nm light source, calculate the ratio of red to green R / G, when the R / G value is ≥0.211, it is determined to be positive, when the R / G value is <0.211, it is determined to be negative, and the x value is calculated according to the formula y=2.818x / (12.33+x), where x is the nucleic acid concentration of the sample to be tested, and y is the R / G value.

Images