A multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture and its application and detection method

Abstract

The present invention belongs to the technical field of aquatic pathogen diagnosis, and specifically relates to a multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture, and its application and detection method. The kit contains primers and probes for detecting common pathogens in aquaculture, and the 5' end of each probe is modified with a corresponding fluorescent marker; wherein the common pathogens are Edwardsiella piscicida (Ep), Photobacterium mermanii (Pd), Vibrio rotifer (Vr) and Pseudomonas fluorescens (Pf). The method realizes the simultaneous identification and quantitative detection of Ep, Pd, Vr and Pf, has high sensitivity and good specificity, can greatly improve the detection efficiency, save the detection cost, and is suitable for large-scale rapid detection of clinical samples.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic pathogen diagnosis, and specifically relates to a multiplex fluorescent quantitative PCR detection kit for common pathogens in aquaculture and an application and detection method. Background Art

[0002] With the expansion of aquaculture factory farming, aquatic diseases have occurred frequently, seriously restricting the development of aquaculture. Edwardsiella piscicida ( Edwardsiella piscicida , Ep), Photobacterium mermaidense ( Photobacterium damselae , Pd), Vibrio rotifer ( Vibrio rotiferianus , Vr) and Pseudomonas fluorescens ( Pseudomonas fluorescens , Pf) is a common pathogen in aquaculture, which can infect a variety of marine fish, such as turbot, flounder, tongue sole, xu's flathead, sea bass, etc., causing huge economic losses to the marine economic fish farming industry. At present, the commonly used molecular biological and immunological methods for detecting pathogens are ELISA, colloidal gold, PCR and LAMP. Although the above methods have strong specificity, they also have different disadvantages, such as low sensitivity of immunological methods, the need to prepare specific monoclonal antibodies, and difficulty in achieving multiple detections; although the existing molecular biological detection methods have high sensitivity and strong specificity, they are mainly aimed at single pathogen detection, and the potential for promotion and application is limited. It is very necessary to establish a clinically applicable detection method that is rapid, sensitive, and highly specific, and can simultaneously identify multiple pathogens. Multiplex fluorescence quantitative PCR detection technology combines the high sensitivity of fluorescence and the high specificity of PCR technology. It can identify and distinguish multiple pathogens through one reaction, and can achieve batch operation. At present, there is no report on the application of multiplex fluorescence quantitative PCR technology to identify the above bacteria. Summary of the invention

[0003] The present invention aims to provide a multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture and its application and detection method.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] A multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture, comprising primers and probes for detecting common pathogens in aquaculture, and the 5' end of each probe is modified with a corresponding fluorescent marker; wherein the common pathogens are Edwardsiella piscicida (Ep), Photobacterium mermanii (Pd), Vibrio rotifer (Vr) and Pseudomonas fluorescens (Pf).

[0006] The probe and primers are respectively directed against Ep evpP Gene, Pd gyrB Gene, VRtoxR Gene and Pf aprX Gene.

[0007] For Ep evpP Gene (Genbank No.: OR670479.1), Pd gyrB Gene (Genbank No.: KU680720.1), Vr toxR Gene (Genbank No.: FM202709.1) and Pf aprX Gene (Genban K number: EU360312.1). evpP The primers for the gene were Ep-qF / qR, the length of the amplified fragment was 118 bp, and the probe was Ep-P; gyrB The primers for the gene were Pd-qF / qR, the length of the amplified fragment was 114 bp, and the probe was Pd-P; gyrB The primers for the gene were Vr-qF / qR, the length of the amplified fragment was 119 bp, and the probe was Vr-P; gyrB The primers of the gene were Pf-qF / qR, the length of the amplified fragment was 108 bp, and the probe was Pf-P.

[0008] The Ep evpP The 5' end of the gene probe sequence was modified with FAM, Pd gyrB The 5' end of the gene probe sequence was modified to HEX, Vr toxR The 5' end of the gene probe sequence was modified to ROX, Pf aprX The 5' end of the gene probe sequence was modified with Cy5.

[0009] The Ep evpP The gene primers and probes are:

[0010] evpP-qF GCAAAACGGGGTATCAATGAG; (sequence 1)

[0011] evpP-qR GAACCAGGCATAGACGGGAAT; (sequence 2)

[0012] evpP-P [6-FAM]GACGACTCACCTCCGTGATCAAAGAAA[BHQ1]; (SEQ ID NO: 3)

[0013] Pd gyrB The gene primers and probes are:

[0014] gyrB-qF GCTTGCGTTAGAAAATGCTGC; (SEQ ID NO: 4)

[0015] gyrB-qR CGCTCAATCAACTTCATTGTGCT; (sequence 5)

[0016] gyrB-P [HEX]AATGGCCGGTCTTGCTCTTGAGAATC[BHQ1]; (SEQ ID 6)

[0017] VR toxR The gene primers and probes are:

[0018] toxR-qF ACAACGCAACACCACTTTC; (SEQ ID NO: 7)

[0019] toxR-qR AGCTGGTTTAGTGAGGGTAAAG; (SEQ ID NO: 8)

[0020] toxR-P [ROX]TCGTTGCTGTACTGCTGCCAATCATC[BHQ2]; (SEQ ID 9)

[0021] Pf aprX The gene primers and probes are:

[0022] aprX-qF CTTGCCCGGCACCAATGAGA; (SEQ ID NO: 10)

[0023] aprX-qR TAGTTGTTCAGGCCCGGGTTGA; (SEQ ID NO: 11)

[0024] aprX-P [Cy5]GGCACGGATGGCACCTCSTGGTACCT[BHQ2] (SEQ ID NO: 12).

[0025] The concentrations of primers and probes in the kit are both 20 µM, and the reaction system includes 2×PCR Mix 10 µl, Ep primer 1 µl, Ep probe 0.8 µl; Pd primer 0.8 µl, Pd-probe 0.7 µl; Vro primer 0.4 µl, Vro probe 0.5 µl; Pf primer 0.4 µl, Ep probe 0.7 µl; ultrapure water + DNA template to make up to 20 µl.

[0026] The reaction procedure is: pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing at 60°C for 30s, and 40 cycles.

[0027] An application of the multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture, and application of the kit in multiplex fluorescence quantitative / qualitative detection of common pathogens in aquaculture.

[0028] A multiple fluorescence quantitative / qualitative detection method for common pathogens in aquaculture:

[0029] (1) Extraction of total DNA from samples;

[0030] (2) Use the above kit and the positive plasmid corresponding to the common pathogens in aquaculture to establish a standard curve for quantitative analysis of pathogens;

[0031] (3) using the above kit to extract total DNA from the sample and perform multiplex fluorescence quantitative PCR amplification reaction to obtain a PCR amplification curve;

[0032] (4) Analyze the results based on the amplification curve.

[0033] If the amplification result is a good "S"-shaped amplification curve and the Cq value is ≤35, it is judged as positive. If there is no amplification curve and the Cq value is greater than 35, it is judged as negative. If a gene channel of the sample to be tested has an S-shaped amplification curve and 35≦Ct<40, it is judged as an uncertain sample and the nucleic acid is re-extracted for re-testing. In positive results, the type of pathogen in the sample is determined according to the fluorescent pigment corresponding to the color of the amplification curve.

[0034] The present invention has the following advantages:

[0035] 1. The present invention is based on TaqMan probe technology, which has strong specificity and avoids the generation of false positives; combined with fluorescent quantitative PCR technology, it has high sensitivity.

[0036] 2. The present invention can simultaneously realize the differential diagnosis and quantification of four common aquatic pathogens, Ep, Pd, Vr and Pf.

[0037] 3. The present invention is simple to operate, saves detection costs, can meet the needs of large-scale rapid detection of pathogenic bacteria, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The multiplex fluorescence quantitative PCR standard curve provided in the embodiment of the present invention; wherein A, B, C and D represent the standard curves of Ep, Pd, Vr and Pf respectively.

[0039] Figure 2 The sensitivity test results of multiplex fluorescence quantitative PCR provided in the embodiments of the present invention; wherein A, B, C and D represent the sensitivity detection results of Ep, Pd, Vr and Pf respectively.

[0040] Figure 3 The specific experimental results of the multiplex fluorescence quantitative PCR provided in the embodiments of the present invention; wherein 1, 2, 3 and 4 represent Ep, Pd, Vr and Pf respectively, and 5-13 represent other common aquatic pathogens and negative controls. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the examples. The examples are intended to illustrate the present invention, but are not intended to limit the present invention in any form.

[0042] Example 1 Preparation of positive plasmid standards for strain Ep, Pd, Vr and Pf specific genes

[0043] Step 1) Primer design for different strain-specific genes

[0044] Ep evpP Gene, Pd gyrB Gene, VR toxR Gene, Pf aprX Gene design primers, the specific primer sequences are as follows:

[0045] EP-F: 5'-ATGCTACTGAAAAAAGGATGGCG-3'

[0046] EP-R: 5'-CTATTTCAATATTGAAAATTGGTGGC-3'

[0047] PD-F: 5'-ATGTCCAACAATTACGATTCATCAAG-3'

[0048] PD-R: 5'-TTATACGTCTAGATTTGCATTTAGAG-3'

[0049] VR-F: 5'-TCAAGCCTAACTCAAGCGATTTC-3'

[0050] VR-R: 5'-GTTTTGTATGATTTTCTACGTATCGAG-3'

[0051] PF-F: 5'-GCGACTTCCACATGACCTTC-3'

[0052] PF-R: 5'-GCCGCTGCCTTTGGTGATAC-3'.

[0053] Step 2) Construction of recombinant positive plasmid

[0054] The genomic DNA of Ep, Pd, Vr and Pf were extracted respectively, and the genes were amplified using the primers in step 1). The amplified PCR products were identified by agarose gel electrophoresis, and the positive products were connected with the pMD-19T plasmid and transformed into DH5α competent cells. After cultivation, the positive clones were identified by colony PCR and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The positive plasmid standards were named: pEp, pPd, pVr and pPf.

[0055] Step 3) Dilution and storage of recombinant positive plasmid

[0056] The concentration of positive clones was measured, and the plasmid copy number was calculated by the following formula: DNA copy number (copy / μL) = [6.02 × 10 23 ×Plasmid concentration (ng / μL) × 10 -9 ] / [DNA length × 660]. Dilute different positive standards to make their concentrations 10 9 copies / μL, stored at -20℃ for future use.

[0057] Example 2 Taqman multiplex fluorescence quantitative PCR primer design

[0058] Step 1) Target gene selection and sequence analysis

[0059] Ep evpP Gene, Pd gyrB Gene, VR toxR Gene and Pf aprX For the target gene, the intraspecies conserved region and interspecies specific region were found through NCBI blast analysis and multiple sequence alignment analysis, and the primers and probes were designed.

[0060] Step 2) Design and modification of fluorescent probes

[0061] Different probes were modified with different fluorescent labels. evpP The 5' end of the gene probe sequence was modified with FAM, Pd gyrB The 5' end of the gene probe sequence was modified to HEX, Vr toxR The 5' end of the gene probe sequence was modified to ROX, Pf aprX The 5' end of the gene probe sequence was modified with Cy5, and the specific sequence is shown in (Table 1).

[0062] Table 1 Primer and probe sequences for multiplex fluorescence quantitative PCR

[0063]

[0064] Step 3) Preparation of primer and probe solutions

[0065] The above-mentioned different primers and probes were dissolved and diluted with ultrapure water, and their concentrations were adjusted to 20 μM, and stored at -20°C for future use.

[0066] Example 3 Optimization of multiplex fluorescence quantitative PCR reaction conditions

[0067] Step 1) Setting of reaction system conditions

[0068] The concentration range of primers was 0.1~1 μmol / L, with a concentration gradient of 0.1 μmol / L. The concentration range of probes was 0.1~ 0.8 μmol / L, with a concentration gradient of 0.1 μmol / L. The annealing temperature range was 58℃~62℃, with a temperature gradient of 2℃.

[0069] Step 2) Fluorescence quantitative PCR reaction under different reaction system conditions

[0070] Taqman fluorescence quantitative PCR was performed using the recombinant plasmid standards pEp, pPd, pVr and pPf as templates, and the corresponding four pairs of qPCR primers and fluorescent probes were used. FAM, HEX, ROX and Cy5 were selected as the four fluorescent channels of the real-time fluorescence quantitative PCR instrument. The primer concentration and probe concentration were selected according to the Cq value, fluorescence value and amplification curve changes in the single fluorescence PCR amplification results, and the multiplex fluorescence PCR detection method was established using the optimized reaction system and reaction conditions (Table 2).

[0071] Table 2 Optimal reaction system for multiplex fluorescence quantitative PCR

[0072]

[0073] Example 4 Establishment of multiplex fluorescence quantitative PCR standard curve

[0074] Step 1) Dilution of positive standard plasmid

[0075] The positive plasmid standards pEp, pPd, pVr and pPf were diluted tenfold to obtain 10 9 Copies / μL ~ 10 3 Copies / μL of plasmid standard.

[0076] Step 2) Plotting of fluorescence quantitative PCR reaction and standard curve

[0077] The diluted recombinant plasmid standard was used as a template, and the template was subjected to multiple fluorescence quantitative PCR reaction according to the optimized reaction system and reaction conditions. The logarithm of the copy number concentration was used as the horizontal axis, and the Cq value of each copy concentration amplification was used as the vertical axis to draw the multiple fluorescence quantitative PCR standard curve ( Figure 1). Standard curve formula, correlation coefficient R 2 , and the amplification efficiency (E) is as follows: Ep, y=-3.0373x+41.19, R 2 = 0.9971, E=1.13; Pd, y=-3.3334x+39.476, R 2 =0.9987, E=1.00; Vro, R 2 = 0.9936, y=-3.3705x +39.33, E=0.98; Pf, R 2 = 0.9971, y=-2.9298x+40.046, E=1.19.

[0078] Example 5 Multiplex fluorescence quantitative PCR sensitivity experiment

[0079] Step 1) Dilution of positive standard plasmid

[0080] The concentrations of the positive plasmid standards pEp, pPd, pVr and pPf were diluted to 10 5 ~10 0 copies / μL.

[0081] Step 2) Multiplex fluorescence quantitative PCR detection

[0082] The diluted recombinant plasmid standard was used as a template, and the Taqman multiplex fluorescence quantitative PCR sensitivity test was performed according to the optimized reaction system and reaction conditions. At the same time, the diluted standard plasmid was used as a template for conventional PCR amplification for comparison. It was finally determined that the detection limits of the established multiplex fluorescence quantitative PCR for pEp, pPd, pVr and pPf were 5.2 × 10 1 copies / uL, 7.6×10 1 copies / uL, 3.1×10 1 copies / uL and 4.2×10 1 copies / uL, and its sensitivity is about 100 times that of ordinary PCR ( Figure 2 ).

[0083] Example 6 Multiplex Fluorescence Quantitative PCR Specificity Experiment

[0084] Step 1) Selection of strains

[0085] Eight other common aquatic pathogens were selected, such as Vibrio anguillarum ( Vibrio anguillarum )、Vibrio alginolyticus( Vibrio alginolyticus harveyi ( Vibrio harveyi ), Vibrio maxima ( Vibrio scophthalmi)、Non-decarboxylating Luxenbergia ( Leclercia adecarboxylata )、Haemophilus ichthyophilus( Haemophilus piscium )、 Vibrio azureus and Vibrio alginolyticus Conduct specificity experiments.

[0086] Step 2) Specific reaction

[0087] The genomic DNA of each strain in step 1) was extracted respectively, and the plasmid standards pEp, pPd, pVr and pPf were used as positive controls and ultrapure water was used as negative control to perform fluorescence quantitative PCR amplification and detection to determine the specificity of the established multiplex fluorescence quantitative PCR detection. The results showed that the established multiplex fluorescence quantitative PCR detection method had good specificity ( Figure 3 ).

[0088] Example 7 Multiplex Fluorescence Quantitative PCR Repeatability Experiment

[0089] The dilution range is 10 6 Copies / μL~10 4 The recombinant plasmid standards pEp, pPd, pVr and pPf with 100 copies / μL were prepared. The diluted standard plasmids were used as templates to perform multiplex fluorescence quantitative PCR repeatability experiments under the optimal reaction conditions and system. Three groups of repeated intra-group experiments and three repeated inter-group experiments were performed on the templates under the same conditions and at three different time periods. At the same time, the coefficient of variation (CV) was calculated by the Cq value of each dilution to evaluate the repeatability of the method. The results showed that the established multiplex fluorescence quantitative PCR detection method had good repeatability.

[0090] Example 8 Clinical application of multiplex fluorescence quantitative PCR kit

[0091] Step 1) Preparation of clinical samples

[0092] 100 μL of Ep, Pd, Vr and Pf (10 7 cfu / ml) were used to infect the flatfish (20.3±1.6 g). The liver, spleen and kidney of the flatfish were aseptically collected at 12, 24 and 48 hours after infection, mixed and ground with PBS at a mass volume ratio of 1:10, and the presence of bacteria in the samples was detected by plate counting. In order to conduct multiple qPCR detection studies, different ground samples were combined in different ways to obtain clinical samples with 1, 2, 3 and 4 bacteria, respectively.

[0093] Step 2) Multiplex fluorescence quantitative PCR detection

[0094] The total genomic DNA from each sample in step 1) was extracted separately, and the plasmid standards pEp, pPd, pVr and pPf were used as positive controls and ultrapure water was used as negative control for fluorescence quantitative PCR amplification and analysis to determine the application potential of the established multiplex fluorescence quantitative PCR in fish clinical samples. The results showed that the detection accuracy of the established multiplex fluorescence quantitative PCR detection method was 100% (Table 3).

[0095] Table 3 Multiplex fluorescence quantitative PCR test results of clinical samples

[0096]

Claims

1. A multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture, Features: The kit contains primers and probes for detecting common pathogens in aquaculture, and the 5' end of each probe is modified with a corresponding fluorescent marker; among them, the common pathogens are Edwardsiella piscicida Ep, Photobacterium mermaidii Pd, Vibrio rotifer Vr and Pseudomonas fluorescens Pf; The primers and probes of Ep are: evpP-qF GCAAAACGGGGTATCAATGAG; evpP-qRGAACCAGGCATAGACGGGAAT; evpP-P[6-FAM]GACGACTCACCTCCGTGATCAAAGAAA[BHQ1]; The primers and probes for Pd are: gyrB-qF GCTTGCGTTAGAAAATGCTGC; gyrB-qR CGCTCAATCAACTTCATTGTGCT; gyrB-P [HEX]AATGGCCGGTCTTGCTCTTGAGAATC[BHQ1]; The primers and probes for Vr are: toxR-qF ACAACGCAACACCACTTTC; toxR-qR AGCTGGTTTAGTGAGGGTAAAG; toxR-P[ROX]TCGTTGCTGTACTGCTGCCAATCATC[BHQ2]; The primers and probes for Pf are: aprX-qF CTTGCCCGGCACCAATGAGA; aprX-qRTAGTTGTTCAGGCCCGGGTTGA; aprX-P[Cy5]GGCACGGATGGCACCTCSTGGTACCT[BHQ2].

2. The multiplex fluorescent quantitative PCR detection kit for common pathogens in aquaculture according to claim 1, Features: The probe and primers are respectively directed against Ep oeLh Gene, Pd ikB Gene, VR toxR Gene and Pf apr Gene.

3. The multiplex fluorescent quantitative PCR detection kit for common pathogens in aquaculture according to claim 2, Features: The Ep oeLh The 5' end of the gene probe sequence was modified with FAM, Pd ikB The 5' end of the gene probe sequence was modified to HEX, Vr toxR The 5' end of the gene probe sequence was modified to ROX, Pf apr The 5' end of the gene probe sequence was modified with Cy5.

4. The multiplex fluorescence quantitative PCR detection kit for common pathogens in aquaculture according to any one of claims 1 to 3, Features: The concentrations of primers and probes in the kit were both 20 µM, and the reaction system included 10 µl of reaction solution 2×PCRMix, 1 µl of Ep primer, 0.8 µl of Ep probe; 0.8 µl of Pd primer, 0.7 µl of Pd-probe; 0.4 µl of Vro primer, 0.5 µl of Vro probe; 0.4 µl of Pf primer, 0.7 µl of Ep probe; ultrapure water + DNA template to make up to 20 µl.

5. Use of the kit according to claim 1 in multiple fluorescence quantitative / qualitative detection of common pathogens in aquaculture; The common pathogens in aquaculture are Edwardsiella piscicida Ep, Photobacterium mermaidii Pd, Vibrio rotifer Vr and Pseudomonas fluorescens Pf; The described use is for non-diagnostic purposes.

6. A multiple fluorescence quantitative / qualitative detection method for common pathogens in aquaculture, Features: The method is not for diagnostic purposes; The common pathogens in aquaculture are Edwardsiella piscicida Ep, Photobacterium mermaidii Pd, Vibrio rotifer Vr and Pseudomonas fluorescens Pf; The method comprises the following steps: (1) Extraction of total DNA from samples; (2) Using the kit described in claim 1 and the positive plasmid corresponding to the common pathogens in aquaculture, a standard curve is established for quantitative analysis of the pathogens; (3) using the kit described in claim 1 to extract total DNA from the sample and perform multiplex fluorescence quantitative PCR amplification reaction to obtain a PCR amplification curve; (4) Analyze the results based on the amplification curve.

7. The method for multiple fluorescence quantitative / qualitative detection of common pathogens in aquaculture according to claim 6, Features: If the amplification result is a good "S"-shaped amplification curve and the Cq value is ≤35, it is judged as positive. If there is no amplification curve and the Cq value is greater than 35, it is judged as negative. If a gene channel of the sample to be tested has an S-shaped amplification curve and 35≦Ct<40, it is judged as an uncertain sample and the nucleic acid is re-extracted for re-testing. In positive results, the corresponding pathogen type in the sample is determined according to the fluorescent pigment corresponding to the color of the amplification curve.

Images