Application of novel nano-drug G3T19-mPEG in preparation of drug for treating periodontitis

Abstract

The invention discloses application of a novel nano-drug G3T19-mPEG in preparation of a drug for treating periodontitis, the nano-drug is formed by conjugating a novel oligonucleotide drug G3T19 and polyethylene glycol (mPEG), and a preparation method comprises the following steps: S01, synthesizing amino-modified G3T19 (G3T19-NH2); and S02, carrying out covalent coupling on the G3T19-NH2 and the mPEG-COOH, and carrying out purification on the G3T19-NH2 and the mPEG-COOH. The G3T19-mPEG has the multifunctional properties of down-regulating expression of cells CD44, further inhibiting macrophages from releasing proinflammatory factors, inhibiting osteoclast differentiation, promoting osteoblast matrix mineralization and the like, the effect and safety of the G3T19-mPEG on treating periodontitis are proved on an animal model, and a new method is provided for treating periodontitis.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine and infection immunology, and specifically relates to application of a novel nano drug G3T19-mPEG in preparing a drug for treating periodontitis. Background Art

[0002] Periodontitis causes irreversible damage to periodontal tissues, which can lead to symptoms such as gingival bleeding and loose teeth. It is the main cause of tooth loss. More than 1 billion adults worldwide suffer from severe periodontitis, which causes impaired chewing function, facial collapse, and affects food digestion and nutrient absorption. Porphyromonas gingivalis (Pg) is recognized as the main dominant bacteria causing periodontitis, which seriously endangers oral health. Periodontitis caused by Pg seriously endangers the health of patients, is expensive to treat, and imposes a huge burden on public health and the economy. In recent years, the prevention and treatment of periodontitis has become particularly urgent.

[0003] Pg damages periodontal tissues through multiple pathways. It is a core role in the destruction and repair stages of periodontal disease. It can release a large number of pro-inflammatory factors (such as IL-1β, IL-6, etc.) after stimulation by Pg, thereby damaging periodontal tissues. In addition, Pg can also induce the differentiation of osteoclast precursor cells and inhibit the mineralization of bone matrix of osteoblasts, ultimately leading to the destruction of periodontal tissues and alveolar bone resorption.

[0004] Drug therapy is an important supplement to local periodontal surgical treatment in clinical practice, such as oral antibiotics or host regulatory drugs, but it may easily lead to bacterial resistance, dysbiosis or systemic inflammatory imbalance. Therefore, targeted improvement of the local periodontal immune microenvironment to treat periodontitis has become the latest research hotspot. Another important pathogenic feature of periodontitis is the lack of reversibility and self-limitation, that is, the damaged alveolar bone is difficult to restore to its normal height, and there is currently a lack of drugs that promote the differentiation of normal periodontal tissue cells. The core scientific issue of drug treatment for periodontitis is to control the excessive local inflammatory response of the periodontal tissue and promote the differentiation of normal periodontal tissue cells. Therefore, new drugs for the treatment of periodontitis should have the following advantages: 1) significant anti-inflammatory effect; 2) inhibition of osteoclast differentiation; 3) promotion of osteoblast matrix mineralization; 4) good safety and no toxic side effects.

[0005] Single-stranded oligonucleotide (ssDNA) drugs are one of the hot spots in drug research and development in recent years. Dozens of ssDNA with special sequences for the treatment of tumors, autoimmune diseases and other diseases have entered the clinical trial stage as drugs with significant effects. Its advantages are low cost, easier chemical modification and no toxic side effects, simple preparation method, rapid in vitro synthesis in large quantities, stable at room temperature, no need for refrigeration, easy to store, small molecular weight, small steric hindrance and high tissue permeability. ssDNA rich in G bases is a special oligonucleotide, called G-quadruplex, which can be used in the detection field because it can form a simulated peroxidase after binding to heme. One of the G-quadruplex sequences is 5′-CTGGGTGGGTGGGTGGGTC-3′ (Xuanxiang Mao et al., A Double Hemin Bonded G-Quadruplex Embedded in Metal Organic Frameworks for Biomimetic Cascade Reaction, ACS Appl. Mater. Interfaces, 2022, Vol. 14, 54598-54606, Publication Date: 2022-12-02), and its reported function is as a biosensor for the detection of related markers. In addition to its possible application in disease diagnosis and environmental monitoring, other biological functions of the sequence cannot be derived. In addition, the sequence (named G3T19) can also be used as a drug that is easier to penetrate the blood-brain barrier for anti-glioma (a method for preparing a new oligonucleotide drug G3T19 and its application in anti-glioma, patent number: 202310992856.0). However, to date, this sequence has not been successfully used as a drug for the treatment of periodontitis, except for the above applications. Summary of the invention

[0006] The present invention provides a novel nano drug G3T19-mPEG for use in the preparation of drugs for treating periodontitis. That is, by coupling G3T19 with mPEG, in vitro and in vivo experiments have confirmed that it can significantly inhibit the release of pro-inflammatory factors by macrophages, inhibit osteoclast differentiation, and promote osteoblast matrix mineralization by down-regulating the expression of cell CD44, and has good safety and no toxic side effects, providing a new method for treating periodontitis.

[0007] The first object of the present invention is to provide a method for preparing the novel nano drug G3T19-mPEG.

[0008] The second purpose of the present invention is to confirm that the nano drug G3T19-mPEG can significantly inhibit the release of proinflammatory factors by macrophages, inhibit osteoclast differentiation, and promote osteoblast matrix mineralization by down-regulating the expression of cell CD44, and has good safety and no toxic side effects.

[0009] The third object of the present invention is to confirm the application of nano drug G3T19-mPEG in the preparation of drugs for treating periodontitis.

[0010] The technical solution adopted to achieve the above-mentioned purpose of the present invention is:

[0011] The G3T19 sequence and the controlled randomized oligonucleotide (CRO) sequence were coupled with mPEG, and the two drugs obtained were named G3T19-mPEG and CRO-mPEG, respectively.

[0012] Furthermore, a new type of nanodrug G3T19-mPEG for periodontitis is administered locally and can downregulate the expression of cell CD44, thereby significantly inhibiting the release of proinflammatory factors by macrophages, inhibiting osteoclast differentiation, and promoting osteoblast matrix mineralization, so it can be used to treat periodontitis.

[0013] The application of a nano drug containing an oligonucleotide drug G3T19 sequence mainly involves down-regulating the expression of cell CD44, inhibiting the release of pro-inflammatory factors by macrophages, inhibiting osteoclast differentiation, and promoting osteoblast matrix mineralization, but is not limited to the above applications.

[0014] The present invention screens out the G-quadruplex G3T19 sequence with the best effect of inhibiting Pg-mediated macrophage inflammation from common G-quadruplex sequences. Downregulation of the cell surface adhesion receptor CD44 by the G-quadruplex sequence, CD44 downregulation or deletion can significantly inhibit macrophage inflammatory response and inhibit osteoclast differentiation. In addition, since the precursor cells of macrophages and osteoclasts are derived from differentiated monocytes, drugs that inhibit macrophage inflammation may also inhibit the differentiation of osteoclast precursor cells, and osteoclasts and osteoblasts in the body are in a state of equilibrium, and drugs that inhibit the differentiation of osteoclast precursor cells may also promote the differentiation of osteoblasts.

[0015] In addition, the disadvantages of nucleic acid drugs are that they are poorly soluble in water, easily degraded by enzymes in the body, and difficult to target bone tissue. Therefore, the present invention needs to modify nucleic acid drugs. Methoxypolyethylene glycol (mPEG) has low toxicity and good biocompatibility, which can increase the water solubility of drugs, protect nucleic acid drugs from being degraded by enzymes in the body, support the differentiation and deposition of bone matrix, and have good targeting. The present invention connects G3T19 to mPEG to prepare a new type of nano drug G3T19-mPEG for the treatment of periodontitis.

[0016] Compared with the prior art, the beneficial effects and advantages of the present invention are:

[0017] 1. The novel nanomedicine (G3T19-mPEG) obtained by the present invention can downregulate the expression of cell CD44, thereby significantly inhibiting the release of pro-inflammatory factors by macrophages, inhibiting osteoclast differentiation, and promoting osteoblast matrix mineralization, thereby treating periodontitis.

[0018] 2. The novel nano drug (G3T19-mPEG) obtained by the present invention can inhibit osteoclast differentiation and promote osteoblast matrix mineralization, thereby being able to repair damaged alveolar bone, while existing drugs still have difficulty solving the problem of lack of self-limiting repair of periodontitis.

[0019] 3. The novel nanomedicine (G3T19-mPEG) obtained by the present invention focuses on host-oriented treatment methods, and treats periodontitis by targeted improvement of the local periodontal immune microenvironment, without causing the drawbacks of bacterial resistance and dysbiosis caused by the abuse of antibiotics.

[0020] 4. The results of cell experiments and animal experiments show that the new nanomedicine (G3T19-mPEG) obtained by the present invention does not inhibit the proliferation of primary cells, does not cause inflammatory response, does not damage major organs, and has no toxic side effects; and the administration method is local administration, directly targeting the periodontitis affected area, thereby reducing the side effects of systemic medication, and safety is guaranteed.

[0021] 5. The main administration method of the new nano drug (G3T19-mPEG) obtained by the present invention is local administration for the treatment of periodontitis. Local administration can directly act on the diseased area and reduce interfering factors. Therefore, it can improve the therapeutic effect of the drug and overcome the limitations of systemic administration. It is the preferred administration method for oral medication.

[0022] 6. The mPEG in the novel nanomedicine (G3T19-mPEG) obtained by the present invention is used as a drug carrier with low toxicity and good biocompatibility. It can also increase the water solubility of oligonucleotide drugs, protect nucleic acid drugs from being degraded by enzymes in the body, support the differentiation and deposition of bone matrix, and has good targeting. It can overcome the adverse effects of the special physiological environment of the oral cavity, especially the high humidity and high fluidity of saliva on local medication. Therefore, it can target periodontal tissues for treatment and significantly improve the efficacy of nucleic acid drugs.

[0023] 7. The new nano drug (G3T19-mPEG) obtained by the present invention is specifically administered by local gingival injection. However, G3T19-mPEG can be made into chewable tablets, chewing gum, mouthwash, toothpaste, etc. for local treatment in the later stage, so as to realize the autonomous administration of drugs by clinical patients, thereby improving the patients' treatment compliance and clinical application value.

[0024] 8. The novel nano drug (G3T19-mPEG) obtained by the present invention has a simple preparation method, can be prepared in large quantities and rapidly, has a relatively low cost, has stable performance, is stable at room temperature, does not require refrigeration, and is easy to store. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the present invention is further described in detail below in combination with the drawings and specific embodiments.

[0026] Figure 1 This study confirmed that G3T19 was the G-quadruplex with the best effect in inhibiting Pg-stimulated macrophage secretion of inflammatory factors.

[0027] Figure 2 This is the prepared new nano drug G3T19-mPEG and its characterization test diagram. Figure 2 (A) is the result of G3T19-mPEG observation using transmission electron microscopy; Figure 2 (B) is the result of G3T19-mPEG particle size analysis; Figure 2 (C) is the result of scanning the absorption wavelength of G3T19-mPEG using a UV spectrophotometer. (G3T19-mPEG and CRO-mPEG are referred to as G3T19-mP and CRO-mP in all figures, respectively, the same below).

[0028] Figure 3This is the result of G3T19-mPEG inhibiting the secretion of inflammatory factors by macrophages stimulated by Pg. Figure 3 (A), (B), and (C) are graphs showing the results of different concentrations of drugs inhibiting the secretion of inflammatory factors IL-1β, IL-6, and TNF-α by Pg-stimulated macrophages.

[0029] Figure 4 : is a comparative diagram of G3T19-mPEG inhibiting osteoclast precursor cell differentiation in the presence or absence of Pg. Figure 4 (A) TRAP staining images of osteoclasts in each group; Figure 4 (B) is the concentration of TARP in each group in osteoclast lysate; Figure 4 (C) is the concentration of OPG in osteoclast lysate of each group.

[0030] Figure 5 This is a comparative diagram of G3T19-mPEG promoting osteoblast differentiation in the presence or absence of Pg. Figure 5 (A) Alizarin red staining images of osteoblasts in each group; Figure 5 (B) is the alkaline phosphatase staining image of osteoblasts in each group; Figure 5 (C) is the concentration of osteocalcin (OCN) in each group in osteoblast lysate; Figure 5 (D) is the concentration of type I collagen (Collagen I) in osteoblast lysate of each group.

[0031] Figure 6 HE staining of gingival and alveolar bone tissues of mice after G3T19-mPEG treatment of periodontitis in the Pg-induced periodontitis mouse model.

[0032] Figure 7 To observe the expression of periodontitis-related inflammatory cytokines such as IL-1β, IL-6, and TNF-α in the periodontal tissues of mice after G3T19-mPEG treatment of periodontitis in a Pg-induced periodontitis mouse model, immunohistochemistry was used to detect the expression of periodontitis-related inflammatory cytokines such as IL-1β, IL-6, and TNF-α in the periodontal tissues of mice.

[0033] Figure 8 To observe the TRAP staining analysis of osteoclasts in the alveolar bone tissue of mice after G3T19-mPEG treatment of periodontitis in a Pg-induced periodontitis mouse model.

[0034] Fig. 9 To observe the alveolar bone resorption after G3T19-mPEG treatment of periodontitis in a Pg-induced periodontitis mouse model. Fig. 9 (A) The results of micro-CT scanning and analysis of the maxillary first and second molar segments of mice in each group. Fig. 9(B) Statistical graph of the distance from the cementoenamel junction (CEJ) to the alveolar ridge apex (ABC) of the maxillary first and second molars of mice in each group.

[0035] Fig.10 To observe the effect of G3T19-mPEG on the periodontitis in Pg-induced periodontitis mouse model, we used real-time fluorescence quantitative PCR to analyze osteoblast differentiation and other related indicators in the periodontal tissue of mice. Fig.10 (A) Statistical graph of OCN in each group of mice; Fig.10 (B) Statistical graph of type I collagen in each group of mice.

[0036] Fig.11 To detect the expression of CD44 in G3T19-mPEG in the presence or absence of Pg in vitro and in vivo. Fig.11 (A) is the result of Western Blot detection of CD44 expression in mouse macrophages (BMDMs), osteoclasts (OCs), and osteoblasts (OBs); Fig.11 (B) Immunohistochemistry was used to detect the expression of CD44 in the periodontal tissue of mice after G3T19-mPEG treatment of periodontitis in a Pg-induced periodontitis mouse model.

[0037] Fig.12 To analyze the toxicity of G3T19-mPEG in an in vitro cell model, Fig.12 (A) and (B) The effects of G3T19-mPEG on the proliferation of macrophages, osteoclasts, and osteoblasts were detected by CCK-8 method at 24 hours and 48 hours, respectively.

[0038] Fig.13 This is a result diagram of analyzing the effects of G3T19-mPEG on mouse liver and kidney function indicators, inflammatory factors, etc. in a mouse animal model. Fig.13 (A) is alanine aminotransferase (AST), a liver function-related indicator in serum; Fig.13 (B) is the test result of serum aspartate aminotransferase (ALT), a liver function-related index; Fig.13 (C) is the test result of creatinine, a renal function-related index in serum; Fig.13 (D), (E), and (F) are the detection results of the main inflammatory factors IL-1β, IL-6, and TNF-α in serum, respectively.

[0039] Fig.14 This is a pathological analysis of the effects of G3T19-mPEG on the main organ tissues of mice in a mouse animal model. Fig.14 (A) and (B) are HE staining images of major organ tissues on the 1st day and 14th day after G3T19-mPEG administration, respectively. DETAILED DESCRIPTION

[0040] The present invention is described in detail below with reference to specific embodiments.

[0041] Example 1 Screening out the G-quadruplex G3T19 with the best effect of inhibiting Pg-stimulated macrophage secretion of inflammatory factors

[0042] Experimental methods:

[0043] 1.1 In this application, mouse bone marrow-derived macrophages (BMDMs) were used as a macrophage model, and the specific induction method was as follows.

[0044] (1) Prepare wild-type C57BL / 6J mice (6-8 weeks old, purchased from the Experimental Animal Center of Hubei Medical College);

[0045] (2) After killing the mice, remove the femur and tibia under sterile conditions and remove as much muscle as possible. Disinfect with 75% alcohol, usually spray or soak for one minute, and then rinse with culture medium;

[0046] (3) Take a few milliliters of ice-cold RPMI 1640 culture medium, cut the two ends of the tibia, aspirate the culture medium to flush out the bone marrow cells in the tibia, and linear red bone marrow can be seen. Use a gun to blow slowly to make a single cell suspension; centrifuge at 4°C and 1600rpm for 5 minutes, discard the supernatant, add an erythrocyte lysing agent to lyse the red blood cells. The erythrocyte lysing should not exceed one minute. Take at least 5 times the volume of the erythrocyte lysing agent (including serum, etc.), wash twice at 4°C and 1600rpm, and finally resuspend and count with DMEM culture medium. The final bone marrow cells of each tibia are about 8-10 million, and the resuspension volume is about 4-5mL, that is, the concentration is 2 million / mL. Count after diluting once;

[0047] (4) Calculate the number of wells required for a six-well plate. If only three wells are needed, take 6-7.5 million cells (ensuring 2-2.5 million cells in each well), resuspend them in a final volume of 6 ml of DMEM (i.e., 2 ml per well), then add mouse M-CSF at a final concentration of 20 ng / mL, mix well, and plate 2 ml per well. Culture for three days. Generally, a small number of macrophages can be seen to be successfully induced and attached to the wall after 24 hours.

[0048] (5) After three days, a large number of macrophages can be seen attached to the wall, occupying about half of the visual field under a microscope. Directly aspirate the macrophage supernatant and suspended cells and discard them, add preheated DMEM containing M-CSF (20 ng / mL), and continue culturing for three days. Macrophages can be seen to almost fill the entire visual field under a microscope. Wash the cells three times with ice PBS, add fresh DMEM, use a cell scraper to remove the attached macrophages, count them, and place them on ice for later use;

[0049] 1.2 Cultivation of Porphyromonas gingivalis (Pg).

[0050] (1) Preparation of Pg medium.

[0051] 1) Component 1: Preparation of 0.05% hemin solution: Dissolve 0.04 g NaOH, 0.01 g vitamin K1, and 50 mg hemin in 100 mL deionized water, mix well, adjust the pH to about 7.4, filter with a 0.22 mm filter, and store at 4°C in the dark for later use.

[0052] 2) Component 2: Preparation of BHI medium: weigh 3.6 g of BHI powder (brain heart infusion broth powder), 0.5 g of yeast powder, and 0.04 g of L-cysteine ​​hydrochloride, add deionized water to make the volume to 100 mL, sterilize by high pressure, and cool to obtain component 2.

[0053] 3) Take 1 mL of component 1 and add it to 100 mL of component 2 to obtain Pg liquid culture medium.

[0054] (2) Cultivation of Pg.

[0055] The standard strain of Porphyromonas gingivalis (Pg) ATCC 33277 frozen in our laboratory was revived and added to the above culture medium. Pg was anaerobically cultured at 37°C for three days using an anaerobic culture system (GeneScience) and the concentration was measured.

[0056] 1.3 Experimental groups and stimulation conditions.

[0057] Pg was first inactivated at 65°C for 0.5 h and added to the macrophages obtained in step 1.1 above. The final concentration of Pg was 1×10 5 / mL, and the final concentration of each oligonucleotide G-quadruplex drug added was 5μM. After 48h of stimulation, the cell culture supernatant was collected. The nucleic acid sequence of each oligonucleotide G-quadruplex drug is shown in Table 1:

[0058] Table 1 Nucleic acid sequence list of oligonucleotide G-quadruplex drugs

[0059] Sequence number name Sequence (5'-3') Number of bases (bp) SEQ ID NO.1 CRO GACCCTCCCTCCCTCCCAG 19 SEQ ID NO.2 G3T19 CTGGGTGGGTGGGTGGGTC 19 SEQ ID NO.3 AS1411 GGTGGTGGTGGTTGTGGTGGTGGTGG 26 SEQ ID NO.4 CatG4 TGGGTAGGGCGGGTTGGGAAA 21 SEQ ID NO.5 EAD2 CTGGGAGGGAGGGAGGGA 18 SEQ ID NO.6 HT22 AGGGTTAGGGTTAGGGTTAGGG 22 SEQ ID NO.7 TBA GGTTGGTGTGGTTGG 15 SEQ ID NO.8 [B7]-3-0 ATTGGGAGGGATTGGGTGGG 20 SEQ ID NO.9 PS2.M GTGGGTAGGGCGGGTTGG 18

[0060] 1.4 Use ELISA detection kit to detect the concentration of cytokines IL-1β and IL-6 in the above cell culture supernatant.

[0061] (1) Add the collected supernatant and the diluted gradient concentration standard to the corresponding pre-coated wells (100 μL / well) and incubate in a 37°C incubator for 90 min;

[0062] (2) Add 300 μL of washing solution to each well, shake on a shaker for 2 min, and pat dry on a thick layer of absorbent paper. Repeat the washing process 4 times and shake off all the liquid in the wells.

[0063] (3) Dilute the biotinylated IL-1β or IL-6 antibody with antibody diluent at a ratio of 1:100, add the diluted antibody to the wells (100 μL / well), incubate in a 37°C incubator for 60 min, and then wash the plate four times. The washing method is the same as step (2);

[0064] (4) Dilute the enzyme conjugate (horseradish peroxide-labeled streptavidin) and enzyme conjugate diluent at a ratio of 1:100, add the diluted solution to the wells (100 μL / well), incubate in a 37°C incubator for 30 min, and then wash the plate 5 times. The washing method is the same as step (2);

[0065] (5) Add 100 μL / well of colorimetric reagent, protect from light, and incubate in a 37°C incubator for 10 min;

[0066] (6) Add 100 μL / well of stop solution, mix well and measure the OD450 value using a microplate reader;

[0067] (7) The obtained results were used to draw a standard curve using Excel software, which was then converted into sample values ​​and statistically analyzed.

[0068] Experimental results:

[0069] The results are as follows Figure 1 As shown, G3T19 significantly inhibited the secretion of IL-1β by Pg-stimulated macrophages ( Figure 1 A) and IL-6 ( Figure 1 B), compared with the group without drug use and the sequence group of other oligonucleotide G-quadruplex drugs, the results were statistically significant, that is, G3T19 had the best effect in inhibiting Pg-stimulated macrophages from secreting inflammatory factors.

[0070] Example 2 Preparation and Characterization of the Novel Nanodrug G3T19-mPEG

[0071] Experimental methods:

[0072] 2.1 Preparation of new nanodrug G3T19-mPEG.

[0073] (1) Synthesis of amino-modified oligonucleotide G3T19 (G3T19-NH2): G3T19 with the sequence of 5'-CTGGGTGGGTGGGTGGGTC-3' was synthesized at the Wuhan Branch of Beijing Qingke Biotechnology Co., Ltd. and amino-modified at the 5' end; at the same time, amino-modified random control oligonucleotide CRO-NH2 (sequence of 5'-GACCCACCCACCCACCCAG-3') was synthesized by the same method. G3T19-NH2 was then covalently coupled with mPEG-COOH (purchased from Chongqing Yusi Pharmaceutical Biotechnology Co., Ltd.).

[0074] (2) Activation of the carboxyl group of mPEG-COOH: Dissolve 200 mg of 5KDa mPEG-COOH in 4 mL of phosphate buffered saline (PBS buffer), shake gently to mix, and after the mPEG-COOH is completely dissolved, add 500 μL of 240 mM carbodiimide hydrochloride (EDC) solution and 1 mL of 60 mM N-hydroxysuccinimide (NHS) solution (the EDC solution and NHS solution can be in excess), and then incubate at room temperature for 30 min to obtain the product mPEG-NHS; then centrifuge at 3000 g and 4°C for 10 min using an ultrafiltration centrifuge tube with a molecular weight cutoff (MWCO) of 5 kDa to remove unreacted EDC and NHS;

[0075] (3) Covalent connection of mPEG-NHS and G3T19-NH2: The purified mPEG-NHS was mixed with excess G3T19-NH2, incubated at 80°C for 10 min, quickly cooled to room temperature, and magnetically stirred at room temperature for 2 h to obtain the product G3T19-mPEG; finally, the product was centrifuged at 3000 g and 4°C for 10 min using an ultrafiltration centrifuge tube with a MWCO of 10 kDa to remove unreacted G3T19 and mPEG-NHS, and the purified mPEG-G3T19 was stored at 4°C;

[0076] (4) CRO-NH2 and mPEG-COOH were covalently coupled and purified using the same method to obtain the control drug CRO-mPEG.

[0077] 2.2 Characterization and detection of the new nanodrug G3T19-mPEG.

[0078] G3T19-mPEG was dissolved in PBS, and then the morphology of G3T19-mPEG was observed by transmission electron microscopy (TEM); the particle size of G3T19-mPEG was detected by particle size and potential analyzer. The UV-visible absorption spectrum of G3T19-mPEG was detected by UV-visible spectrophotometer.

[0079] Experimental results:

[0080] The morphology of mPEG-G3T19 under electron microscope is as follows Figure 2 As shown in (A), the results show that at the same magnification, G3T19 becomes larger after coupling with mPEG; Figure 2 As shown in (B), the particle size range of G3T19 is 30nm-50nm, the particle size range of mPEG-COOH is 50nm-141nm, and the particle size range of G3T19-mPEG is 78nm-190nm, indicating that the particle size of G3T19 increases after coupling with mPEG. Figure 2 As shown in (C), the new drug G3T19-mPEG has absorption peaks near 200nm, 210nm, 260nm and 404nm, respectively, while mPEG-COOH alone does not have characteristic peaks at 210nm, 260nm and 404nm, and G3T19 alone does not have a characteristic peak near 210nm. The absorption peak near 210nm is the characteristic peak after G3T19 and mPEG are coupled through an amide bond.

[0081] The above results indicate that G3T19 and mPEG were successfully coupled, that is, the new drug G3T19-mPEG was successfully prepared.

[0082] Example 3 Effect of the novel nanodrug G3T19-mPEG on the secretion of inflammatory cytokines by macrophages

[0083] Experimental methods:

[0084] 3.1 Induce macrophage BMDMs according to the method in Example 1 for use.

[0085] 3.2 Experimental groups and stimulation conditions.

[0086] Pg was first inactivated at 65°C for 0.5 h and then added to macrophages (prepared in Example 1). The final concentration of Pg was 1×10 5 / mL, G3T19-mPEG and control group drug CRO-mPEG were added at final concentrations of 0, 1, 2, 5, 10, and 20 μM, respectively. The experimental group drug G3T19-mPEG and the control group drug CRO-mPEG were prepared according to the method of Example 2. After 48 hours of stimulation, the cell culture supernatant was collected.

[0087] 3.3 The concentrations of cytokines IL-1β, IL-6, and TNF-α in the cell culture supernatant were detected using an ELISA detection kit in the same manner as in Example 1.

[0088] Experimental results:

[0089] The results are as follows Figure 3 As shown, G3T19-mPEG at a concentration higher than 5 μM significantly inhibited the secretion of IL-1β by Pg-stimulated macrophages ( Figure 3 A in), IL-6 ( Figure 3 B), TNF-α ( Figure 3 The results were statistically significant, while the control group CRO-mPEG could not inhibit Pg-stimulated macrophages from secreting IL-1β, IL-6, and TNF-α. Figure 3 In the following examples, unless otherwise specified, the concentrations of G3T19-mPEG and the control group CRO-mPEG were both 5 μM.

[0090] Example 4 Effect of the novel nanodrug G3T19-mPEG on osteoclast precursor cell differentiation

[0091] Experimental methods:

[0092] 4.1 Induction method and experimental grouping.

[0093] (1) Prepare wild-type C57BL / 6J mice (purchased from the Experimental Animal Center of Hubei Medical College). Take the femur and tibia of 4-8 week-old mice, cut the two ends of the bones, and use a 5 mL syringe to aspirate the culture medium to flush out the bone marrow until the bones turn white. No centrifugation is required, and no red blood cells need to be lysed. Filter with a 70 μm filter. Place the filtered cell suspension in a 100 mm culture dish, add M-CSF (colony stimulating factor-1) with a final concentration of 10 ng / mL, and culture in an incubator;

[0094] (2) The next day: (16-24 hours later) directly transfer the culture medium containing suspended cells to a new culture dish, add M-CSF to 30 ng / mL and continue culturing;

[0095] (3) Day 4: discard the culture supernatant, wash twice with PBS, and add fresh culture medium (25 ng / mL M-CSF) for further culture;

[0096] (4) Day 5: At this time, the monocytes have grown to about 60%-70% and can be plated. Discard the supernatant, wash twice with PBS, digest with trypsin for 5 minutes, and then use a pipette to blow down to see if they can be blown down (if they can be blown down, it means that the cells are in poor condition and it is not recommended to use this cell induction). If they cannot be blown down, use a cell scraper to gently scrape the cells (digest first and then scrape because it is easier to scrape and the cells are not easily damaged). Collect the cells and centrifuge at 1000-1500 rpm at 4°C for 5 minutes. Discard the supernatant and resuspend in 2-3 mL of culture medium. Stain with trypan blue and count. Plate the cells in a 48-well plate with 2000-3000 naive monocytes per well.

[0097] (5) Pg was first inactivated at 65°C for 0.5 h and then added to the mononuclear cells obtained in step (4) above. The final concentration of Pg was 1×10 5 / mL. The groups were as follows: untreated group, Pg stimulation group, Pg+G3T19-mPEG group and Pg+CRO-mPEG group. The final concentration of M-CSF was 20ng / mL;

[0098] (6) Day 7: After changing the medium, add M-CSF with a final concentration of 20 ng / mL and RANKL (receptor activator of nuclear factor κB ligand) at 100 ng / mL to start induction, which is the first day of induction (induction after three days of attachment is better than induction after two days of attachment. If the density is appropriate after two days of attachment, induction can also be started after two days of attachment). Prepare four groups of cells, divided into uninduced group (naive monocytes), induced group (Induced OC), induced group + G3T19-mPEG, and induced group + CRO-mPEG.

[0099] (7) After that, the medium should be changed every two days (no need to wash with PBS). After five days of induction, the medium should be changed every day. Multinucleated giant cells will appear around the ninth day of induction (vacuolar-like cells with irregular shapes but no protrusions can be seen under a light microscope). It is not advisable to induce for too long (osteoclasts will begin to die after about two or three days of formation); if there is no sign of differentiation on the twelfth day of induction, the induction can be abandoned.

[0100] 4.2 Tartrate-resistant acid phosphatase (TRAP) staining of osteoclasts.

[0101] When cells with irregular shapes and significantly larger volumes than the surrounding monocytes can be seen under a light microscope, these cells are osteoclasts (OCs) and can be stained with TRAP. The staining steps are as follows:

[0102] (1) The culture supernatant of each well was aspirated and frozen at -80°C for subsequent related tests; the cell culture plate was allowed to dry naturally (or placed in a 37°C oven for about 5 minutes);

[0103] (2) Fix with TRAP fixative at 2-8°C for 1-3 min;

[0104] (3) Rinse once with PBS and dry slightly (not too dry);

[0105] (4) Add 150-200 μL TRAP incubation solution to each well and place in a 37°C incubator for 45-60 min.

[0106] (5) Restaining: After rinsing with PBS 1-2 times, stain with hematoxylin staining solution (100-120 μL per well) for 5-8 min, and then return to blue with tap water for 10 min; or stain with methyl green staining solution (100-120 μL per well) for 2-3 min;

[0107] (6) Rinse 1-2 times with 1× PBS, dry, and observe the staining results under an inverted microscope (cells with purple-red cytoplasm and ≥3 nuclei are positive cells or osteoclasts).

[0108] 4.3 ELISA detection of TRAP in osteoclast lysate.

[0109] (1) Sample preparation: At the end of osteoclast induction, osteoclasts were lysed with cell lysis buffer (the lysis buffer should not contain phosphatase inhibitors), followed by centrifugation to obtain the supernatant as the test sample, which was stored at -80°C (to avoid repeated freezing and thawing);

[0110] (2) Mix the detection buffer, sample and chromogenic substrate solution according to the instructions (the detection buffer and chromogenic substrate solution are prepared according to the instructions and are prepared before use), and incubate at 37°C for 5-10 minutes (when the activity of tartaric acid phosphatase in the sample to be tested is low, the incubation time can be appropriately extended to 30 minutes);

[0111] (3) Add 160 μL of reaction stop solution to each well to terminate the reaction. The wells with tartrate acid phosphatase activity will show different shades of yellow.

[0112] (4) Measure the absorbance at 405 nm. If it cannot be measured immediately, it can be completed within a few hours (if the sample contains highly active tartrate-resistant acid phosphatase, it can be diluted with PBS or the detection buffer in the kit), and perform statistical analysis.

[0113] 4.4 ELISA detection of osteoprotegerin (OPG) in osteoclast lysate.

[0114] (1) Sample preparation: The osteoclasts of each group at the end of osteoclast induction were lysed with cell lysis buffer and centrifuged to obtain the supernatant as the cell lysate sample;

[0115] (2) Add cell lysis samples and 100 μL / well of the diluted standard sample at gradient concentrations to the ELISA plate and incubate at 37°C for about 90 min;

[0116] (3) Add 100 μL / well of anti-OPG biotinylated antibody working solution (dilute the concentrated biotinylated antibody with antibody diluent at 1:100 according to the required amount) and incubate at 37°C for about 60 min;

[0117] (4) Wash the plate three times with washing solution (dilute the concentrated washing solution with deionized water at a ratio of 1:24 according to the required amount) (shake off all the liquid in the wells, pat dry on a thick stack of absorbent paper, add 300 μL of washing solution to each well, soak for 1-2 minutes, shake off all the liquid, and repeat this step);

[0118] (5) Add 100 μL / well of enzyme conjugate (horseradish peroxide-labeled streptavidin) working solution (dilute the concentrated enzyme conjugate with enzyme conjugate diluent at 1:100 according to the required amount) and incubate at 37°C for about 30 min;

[0119] (6) Wash the plate 5 times, using the same method as step (4);

[0120] (7) Add 100 μL / well of colorimetric reagent and incubate at 37°C in the dark for 10-20 min;

[0121] (8) Add 100 μL / well of stop solution and measure OD with an ELISA reader immediately after stop. 450 nm, Excel software was used to draw a standard curve, and the standard curve was used to calculate the sample concentration for statistical analysis.

[0122] Experimental results:

[0123] The results are as follows Figure 4 As shown in the figure, the uninduced group (naive monocytes) had a monocyte morphology and a small size because RANKL was not added for induction. However, after RANKL was added for induction, irregular morphology and large multinucleated giant cells appeared, which were osteoclasts (OC), indicating that OC induction was successful. However, the addition of G3T19-mPEG significantly inhibited the differentiation of osteoclasts, while CRO-mPEG in the control group could not inhibit the differentiation of osteoclasts ( Figure 4 In addition, the number of osteoclasts (OC) in the Pg stimulation group was significantly greater than that in the non-Pg group, and G3T19-mPEG significantly inhibited the Pg-induced osteoclast differentiation, while CRO-mPEG in the control group could not inhibit the Pg-induced osteoclast differentiation ( Figure 4 A in the figure); Since the uninduced group (naive monocytes) was not induced by RANKL, it was a mononuclear cell, so the concentrations of TRAP and OPG, which are important indicators of successful OC induction, were low. After RANKL was added for induction, the concentrations of TRAP and OPG increased significantly, indicating that OC was successfully induced. However, the addition of G3T19-mPEG significantly inhibited the concentrations of TRAP and OPG, while CRO-mPEG in the control group could not inhibit the concentrations of TRAP and OPG. In addition, the concentrations of TRAP and OPG in the Pg stimulation group were significantly higher than those in the non-Pg treatment group, and G3T19-mPEG significantly inhibited the TRAP induced by Pg stimulation ( Figure 4 B) and OPG( Figure 4 The concentration of C) in the control group increased, and the difference was statistically significant, while the control group CRO-mPEG had no obvious effect on the concentration of TRAP and OPG.

[0124] Figure 4The results showed that G3T19-mPEG could not only directly inhibit the differentiation of osteoclast precursor cells, but also downregulate the effect of Pg in promoting the differentiation of osteoclast precursor cells.

[0125] Example 5 Effect of the novel nanodrug G3T19-mPEG on osteoblast differentiation

[0126] Experimental methods:

[0127] 5.1 Induction method and experimental grouping.

[0128] (1) Extraction of bone marrow mesenchymal stem cells (MSC): SPF-grade four-week-old C57BL / 6J mice were euthanized and soaked in 75% alcohol for 15 min. The alcohol-soaked C57 mice were placed in a prone position on a clean bench that was disinfected with ultraviolet light for 30 min. The skin was incised on the posterolateral side of the femur under sterile conditions, and the subcutaneous fat and muscle tissue were bluntly peeled off. The bilateral femurs and tibiae were separated from the knee joints and the claws were cut off. The lower limb muscles and accompanying tissues were thoroughly removed with sterile gauze and placed in sterile PBS. Soak for 10 minutes, then disinfect with 75% alcohol and soak for 1 minute, rinse off the alcohol with PBS, cut off the femoral and tibial metaphysis on both sides with ophthalmic scissors to expose the bone marrow cavity, place in a sterile cell culture dish, use a 5mL syringe to absorb α-MEM cell culture fluid containing 15% fetal bovine serum to repeatedly rinse the bone marrow cavity, repeatedly blow the flushed bone marrow with a sterile syringe until the bone turns white, blow with a syringe to fully disperse the bone marrow cells into a single cell suspension; filter the collected cell suspension with a filter to remove blood stains and bone residues. Inject the single cell suspension (naive MSCs) into a 25cm 2 The culture flask was placed in a cell culture incubator at 37°C and 5% CO2.

[0129] (2) Isolation and culture: Replace the culture medium with fresh medium every 18-24 hours for the first 3 days, discard the suspended cells, but do not rinse. After 72 hours, rinse with PBS and replace with fresh culture medium. Thereafter, change the medium once every 3 days. This cell generation is recorded as P0. When the cells grow to 70%-80% confluence, digest them with trypsin for passage. The primary cell generation is recorded as the first generation (P1);

[0130] (3) Osteogenesis induction: When the cells were passaged to the third generation and the degree of confluence of mouse bone marrow mesenchymal stem cells reached 80-90%, they were digested with 0.25% trypsin and the cells were counted and counted according to 2×10 4 cell / cm 2The cells were inoculated in a 12-well plate at a density of 1 mL of complete mesenchymal stem cell culture medium per well and cultured in a cell culture incubator at 37°C and 5% CO2. When the cell confluence reached 70%-80%, the bone marrow mesenchymal stem cell osteogenic differentiation medium containing inducers 10 mmol / L sodium β-glycerophosphate, 0.1 μmol / L dexamethasone, 50 mg / L vitamin C, and 10% fetal bovine serum was used, and the medium was changed every three days. The induced groups were as follows: untreated group, Pg stimulation group, Pg+G3T19-mPEG group, and Pg+CRO-mPEG group (control group). Four groups of cells were prepared, divided into uninduced group (naive MSCs), induced group (Induced OB), induced group + G3T19-mPEG, and induced group + CRO-mPEG. After 2-4 weeks of induction differentiation, osteoblasts were identified.

[0131] 5.2 Alizarin red staining of osteoblasts.

[0132] (1) After 14 and 21 days of osteogenic differentiation, discard the differentiation medium and rinse 1-2 times with 1 mL of PBS;

[0133] (2) Aspirate and discard PBS, add 0.5 mL Fixation solution or 4% paraformaldehyde solution to evenly soak the bottom surface. Incubate at room temperature for 30 minutes;

[0134] (3) Aspirate the fixative and add 0.5 mL of Wash I or PBS to rinse the cells 2-3 times;

[0135] (4) Aspirate and discard the washing solution, add 0.5 mL of Alizarin Red staining solution, evenly soak the bottom surface, and stain at room temperature for 30 min;

[0136] (5) Aspirate the Alizarin Red staining solution, add 0.5 mL Wash II solution or PBS, and rinse the cells 2-3 times;

[0137] (6) Aspirate Wash II and add 1 mL of Inspection Solution or PBS. Place the bone under a microscope and observe that the calcified bone nodules will appear red or orange after combining with the Alizarin Red dye. Take a photo.

[0138] 5.3 Alkaline phosphatase staining of osteoblasts.

[0139] (1) After 14 and 21 days of osteogenic differentiation, discard the differentiation medium and rinse 1-2 times with 1 mL of PBS;

[0140] (2) Aspirate and discard PBS, add 0.5 mL of 4% paraformaldehyde solution, and evenly soak the bottom surface. Let it stand and fix at room temperature for 20 minutes;

[0141] (3) Aspirate the fixative, add 0.5 mL of PBS, and rinse the cells 3-5 times, each time for 3-5 minutes;

[0142] (4) After washing, discard the washing solution, add BCIP / NBT staining working solution (prepare the BCIP / NBT staining working solution in advance according to the instructions of the instruction manual based on the sample volume of 0.5 mL / well), evenly infiltrate the bottom surface, incubate at room temperature in the dark for 30 min-24 h, and observe the staining;

[0143] (5) Remove the BCIP / NBT staining solution and wash with PBS 1-2 times to terminate the color development reaction;

[0144] (6) Observe the staining conditions under a microscope (the appearance of insoluble dark blue to blue-purple precipitates in the cytoplasm indicates osteoblasts) and take photos.

[0145] 5.4 ELISA detection of osteocalcin (OCN) in osteoblasts.

[0146] (1) Sample preparation: After 14 and 21 days of osteogenic differentiation, the osteogenic differentiation culture supernatant of each group in the 12-well plate was collected and centrifuged at 12000 rpm for 10 min. The supernatant was retained as the sample;

[0147] (2) Add 50 μL / well of the sample and the diluted standard at gradient concentrations to the ELISA coated plate, gently shake to mix without touching the well wall, seal the plate with a sealing film, and incubate at 37°C for 30 min;

[0148] (3) Wash the plate 5 times: Carefully peel off the sealing film, discard the liquid, spin dry, fill each well with washing solution (300 μL), let it stand for 30 seconds and then discard, repeat 5 times, and pat dry;

[0149] (4) Add 50 μL of biotin-labeled anti-OCN antibody reagent (diluted 1:100 with antibody diluent) to each well, seal the plate with a sealing film, and incubate at 37°C for 30 min;

[0150] (5) Wash the plate 5 times, using the same method as step (3);

[0151] (6) First add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix, and incubate at 37°C in the dark for 10 min.

[0152] (7) Add 50 μL of stop solution to each well to terminate the reaction and measure the absorbance (OD value) at a wavelength of 450 nm within 15 min. Draw a standard curve based on the standard concentration and OD value, calculate the sample concentration, and perform statistical analysis.

[0153] 5.5 ELISA detection of type I collagen (Collagen I) in osteoblasts.

[0154] (1) Sample preparation: After 14 and 21 days of osteogenic differentiation, the osteogenic differentiation culture supernatant of each group in the 12-well plate was collected and centrifuged at 12000 rpm for 10 min. The supernatant was retained as the sample;

[0155] (2) Add 50 μL / well of the sample and the diluted standard at gradient concentrations to the ELISA coated plate, gently shake to mix without touching the well wall, seal the plate with a sealing film, and incubate at 37°C for 30 min;

[0156] (3) Wash the plate 5 times: Carefully peel off the sealing film, discard the liquid, spin dry, fill each well with washing solution (300 μL), let it stand for 30 seconds and then discard, repeat 5 times, and pat dry;

[0157] (4) Add 50 μL of biotin-labeled anti-collagen I antibody reagent (diluted 1:100 with antibody diluent) to each well, seal the plate with a sealing film, and incubate at 37°C for 30 min;

[0158] (5) Wash the plate 5 times (same method as step 3);

[0159] (6) First add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix, and incubate at 37°C in the dark for 10 min.

[0160] (7) Add 50 μl of stop solution to each well to terminate the reaction and measure the absorbance (OD value) at 450 nm within 15 min. Draw a standard curve based on the standard concentration and OD value, calculate the sample concentration, and perform statistical analysis.

[0161] Experimental results:

[0162] The results are as follows Figure 5 As shown in the figure, the uninduced group (naive MSCs) maintained the morphology and characteristics of bone marrow mesenchymal stem cells because no osteoblast inducer was added, and the alizarin red staining could not stain them. After the induction agent was added, the obviously red cells appeared, which were osteoblasts (OB), indicating that the OB induction was successful. However, the addition of G3T19-mPEG further promoted the differentiation of osteoblasts, while CRO-mPEG in the control group could not promote the differentiation of osteoblasts ( Figure 5 In addition, the number of osteoblasts (OB) in the Pg stimulation group was significantly less than that in the group without Pg treatment, indicating that Pg can inhibit the differentiation of osteoblasts, and G3T19-mPEG can reverse the inhibitory effect of Pg on osteoblast differentiation, while CRO-mPEG in the control group cannot reverse the inhibitory effect of Pg on osteoblast differentiation ( Figure 5 A in the figure); alkaline phosphatase staining ( Figure 5 B) in Figure 5 shows a similar trend to that of Alizarin Red staining.

[0163] Since the uninduced group (naive MSCs) was not induced by osteoblast induction agents, it was mesenchymal stem cells, so OCN ( Figure 5 C) and Collagen I ( Figure 5 The concentration of OCN and Collagen I in the Pg stimulation group was low, while the concentrations of OCN and Collagen I increased significantly after the addition of the inducer, indicating that OB was successfully induced. However, the addition of G3T19-mPEG could further increase the concentrations of OCN and Collagen I, while CRO-mPEG in the control group could not further increase the concentrations of OCN and Collagen I. In addition, the concentrations of OCN ( Figure 5 C) and Collagen I ( Figure 5 The concentration of OCN and Collagen I in the control group was significantly lower than that in the group without Pg treatment. The concentrations of OCN and Collagen I increased significantly after G3T19-mPEG treatment, and the difference was statistically significant. However, CRO-mPEG in the control group had no significant effect on the concentrations of OCN and Collagen I ( Figure 5 C and Figure 5 D).

[0164] Figure 5 The results showed that G3T19-mPEG not only promoted the differentiation of osteoblasts, but also reversed the inhibitory effect of Pg on osteoblast differentiation.

[0165] Example 6 In vivo experiment of new nano drug (G3T19-mPEG) in mice

[0166] 6.1 Construction and grouping of mouse periodontitis model

[0167] (1) Twenty-four female C57 / B6L mice (age: 6-8 weeks, purchased from the Experimental Animal Center of Hubei Medical College) were randomly divided into 4 groups, with 6 mice in each group;

[0168] (2) Cultivate Pg and adjust the concentration to 1×10 9 / mL, resuspended in PBS. Anesthetize the mice with 1% sodium pentobarbital (using a concentration of 50 mg / kg), take 100 μL and inject it into the posterior gums of C57 / B6 mice for 14 consecutive days. After about 21 days of feeding, if the mice show symptoms such as red and swollen gums and loose teeth, it indicates that the modeling is successful.

[0169] (3) Mice were anesthetized with 1% sodium pentobarbital (concentration of 50 mg / kg) and treated by local injection into the posterior gums of each group of mice. Mice had free access to drinking water and food (regular diet) during the experiment. The treatment was continued for 15 days, once a day. The groups were as follows:

[0170] Table 2. Grouping and treatment of mice

[0171]

[0172] 6.2 HE staining of mouse periodontal tissue.

[0173] Experimental methods:

[0174] (1) Slice preparation: Mouse periodontal tissue was obtained, colon tissue was fixed with 4% paraformaldehyde, and then routinely paraffin-embedded, and then 4 μm slices were prepared;

[0175] (2) Slice drying: Flatten the slices in hot water, attach them to a glass slide, and dry them in a 45°C thermostat.

[0176] (3) Dewaxing the paraffin sections to water: sequentially place the sections in xylene I for 10 min, xylene II for 10 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% alcohol for 5 min, 90% alcohol for 5 min, 80% alcohol for 5 min, 70% alcohol for 5 min, and wash with distilled water;

[0177] (4) Hematoxylin staining of cell nuclei: sections were stained with hematoxylin for 6 min, washed with tap water, then differentiated with 1% hydrochloric acid alcohol for a few seconds, rinsed with tap water, blued with 0.6% ammonia solution, and rinsed with running water;

[0178] (5) Eosin staining of cytoplasm: Slice into eosin staining solution for 2 min;

[0179] (6) Dehydration and sealing: Dehydrate the slices in 95% alcohol I for 5 min, 95% alcohol II for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, xylene I for 5 min, and xylene II for 5 min. Take the slices out of xylene, dry them slightly, and seal them with neutral gum.

[0180] (7) Examination under an upright microscope: The stained sections are analyzed based on the morphology of the gingival junctional epithelium, periodontal attachment, inflammatory cell infiltration, alveolar bone resorption, and hemorrhagic congestion.

[0181] Experimental results:

[0182] The results are as follows Figure 6As shown, the overall appearance of the periodontal tissue in the non-induced group (normal mice) showed no obvious abnormalities, the thickness of the gingival junction epithelium was uniform, the periodontal attachment was normal, there was no obvious inflammatory cell infiltration, no alveolar bone absorption, and no red blood cell infiltration; the gingival junction epithelium in the Pg-induced group and the Pg+CRO-mPEG group proliferated in a mesh-like manner, the periodontal attachment was lost, the periodontal tissue had inflammatory cell infiltration, the alveolar bone structure was absorbed, and vascular dilation and congestion were visible; the gingival junction epithelium in the Pg+G3T19-mPEG group had mild hyperplasia, mild periodontal attachment loss, a small amount of inflammatory cell infiltration in the periodontal tissue, mild absorption of the alveolar bone structure, and no obvious vascular dilation and congestion.

[0183] The above-mentioned periodontal pathology analysis results of mice showed that G3T19-mPEG had a significant effect on the treatment of periodontitis.

[0184] 6.3 Immunohistochemical detection of macrophage infiltration in rat gingival tissue and expression of major periodontitis-related inflammatory cytokines such as IL-1β, IL-6, and TNF-α

[0185] Experimental methods:

[0186] (1) Preparation of paraffin sections and room temperature dewaxing and hydration: Gingival tissue blocks of the maxillary first and second molars were obtained from each group of periodontitis model mice to prepare paraffin sections. The preparation, dewaxing and hydration methods were the same as those for HE staining;

[0187] (2) Hot antigen repair: Replace the slice rack with a new one and put the hydrated slices in. Prepare antigen repair solution (one pack of sodium citrate powder to 2 liters of PBS solution), heat and boil in an iron lunch box or pot, and control the temperature at 96-98°C. Then put the slices in the hot pot for 15 minutes, and finally cool naturally to room temperature. Soak in PBS for five minutes, twice in total, and soak in distilled water for three minutes, twice in total;

[0188] (3) Immunohistochemistry pen circle: Take out the tissue, shake dry, and use absorbent paper to absorb the water droplets. Use a histochemistry pen to draw a circle around the tissue, making the circle complete;

[0189] (4) Inactivation of endogenous enzyme activity: Place the slices in a wet box, add a small amount of distilled water, add 3% hydrogen peroxide (one drop or 50 μl, see the secondary antibody instructions for dosage), incubate at room temperature for 10 minutes. Soak in PBS for three minutes, three times in total, and wash with distilled water for three minutes;

[0190] (5) Block nonspecific sites: shake off the water, absorb the water droplets, add goat serum blocking solution (one drop or 50 μL), place in a wet box, and incubate at room temperature for 10 minutes;

[0191] (6) Discard the blocking solution, add the corresponding primary antibody to cover the tissue, and then place it in a humidified box at 4°C overnight;

[0192] (7) The next day, take out the wet box from the 4-degree refrigerator, warm it to room temperature for 30 minutes, soak it in PBS for three minutes, three times in total, and wash it with distilled water for three minutes.

[0193] (8) Shake off the water, absorb the water droplets, add one drop of secondary antibody or 50 μL, and incubate at room temperature for 60 minutes. Soak in PBS for three minutes, three times in total; wash with distilled water for three minutes;

[0194] (9) Add one drop or 50 μL of streptavidin-peroxidase solution to each slide, incubate at room temperature for 10 minutes, soak in PBS for three minutes, three times, and wash with distilled water for three minutes;

[0195] (10) Add two drops or 100 μl of DAB solution to each slide and observe under a microscope for 3 to 10 minutes. Stop staining when staining is appropriate and rinse with tap water;

[0196] (11) Counterstain with hematoxylin for 1 to 2 minutes until the cell nucleus turns blue. Rinse with tap water or PBS to reverse the blue (0.5% ammonia solution can be used to reverse the blue).

[0197] (12) Hydrochloric acid alcohol (1%) for 3 seconds, then rinse with tap water for 3 minutes;

[0198] (13) Dehydration: 75% alcohol for 1 minute, 80% alcohol for 1 minute, 95% alcohol for 2 minutes, anhydrous ethanol for 4 minutes, xylene No. 1 for 3 minutes, and xylene No. 2 for 3 minutes;

[0199] (14) After the slides are dried, add an appropriate amount of neutral gum to seal the slides, cover with a coverslip, and let dry.

[0200] (15) Observe the staining results under a microscope and take photos.

[0201] Experimental results:

[0202] The results are as follows Figure 7 As shown in the data, there was no obvious macrophage infiltration in the gingival tissue of the non-induced group, and the expression levels of inflammatory cytokines such as IL-1β, IL-6, and TNF-α were low; the gingival tissue of the Pg-induced group had obvious and varying degrees of macrophage infiltration, and the expression levels of the above-mentioned inflammatory mediators were significantly increased; G3T19-mPEG could significantly improve the macrophage infiltration in the Pg-induced gingival tissue and inhibit the expression of the above-mentioned inflammatory mediators; while CRO-mPEG had no obvious effect on the macrophage infiltration of the gingival tissue and the expression of inflammatory mediators.

[0203] 6.4 TRAP staining analysis of mouse molar segments

[0204] Experimental method: The left maxillary bone, especially the alveolar bone and tooth, was fixed and embedded in paraffin, and sagittal sections were made along the long axis of the bone and stained with the TRAP activity staining kit. The details are as follows:

[0205] (1) Preparation of paraffin sections: The left maxillary bones, especially the alveolar bones and teeth, were obtained from each group of periodontitis model mice, fixed, and embedded in paraffin. Sagittal sections were made along the long axis of the bones to prepare paraffin sections using the same method as H&E staining.

[0206] (2) Dewaxing with xylene for 5 to 10 min, using the same method as H&E staining.

[0207] (3) The sections were placed in anhydrous ethanol for 5 min, 90% ethanol and 70% ethanol for 2 min each, and then washed with distilled water for 2 min.

[0208] (4) Allow to dry naturally and fix with TRAP fixative at 2-8°C for 1-3 min.

[0209] (5) Wash with water and dry slightly (not over-drying).

[0210] (6) Place the slices in TRAP incubation solution, place in a 37°C incubator, soak for 45-60 minutes, and then wash with water.

[0211] (7) Restaining: Stain with hematoxylin solution for 5 to 8 minutes, blue with tap water for 10 minutes, or stain with methyl green solution for 2 to 3 minutes.

[0212] (8) Wash with water, dry and observe the staining results under a fluorescent inverted microscope (white light).

[0213] Experimental results:

[0214] The results are as follows Figure 8 As shown, there were almost no osteoclasts or very few osteoclasts in the alveolar bone and tooth tissue of the non-induced group; there was a significant increase in osteoclasts (red) in the alveolar bone and tooth tissue of the Pg-induced group; G3T19-mPEG could significantly inhibit the increase in osteoclasts induced by Pg; while CRO-mPEG had no significant effect on the number of osteoclasts in the alveolar bone and tooth tissue.

[0215] 6.5 Micro-CT scanning and analysis of mouse molar segments.

[0216] Experimental methods:

[0217] After intraperitoneal injection of 1.0% sodium pentobarbital (0.1 ml / 20 g) to anesthetize mice, the entire maxilla of C57 / B6L mice was removed, and all soft tissues were removed. The maxilla was scanned and analyzed using a small animal in vivo Micro-CT imaging system. After scanning the maxilla, the reconstructed bone surface image was used for three-dimensional tissue morphology analysis. The specific steps are as follows:

[0218] (1) Fix in supine position and expose the maxilla;

[0219] (2) The heart was perfused with 4% paraformaldehyde for about 5 minutes;

[0220] (3) The entire maxillary tissue was collected by cutting the oral cavity, boiled in boiling water for 10 minutes, and then brushed clean of residual soft tissue, bleached with 3% hydrogen peroxide, stained with 1% methylene blue for 5 minutes, and then rinsed with clean water to remove residual dye;

[0221] (4) The first and second molar segments of the right maxillary teeth were taken, and the images of the maxillary buccal and palatal sagittal planes were captured using a small animal in vivo Micro-CT imaging system scanner;

[0222] (5) Image J was used to measure the distance from the cementoenamel junction to the alveolar bone crest of the distal end of the first molar and the second molar (CEJ-ABC distance).

[0223] Experimental results:

[0224] The results are as follows Fig. 9 As shown in the figure, the Pg-induced mice had obvious alveolar bone loss on the buccal and palatal sides of the maxillary first and second molars, while G3T19-mPEG significantly inhibited the Pg-induced alveolar bone loss ( Fig. 9 A in the figure); the CEJ-ABC distance in the Pg-induced group was significantly higher than that in the non-induced group, while the CEJ-ABC distance after G3T19-mPEG treatment was significantly lower than that in the Pg-induced group ( Fig. 9 B); CRO-mPEG had no significant effect on alveolar bone loss and CEJ-ABC distance.

[0225] 6.6 Real-time fluorescence quantitative method was used to detect osteoblast differentiation-related indicators (OCN, Collagen I) in periodontal tissue.

[0226] Experimental methods:

[0227] (1) Gum tissue of mice was obtained, ground with liquid nitrogen, and RNA was extracted.

[0228] (2) Measure the concentration of the extracted RNA and reverse transcribe the RNA into cDNA. The reaction system is as follows:

[0229] 5×PrimeScriptTM Master Mix: 4μL

[0230] RNase Free dH2O: Make up to 20 μL

[0231] 1000ng total RNA:1000 / C(RNA)

[0232] (3) After the reaction system is prepared, the following program is set in the PCR instrument for reaction: 37°C for 15 min (reverse transcription), 85°C for 5 s (inactivation of reverse transcriptase), and the obtained product is diluted 10-fold at 4°C for the subsequent fluorescent quantitative PCR reaction.

[0233] (4) qPCR: The reverse transcription products were subjected to quantitative fluorescence PCR analysis. Three replicate wells were set up in each group. The reaction system was as follows:

[0234] TB Green Fast qPCR Mix(2×): 10μL

[0235] Upstream primer (10 μM): 0.8 μL

[0236] Downstream primer (10 μM): 0.8 μL

[0237] DNA template: 2 μL

[0238] DEPC water: 6.4μL

[0239] Total volume: 20 μL

[0240] The above reaction system was mixed and added to a 96-well qPCR plate. The liquid was mixed and thrown into the bottom of the tube by low-speed centrifugation. The qRT-PCR reaction procedure was: 95℃ pre-denaturation for 30s, 95℃ denaturation for 5s, 60℃ annealing and extension for 10s, and 39 cycles. The relative expression of the target gene (OCN, Collagen I) mRNA in the sample was calculated based on the CT value of the target gene and the CT value of the housekeeping gene GAPDH.

[0241] Experimental results:

[0242] The results are as follows Fig.10 As shown in the figure, compared with the non-induced group, the expression of OCN and Collagen I in the periodontal tissue of the Pg-induced group decreased, while G3T19-mPEG significantly increased the expression of OCN and Collagen I in the periodontal tissue and reversed the Pg-induced increase in OCN in the periodontal tissue ( Fig.10 A in the figure), downregulation of collagen I ( Fig.10 B); CRO-mPEG had no significant effect on the expression of OCN and Collagen I in gingival tissue.

[0243] Example 7 Effects of the novel nanodrug G3T19-mPEG on CD44 expression in macrophages, osteoclasts, osteoblasts and periodontal tissues in vivo

[0244] Experimental methods:

[0245] 7.1 In vitro detection of the effect of G3T19-mPEG on CD44 expression in macrophages (BMDM), osteoclasts (OC), and osteoblasts (OB)

[0246] (1) Macrophages, osteoclasts, and osteoblasts were induced according to the methods in Examples 1, 4, and 5, respectively, and the cells were resuspended in culture medium and concentrated to 4×10 5 The cells were evenly inoculated at a density of 100 μL / well in a 6-well plate for culture. After 4-6 hours of cell adhesion, 800 μL of fresh culture medium was added.

[0247] (2) Experimental groups and stimulation conditions: untreated group, Pg stimulation group, Pg+G3T19-mPEG group, and Pg+CRO-mPEG group. Pg was first inactivated at 65°C for 0.5 h, and the final concentration was 1×10 5 / mL, and the final concentration of each drug was 5 μM.

[0248] (3) In addition, the expression of CD44 in each group was compared in the absence of Pg. The experimental groups and stimulation conditions were: untreated group, G3T19-mPEG group, and CRO-mPEG group. The final concentration of each drug was 5 μM.

[0249] (4) After 48 h of culture, wash the cells twice with PBS, add 150 μL of protein lysis buffer, scrape repeatedly with a pipette tip, place on ice for lysis for 30 min, centrifuge at 12,000 rpm for 15 min at 4°C, carefully aspirate the supernatant, use the BCA kit to detect the protein concentration, then add the corresponding volume of 5× Loading buffer, mix well, and denature at 100°C for 10 min for later use.

[0250] (5) Prepare 10% PAGE gel in advance, add the above protein sample and perform protein PAGE gel electrophoresis.

[0251] (6) After electrophoresis, transfer the proteins on the gel to a PVDF membrane at a constant current of 200 mA for 80 min.

[0252] (7) After transfer, place the PVDF membrane in freshly prepared 5% skim milk and block it at room temperature for 60 min.

[0253] (8) Dilute the PD-L1 primary antibody with 5% skim milk, cut the PVDF membrane and place it in the primary antibody, and incubate it on a shaker at 4°C overnight.

[0254] (9) Wash the membrane three times with TBS-T solution, each time for 10 min. Select a secondary antibody of the same species as the primary antibody, dilute the secondary antibody with 5% skim milk, place the PVDF membrane in the secondary antibody, and incubate on a shaker at room temperature for 60 min. Wash the membrane three times with TBS-T solution, each time for 10 min.

[0255] (10) Drain the residual TBS-T solution on the PVDF membrane, place it on the imager's loading tray, add an appropriate amount of ECL colorimetric solution, and adjust the exposure time according to the exposure results to obtain the ideal exposure image.

[0256] 7.2 Effect of G3T19-mPEG on CD44 expression in periodontal tissues in vivo in a periodontitis mouse model

[0257] The method was the same as that of 6.3 immunohistochemical staining in Example 6 to detect the effect of G3T19-mPEG on the expression of CD44 in periodontal tissues in vivo in a periodontitis mouse model.

[0258] Experimental results:

[0259] The results are as follows Fig.11 As shown in the figure, Pg significantly upregulated the expression of CD44 in macrophages, osteoclasts and osteoblasts, while mPEG-G3T19 significantly inhibited the expression of CD44 in macrophages, osteoclasts and osteoblasts, significantly reversing the upregulation of CD44 by Pg; the control group mPEG-CRO had no significant effect on the expression of CD44 in macrophages, osteoclasts and osteoblasts ( Fig.11 A). In the periodontitis mouse model, a similar trend was observed, i.e., mPEG-G3T19 inhibited the Pg-mediated CD44 expression in periodontal tissues ( Fig.11 B).

[0260] Example 8: Safety analysis of the novel nanomedicine G3T19-mPEG in vivo and in vitro

[0261] 8.1 CCK-8 assay to detect the effect of novel nanodrug (G3T19-mPEG) on the proliferation of macrophages, osteoclasts and osteoblasts

[0262] Experimental methods:

[0263] (1) Macrophages, osteoclasts, and osteoblasts were cultured according to the methods in Examples 1, 4, and 5, respectively, and resuspended in corresponding culture medium and concentrated to 2×10 3 The cells were uniformly inoculated at a density of 1 / well in a 96-well plate for culture (100 μl was added to each well); the groups and stimulation conditions were as follows: untreated group, G3T19-mPEG group, and CRO-mPEG group, with final concentrations of 0, 1, 2, 5, 10, and 20 μM.

[0264] (2) After placing in a 37°C cell culture incubator for 24 h, the medium was changed and corresponding drug stimulation was given according to the grouping;

[0265] (3) 24 or 48 h after stimulation, 5 μL of enhanced CCK-8 solution was added to each well;

[0266] (4) After incubation at 37°C for 1 to 4 h, the absorbance was measured at 450 nm on a microplate reader;

[0267] (5) Statistical analysis was performed on the absorbance of each group using statistical software (GraphPad).

[0268] Experimental results:

[0269] The results are as follows Fig.12 As shown, G3T19-mPEG and CRO-mPEG were stimulated for 24h ( Fig.12 A in), 48h( Fig.12 There was no significant effect on the proliferation of macrophages, osteoclasts and osteoblasts after treatment.

[0270] 8.2 In vivo safety analysis of G3T19-mPEG in mice

[0271] Experimental methods:

[0272] (1) 6-8 week old C57 / B6L female mice were gavaged with 100 μL of oligonucleotide nanodrugs (20 μM) and divided into normal mouse group, G3T19-mPEG treatment group, and CRO-mPEG treatment group. Since the drug will inevitably enter the digestive tract when the final concentration of 5 μM is used for local injection, if no obvious toxicity is found when the drug is gavaged at a concentration of 20 μM, it means that the drug is relatively safe;

[0273] (2) The serum of mice was collected at different time periods to analyze the effects of G3T19-mPEG on liver and kidney function indicators, inflammatory factors, etc. of mice. The expression of inflammatory factors such as alanine aminotransferase, aspartate aminotransferase, creatinine, IL-1β, IL-6, and TNF-α was detected by ELISA. The method was referred to Example 1.

[0274] (3) The hearts, livers, spleens, lungs, kidneys, and brains of mice were collected at different time periods and stained with HE using the same method as 6.2 in Example 6.

[0275] Experimental results:

[0276] like Fig.13 As shown in the mouse animal model, G3T19-mPEG had no significant effect on mouse liver and kidney function indicators, inflammatory factors, etc. Fig.13 (A) is the serum liver function-related index alanine aminotransferase (AST); Fig.13 (B) is the test result of serum aspartate aminotransferase (ALT), a liver function-related index; Fig.13 (C) in the figure is the test result of creatinine, a renal function-related index in serum; Fig.13(D), (E), and (F) are the test results of the main inflammatory factors IL-1, IL-6, and TNF- in serum, respectively.

[0277] Fig.14 This is a pathological analysis of the effects of G3T19-mPEG on the main organ tissues of mice in a mouse animal model. Fig.14 (A) and (B) are HE staining images of major organ tissues on the 1st day and 14th day after G3T19-mPEG administration, respectively. The results showed that G3T19-mPEG had no obvious damage to the heart, liver, spleen, lung, kidney and brain tissues of mice.

[0278] Fig.12 , Fig.13 and Fig.14 The results showed that G3T19-mPEG drug has good safety.

Claims

1. Use of a novel nano drug containing oligonucleotide G3T19 in the preparation of a drug for treating periodontitis, characterized in that: The novel nano drug contains oligonucleotide G3T19, and the oligonucleotide G3T19 contains the nucleotide sequence shown in SEQ ID No.

02.

2. The use according to claim 1, characterized in that: The 5' end of the oligonucleotide G3T19 is connected with mPEG.

3. The use according to claim 1, characterized in that: The molecular weight of the mPEG is 300-10KDa.

4. The use according to claim 1, characterized in that: The novel nano drug also includes a pharmaceutically acceptable carrier.

5. The use according to claim 1, characterized in that: The dosage form of the novel nano drug is one of pharmaceutically acceptable injection preparations, tablets, liquid preparations, dressing preparations, hydrogel preparations, and capsule preparations.

6. The use according to claim 1, characterized in that: The novel nanomedicine further comprises supplementary additives, which are selected from one or more of diluents, buffers, encapsulating agents, excipients, fillers, binders, wetting agents, disintegrants, surfactants, colorants and flavoring agents.

7. A method for preparing a novel nanomedicine containing oligonucleotide G3T19, comprising the following steps: S01. Synthesizing an amino-modified oligonucleotide G3T19, wherein the sequence of the oligonucleotide G3T19 contains the nucleotide sequence shown in SEQ ID No.02, and the 5' end is amino-modified to obtain G3T19-NH2; S02. Activation treatment of the carrier: dissolve an appropriate amount of mPEG-COOH in phosphate buffer, add excess EDC solution and NHS solution, incubate at room temperature, and obtain the product mPEG-NHS after ultrafiltration in a centrifuge tube; S03. Covalently couple G3T19-NH2 with mPEG-COOH and purify it. Mix the purified mPEG-NHS with excess G3T19-NH2 and incubate them. Rapidly cool to room temperature, stir magnetically at room temperature, and finally process through an ultrafiltration centrifuge tube to obtain the product G3T19-mPEG, which is stored at low temperature for future use.

8. The preparation method according to claim 7, characterized in that: The molecular weight of the mPEG is 300-10KDa.

Images