Soybean sauce aspergillus and application thereof in soy sauce fermentation

Abstract

The invention provides a soy sauce aspergillus HSCY6012 which has high yield of glutaminase, neutral protease and saccharifying enzyme and can reduce the beany flavor of finished koji, the soy sauce aspergillus HSCY6012 is preserved in China General Microbiological Culture Collection Center on April 1, 2024, and the preservation number is CGMCC NO.41133. The invention further provides a preparation method of the soy sauce aspergillus HSCY6012. The soy sauce crude oil prepared by the aspergillus sojae strain HSCY6012 in the soy sauce fermentation method has the advantages that the contents of glutamic acid, reducing sugar and ethanol are increased, the contents of pyroglutamic acid, isoamyl alcohol, isovaleraldehyde and 2-amyl furan are obviously reduced, and the quality of the soy sauce is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a soy sauce Aspergillus and application thereof in soy sauce fermentation. Background Art

[0002] Soy sauce, a traditional Chinese fermented condiment, is mainly made from soybeans or soybean meal, wheat and salt water through a long-term mixed fermentation of multiple microorganisms. Its sweet taste and unique aroma add a lot of flavor to people's three meals a day.

[0003] Umami is the main characteristic of soy sauce in terms of flavor. Umami amino acids in soy sauce are the main substances that constitute its umami flavor. The amino acid nitrogen content is the main indicator of the level of umami flavor in soy sauce. Glutamic acid has a distinct umami flavor and is the main umami amino acid in soy sauce. However, about 46% of glutamic acid in soybean meal, the raw material of soy sauce, exists in the form of glutamine, which requires sufficient glutaminase activity to convert it into glutamate. If the enzyme activity is low, glutamine will undergo non-enzymatic carbonization to generate pyroglutamic acid, making the bitterness of soy sauce heavier and losing its umami flavor. Therefore, it is necessary to increase the glutaminase activity in the soy sauce koji to increase the glutamate content in soy sauce.

[0004] In terms of flavor, in addition to its rich aroma and mellow flavor, soy sauce often emits a certain beany smell, which seriously affects the flavor quality of soy sauce. The beany smell of soy sauce mainly comes from the action of lipoxygenase during the processing of soybean meal, which produces aldehydes, alcohols and other fishy substances, mainly isopentanol, isovaleraldehyde, 2-pentylfuran, etc. At present, there is no complete solution to this problem in the industry. Common treatment methods include heat treatment and microbial fermentation.

[0005] The invention patent with patent publication number "CN202211125545.6" discloses a strain of Aspergillus sojae ZA179 and its application. This strain has the characteristics of high tartaric acid metabolism, which significantly improves the sour taste of crude soy sauce and increases the glutamate content. Although the application of this bacterium has increased the glutamate content in soy sauce by 12% and the amino acid nitrogen by 2%, the improvement level is low, and it does not involve the improvement of the activity of glutaminase and saccharifying enzyme in the finished koji prepared by this strain, as well as the effect of reducing the beany smell of soy sauce. The quality of fermented crude oil still needs to be improved.

[0006] Therefore, it is urgent to breed a soy sauce Aspergillus with high production of glutaminase and saccharifying enzyme, which can reduce the beany smell of the finished koji. In the soy sauce fermentation system, the fermentation performance of this strain can be well manifested, so that the glutamate content of the crude soy sauce oil is significantly increased, the pyroglutamate content is significantly reduced, and the content of beany smell substances is significantly reduced, making the soy sauce flavor more mellow. Summary of the invention

[0007] In order to solve the above technical problems, the present invention obtains soy sauce Aspergillus niger with excellent glutaminase, neutral protease and saccharifying enzyme through mutagenesis screening, which can reduce the beany smell of the finished koji. At the same time, it provides a pneumatic stirring sauce mash fermentation tank to promote beneficial fermentation between microorganisms in the sauce mash.

[0008] Specifically, the first aspect of the present invention provides a strain of Aspergillus sojae HSCY6012, characterized in that the Aspergillus sojae is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with a deposit number of CGMCC NO.41133 and a deposit date of April 1, 2024.

[0009] A second aspect of the present invention provides a microbial agent comprising the Aspergillus sojae HSCY6012 described in claim 1.

[0010] The third aspect of the present invention provides use of the soy sauce Aspergillus HSCY6012 described in the first aspect of the present invention and the microbial agent described in the second aspect of the present invention in soy sauce brewing.

[0011] The fourth aspect of the present invention provides a method for brewing soy sauce, which includes raw material screening, steaming, koji making, tank filling, fermentation, pressing, sterilization and optional detection steps; wherein the koji making adopts the soy sauce Aspergillus HSCY6012 described in the first aspect of the present invention or the seed koji prepared by the microbial agent described in the second aspect of the present invention.

[0012] In certain embodiments, the tanking is to suck the finished koji obtained by koji making into a pneumatic stirring sauce and mash fermentation tank, and then add 1.8 times (w / v) the mass of 18°Bé brine, and ventilate and stir evenly.

[0013] In certain embodiments, the pneumatic stirring sauce mash fermentation tank comprises a compressed air inlet pipeline (1), a stirring shaft mechanical seal (2), a feed port (3), a stirring shaft inlet pipeline (4), a stirring paddle (5), a jacket water outlet (6), a rotor flowmeter (7), an air outlet pipeline (8), a stirring shaft (9), a jacket water inlet (10), a sauce mash fermentation tank body (11), and a discharge port (12); the feed port (3), the jacket water outlet (6), the air outlet pipeline (8), the jacket water inlet (10), and the discharge port (12) are connected to the sauce mash fermentation tank body (11), the stirring paddle (5) and the stirring shaft (9) are located inside the sauce mash fermentation tank body (11), and the stirring paddle (5) is connected to the stirring paddle (5). On the stirring shaft (9), the compressed air intake pipeline (1) is connected to the stirring shaft (9) through a stirring shaft mechanical seal (2); the stirring shaft (9) is hollow to form a stirring shaft intake pipeline (4); the rotor flowmeter (7) is located at the upper end of the processing pipeline (8); the stirring paddle (5) comprises a stirring blade (51), an air path (52), and a blade end (53); the stirring blade (51) is fixed on the stirring shaft (9); the blade end (53) is evenly distributed with ventilation holes (54); the ventilation pipeline (4) is connected to the air path (52) on the stirring paddle (5); the ventilation holes (54) on the blade end (53) are connected to the air path (52).

[0014] In certain embodiments, the compressed air passes through the compressed air intake line, enters the stirring shaft mechanical seal (2) and is connected to the stirring shaft intake line (4), and is discharged from the vent hole (54) on the end (53) of the blade after reaching the air path (52), generating a strong reverse thrust to drive the stirring blade (51), thereby making the stirring paddle (5) and the stirring shaft (9) located in the mash fermentation tank (11) move quickly, so that the mash in the mash fermentation tank is fully stirred, and the discharged bubbles are broken by the stirring paddle (5) to have smaller particle size and more uniform distribution, without the need to install a motor to consume electrical energy.

[0015] In certain embodiments, the fermentation includes low-temperature fermentation, warm fermentation and natural fermentation.

[0016] In certain embodiments, the low-temperature fermentation is to control the temperature of the fermentation tank to ≤15°C and ferment for 20 days; the heat preservation fermentation is to maintain the temperature at 30°C, inoculate 5‰ of the mass of the raw material with pre-activated commercial Torulopsis seed liquid on the 25th day of fermentation, and inoculate 5‰ of the mass of the raw material with pre-activated commercial Saccharomyces cerevisiae seed liquid on the 40th day of fermentation, during which time the mixture is ventilated and stirred for 3 minutes every 3 days, and the fermentation is continued at a constant temperature for 90 days; the late natural fermentation is to maintain the temperature below 28°C for continued after-ripening, during which time the mixture is ventilated and stirred for 3 minutes every 8 days, and the fermentation is continued for 180 days to obtain fermented mature sauce mash.

[0017] The fifth aspect of the present invention provides a soy sauce product brewed using the Aspergillus sojae HSCY6012 described in the first aspect of the present invention, the microbial agent described in the second aspect of the present invention, or the preparation method described in the fourth aspect of the present invention.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] (1) The soy sauce Aspergillus strain HSCY6012 provided by the present invention has a fast growth rate, rich spores, strong ability to produce glutamine aminotransferase, neutral protease, and saccharifying enzyme, and can hydrolyze glutamine and sugar substances in the raw materials; the aroma of the koji is prominent, and the content of soybean meal odor substances such as isopentanol, isovaleraldehyde, and 2-pentylfuran in the koji is significantly reduced;

[0020] (2) The soy sauce crude oil prepared by the soy sauce Aspergillus strain HSCY6012 of the present invention in the soy sauce fermentation method has increased glutamic acid, reducing sugar, and ethanol contents, and significantly reduced pyroglutamic acid, isopentanol, isovaleraldehyde, and 2-pentylfuran contents, thereby improving the quality of the soy sauce;

[0021] (3) The present invention provides a pneumatic stirring soy sauce fermentation tank, which is suitable for the application of Aspergillus sylvatica strain HSCY6012 in soy sauce fermentation; the rich enzyme system provided by Aspergillus sylvatica HSCY6012 is used to provide more small molecule nutrients and better stirring conditions for the microorganisms in the soy sauce system, thereby promoting the beneficial fermentation between the microorganisms in the soy sauce, further increasing the content of glutamic acid, amino acid nitrogen, and ethanol in the crude soy sauce, and reducing the content of pyroglutamic acid, isopentanol, isovaleraldehyde, and 2-pentylfuran. The crude soy sauce has no obvious beany smell, bitterness, and mellow soy sauce flavor, and has a better and sweeter taste, and the quality is greatly improved; in the soy sauce fermentation process, compared with motor stirring, pneumatic stirring can not only introduce gas to promote the growth of microorganisms, but also drive paddle stirring to promote the efficiency of the fermentation system, which is more green and energy-saving, and has a better application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0023] Figure 1 This is a growth morphology diagram of Aspergillus sojae HSCY6012 in PDA medium according to an embodiment of the present invention;

[0024] Figure 2 This is a schematic structural diagram of a pneumatic stirring mash fermentation tank according to an embodiment of the present invention;

[0025] Figure 3 The present invention is a schematic diagram of a pneumatic stirring sauce mash fermentation tank stirring paddle structure. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Unless otherwise defined, the technical or scientific terms used herein shall have the common meanings understood by persons with ordinary skills in the field to which the present invention belongs. The words "first", "second" and similar words used in the patent application specification and claims of the present invention do not indicate any order, quantity or importance, but are only used to distinguish different components. Similarly, words such as "one" or "a" do not indicate a quantity limitation, but indicate the existence of at least one.

[0028] Example 1 Isolation and identification of Aspergillus sojae JY4001

[0029] (1) Isolation of bacteria

[0030] Take 2g of soy sauce koji from different sources and add it to 15mL of physiological saline, vortex and shake to mix, draw 200μL of the dilution on the PDA plate, spread it evenly, and place it at 25℃ for culture. After one week, pick the mold colonies and purify them by streaking. After one week of culture, each purified colony is cultured at 25℃ with PDA as the culture medium, and then each strain is picked and planted on the casein culture medium plate (the preparation method of the culture medium is: 10g casein, 10g beef extract powder, 2g disodium hydrogen phosphate, 5g sodium chloride, 15g agar powder dissolved in 1L water and sterilized by high pressure), and select 4 strains with large transparent circle and vigorous mycelium growth.

[0031] (2) Determination of enzyme production performance of strains

[0032] Four soy sauce strains in the laboratory were used as test strains. Two rings were inoculated into bran culture medium (the preparation method of the culture medium was: 50g wheat bran, 5g flour, 50g water, stirred evenly and sterilized). After culturing at 30℃ for 40h, the bottle was inverted and cultured for another 72h. The number of spores in the bran and the activities of saccharifying enzyme and neutral protease were determined.

[0033] After testing, one strain of Aspergillus soy sauce had the largest number of spores among the malt koji, the most obvious koji aroma, and the highest saccharifying enzyme and neutral protease activities, reaching 900u / g and 1600u / g respectively.

[0034] (3) Strain identification

[0035] The strain with high enzyme activity was compared and analyzed in the NCBI database based on the 28S rDNA sequence, and combined with the physiological and biochemical characteristics, the strain of the present invention was named Aspergillus sojae JY4001 (Aspergillus sojae), and its sequence is as follows.

[0036] GCATGATCTCGGATGTGTCCTATTATATCTGCCACGTGTTTGCTAACAACTTTGCAGGCAAACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTACAGCCTGTATACACCTCGAACGACGACCATATGGCATTAGAAGTTGGAATGGATCTGACGGCAAGGATAGTTACAATGGCTCCTCTGATCTCC AGCTGGAGTATGAACGTCTACTTCAACGAGGTGCGTACCTCAAAATTTTCAGCATCTATGAAAACGCTTTACAACCCTGACCGCTTCTCCAGGCCTAGCGGAAACAAGTATGTCCCTCGTGCCGTCCTCGTCGATCTTGAGCCTGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTT CGTTTTCGGCCAGTCCGGTGCGGTAACAACTGGGCCAAGGGTCAC

[0037] (SEQ ID NO: 1)

[0038] Example 2 Mutagenesis Screening of Aspergillus sojae JY4001

[0039] (1) The spores of the mature strain Aspergillus sojae JY4001 were cultured to prepare a spore suspension, the concentration of which was 10 6 For the UV mutagenesis operation, first turn on the UV lamp (power is 30W) and let the lamp power stabilize for 30 minutes. Then take 5mL of spore suspension in a culture dish, place the culture dish on a magnetic stirrer in a sterile operating table, turn on the magnetic stirrer to stir. Open the culture dish cover and irradiate for 8 minutes.

[0040] (2) The spore suspension after UV mutagenesis was subjected to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 The bacterial suspensions with different dilutions were obtained by diluting them several times.

[0041] (3) spreading the spore dilution onto PDA medium and culturing at 30° C. for 7 days;

[0042] (4) 21 strains with fast growth rate and abundant spores were selected and inoculated into PDA slant test tubes. After being cultured to maturity at 30°C, they were stored in a refrigerator at 4°C for future use.

[0043] Example 3 Production of soy sauce Aspergillus plaque

[0044] (1) Preparation of seed koji: Inoculate 2 loops of the PDA slant test tube colonies in Example 2 into the sterilized bran medium, culture at 30° C. for 40 h, then invert the bottle and continue to culture for 72 h to form seed koji;

[0045] (2) Preparation of koji: soybean meal: wheat: water are mixed evenly in a ratio of 6:4:5 (mass ratio), put into a koji, and then steam sterilized for 30 minutes, inoculated with 0.4% (w / w) of the koji in step (1), and cultured at a humidity of 90 and a temperature of 30°C for 48 hours until maturity to obtain koji. The prepared koji is tested for saccharifying enzyme and glutaminase, and the contents of isopentanol, isovaleraldehyde, and 2-pentylfuran in the prepared koji are tested by gas chromatography-mass spectrometry. Sensory evaluators conduct sensory evaluation of koji aroma. Three strains with high saccharifying enzyme and glutaminase activities, obvious koji aroma, and low bean smell are obtained, which are represented by JY4056, JY4057, and JY4058 respectively. The saccharifying enzyme, glutaminase activities, isopentanol, isovaleraldehyde, and 2-pentylfuran contents (relative content %) and sensory evaluation results are shown in Table 1.

[0046] Table 1 Plaque evaluation index detection results

[0047]

[0048] Note: ① Compare the known strain Huniang 3.042 with the starting strain JY4001

[0049] It can be seen from Table 1 above that, compared with the well-known strain Shanghai Niang 3.042 and the starting strain JY4001, the strain obtained in this embodiment has higher saccharifying enzyme and glutaminase activities, obvious koji aroma, and significantly reduced bean smell and bean substances. The soy sauce Aspergillus JY4058 strain with the highest saccharifying enzyme and glutaminase activities, obvious koji aroma, and the lowest bean smell substance content is preferably used for subsequent tests.

[0050] The strain JY4058 bred in this example is Aspergillus sojae HSCY6012 deposited by the inventors, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a deposit date of April 1, 2024 and a deposit number of CGMCC NO.41133.

[0051] Example 4 Genetic stability test of Aspergillus sojae HSCY6012 strain

[0052] The Aspergillus sojae HSCY6012 obtained by the breeding of Example 3 was continuously subcultured on PDA slant medium for 10 generations, the growth of each generation of strains was observed and recorded, and the 1st, 5th and 10th generation slant strains were carried out according to the method described in Example 3, saccharifying enzyme and glutaminase were detected, and the contents of isopentanol, isovaleraldehyde and 2-pentylfuran in the prepared plaque were detected by gas chromatography-mass spectrometry to judge the genetic stability of Aspergillus sojae HSCY6012 strains. If the saccharifying enzyme and glutaminase activities were measured for ten generations, and the content errors of isopentanol, isovaleraldehyde and 2-pentylfuran were within the error range of 10%, it was shown that the strain had good genetic stability. The test results are shown in Table 2, indicating that the Aspergillus sojae HSCY6012 strain of the present invention had good genetic stability.

[0053] Table 2 Results of the stability test of Aspergillus sojae HSCY6012

[0054] strain Glucoamylase Glutaminase Isoamyl alcohol Isovaleraldehyde 2-Pentylfuran Generation 1 1.00 1.00 1.00 1.00 1.00 5th Generation 0.99 1.02 1.01 1.06 1.02 10th Generation 1.03 1.04 1.00 1.01 0.98

[0055] Note: Taking the first generation indicators as 1.00, the subcultured Aspergillus HSCY6012 was converted into corresponding ratios.

[0056] Example 5 Application of Aspergillus sojae HSCY6012 in soy sauce fermentation

[0057] a. Experimental Group A

[0058] (1) Raw material screening: Raw material processing: Select dry soybean meal and fried wheat that are free of insect bites and mildew as raw materials.

[0059] (2) Steaming: dry-steam soybean meal at about 110°C for 15 min, then add 1 times the amount of water and steam at 120°C for 20 min. After the cooking is complete, cool it slightly and mix it with 0.8 times the amount of roasted wheat.

[0060] (3) Koji making: When the material temperature drops to about 36°C, inoculate 4‰ soy sauce Aspergillus HSCY6012 prepared in Example 3, control the room temperature to 30°C, humidity to more than 90%, until the late koji material matures, when the material temperature reaches about 36°C, the koji material is agglomerated and covered with mycelium, the first koji turning machine can be used, continue to circulate air, control the material temperature to 35°C, and then cultivate, wait for the koji material to agglomerate and the mycelium to be plump, and then turn the koji for the second time, continue to circulate air and cultivate, control the material temperature to 32°C, wait for the koji material to be full of yellow-green spores, and the koji material to be loose and smooth, and mix to obtain finished koji;

[0061] (4) Tank filling: The koji prepared in step (3) is sucked into a pneumatic stirring mash fermentation tank, and then 1.8 weight of 18° Bé brine is added, and aeration and stirring are performed to make it uniform;

[0062] (5) Fermentation:

[0063] ① Low temperature fermentation: control the temperature of the fermentation tank ≤ 15°C and ferment for 20 days; preferably, aerate and stir for 10 minutes every day;

[0064] ② Insulated fermentation: The temperature is kept at 30℃, and 5‰ of the raw material mass is inoculated on the 25th day of fermentation.

[0065] Pre-activated commercial Torulopsis yeast seed solution, and inoculated with 5‰ of the raw material mass of pre-activated commercial Saccharomyces rouxii seed solution on the 40th day of fermentation, aerated and stirred for 3 minutes every 3 days, and continued to ferment at a constant temperature for 90 days;

[0066] ③ Late natural fermentation: Keep the temperature below 28℃ and continue to mature. During this period, aerate and stir for 3 minutes every 8 days. Continue fermentation for 180 days to obtain fermented mature mash.

[0067] (6) Pressing:

[0068] The fermented mash in step (5) is squeezed by a vertical press to separate the mash residue from the crude oil, thereby obtaining a mash residue with a water content of 25% w / w;

[0069] (7) Sterilization:

[0070] The crude oil obtained in the above step (6) is sterilized at 135° C. for an instant, and then rapidly cooled to below 60° C. after sterilization, and pumped into a storage tank to obtain soy sauce crude oil;

[0071] (8) Detection

[0072] The stored crude oil was tested for glutamic acid, pyroglutamic acid, amino acid nitrogen, reducing sugar, ethanol, isopentanol, isovaleraldehyde, and 2-pentylfuran, and sensory evaluation was performed by 10 sensory assessors;

[0073] Control group A

[0074] The above step (3) is: according to the three-seed koji preparation process of this embodiment, one tank is inoculated with 4‰ soy sauce Aspergillus JY4001 seed koji for koji making; another tank is inoculated with 4‰ Shanghai Brewing 3.042 seed koji for koji making, and the other steps are the same as those of experimental group A.

[0075] b. Experimental Group B

[0076] (1) Raw material screening: Raw material processing: select dry soybean meal and fried wheat that are free of insect bites and mildew as raw materials;

[0077] (2) Steaming: dry-steam soybean meal at about 110°C for 15 min, then add 1 times the amount of water and steam at 120°C for 20 min. After the cooking is complete, cool it slightly and mix it with 0.8 times the amount of roasted wheat.

[0078] (3) koji making: when the material temperature drops to about 36°C, inoculate 4‰ soy sauce Aspergillus koji prepared in Example 3, control the room temperature to 30°C, humidity to 90% or more, until the koji material matures in the later stage, when the material temperature reaches about 36°C, the koji material is agglomerated and covered with mycelium, the koji turning machine can be used for the first turning, continue to circulate air, control the material temperature to 35°C, and then cultivate, when the koji material is agglomerated and the mycelium is plump, turn the koji for the second time, continue to circulate air and cultivate, control the material temperature to 32°C, until the koji material is covered with yellow-green spores and the koji material is loose and smooth, mix and obtain the finished koji;

[0079] (4) Tank filling: The koji prepared in step (3) is sucked into a conventional aerated mash fermentation tank (without attached Figure 2 A pneumatic stirring paddle (5) is placed in the fermentation tank for sauce and mash, and 1.8 weight of 18° Bé salt water is added, and the mixture is aerated and stirred evenly;

[0080] (5) Fermentation:

[0081] ① Low temperature fermentation: control the temperature of the fermentation tank ≤ 15°C and ferment for 20 days; preferably, aerate and stir for 10 minutes every day;

[0082] ② Insulated fermentation: The temperature is kept at 30℃, and 5‰ of the raw material mass is inoculated on the 25th day of fermentation.

[0083] Pre-activated commercial Torulopsis yeast seed solution, and inoculated with 5‰ of the raw material mass of pre-activated commercial Saccharomyces rouxii seed solution on the 40th day of fermentation, aerated and stirred for 3 minutes every 3 days, and continued to ferment at a constant temperature for 90 days;

[0084] ③ Late natural fermentation: Keep the temperature below 28℃ and continue to mature. During this period, aerate and stir for 3 minutes every 8 days. Continue fermentation for 180 days to obtain fermented mature mash.

[0085] (6) Pressing:

[0086] The fermented mash in step (5) is squeezed by a vertical press to separate the mash residue from the crude oil, thereby obtaining a mash residue with a water content of 25% w / w;

[0087] (7) Sterilization:

[0088] The crude oil obtained in the above step (6) is sterilized at 135° C. for an instant, and then rapidly cooled to below 60° C. after sterilization, and pumped into a storage tank to obtain soy sauce crude oil;

[0089] (8) Detection

[0090] The stored crude oil was tested for glutamic acid, pyroglutamic acid, amino acid nitrogen, reducing sugar, ethanol, isopentanol, isovaleraldehyde, and 2-pentylfuran, and sensory evaluation was performed by 10 sensory assessors;

[0091] Control group B

[0092] The above step (3) is: according to the three-kind koji preparation process of this embodiment, one tank is inoculated with 4‰ soy sauce Aspergillus JY4001 koji to make koji; another tank is inoculated with 4‰ Shanghai brewing 3.042 koji to make koji, and the other steps are the same as those of experimental group B.

[0093] Table 3 Application effect of Aspergillus sacchari HSCY6012 in soy sauce fermentation

[0094]

[0095]

[0096] From the results in Table 3, it can be seen that the soy sauce fermented by Aspergillus sojae HSCY6012 has significantly increased contents of glutamic acid, reducing sugar and ethanol, a certain increase in amino acid nitrogen, and decreased contents of pyroglutamic acid, isopentanol, isovaleraldehyde and 2-pentylfuran compared with the starting strains JY4001 and Shanghai Brewing 3.042. From the sensory evaluation, it can be concluded that the soy sauce fermented by Aspergillus sojae HSCY6012 has more prominent sweetness and umami taste, and significantly reduced beany smell. Aspergillus sojae HSCY6012 was used to ferment soy sauce in a pneumatic stirring mash fermenter. It can be seen from experimental group A that the rich enzyme activity was better utilized, the fermentation performance of the microorganisms in the fermentation system unexpectedly achieved better results, the overall soy sauce flavor was better, the aroma was rich, there was no beany smell, and the fermentation process was controllable.

[0097] Example 6 Pneumatic stirring fermentation device for sauce mash

[0098] This embodiment provides a pneumatic stirring sauce fermentation device comprising a compressed air intake pipeline.

[0099] (1), a stirring shaft mechanical seal (2), a feed inlet (3), a stirring shaft air inlet pipeline (4), a stirring paddle (5), a jacket water outlet (6), a rotor flowmeter (7), an air outlet pipeline (8), a stirring shaft (9), a jacket water inlet (10), a sauce mash fermentation tank body (11), and a discharge port (12); the feed inlet (3), the jacket water outlet (6), the air outlet pipeline (8), the jacket water inlet (10), and the discharge port (12) are connected to the sauce mash fermentation tank body (11), the stirring paddle (5) and the stirring shaft (9) are located inside the sauce mash fermentation tank body (11), the stirring paddle (5) is connected to the stirring shaft (9), and the compressed air The air inlet pipeline (1) is connected to the stirring shaft (9) through a stirring shaft mechanical seal (2); the stirring shaft (9) is hollow to form a stirring shaft air inlet pipeline (4); the rotor flowmeter (7) is located at the upper end of the processing pipeline (8); the stirring paddle (5) comprises a stirring blade (51), an air path (52), and a blade end (53); the stirring blade (51) is fixed on the stirring shaft (9); the blade end (53) is evenly distributed with ventilation holes (54); the ventilation pipeline (4) is connected to the air path (52) on the stirring paddle (5); and the ventilation holes (54) on the blade end (53) are connected to the air path (52).

[0100] The working method of this embodiment is as follows:

[0101] The compressed air passes through the compressed air intake pipeline, enters the stirring shaft mechanical seal (2) and is connected to the stirring shaft intake pipeline (4), and is discharged from the vent hole (54) on the end (53) of the blade after reaching the air path (52), generating a strong reverse thrust to drive the stirring blade (51), thereby making the stirring paddle (5) and the stirring shaft (9) in the sauce and mash fermentation tank body (11) move quickly, so that the sauce and mash in the sauce and mash fermentation tank body are fully stirred, and the discharged bubbles are broken by the stirring paddle (5) to have smaller particle size and more uniform distribution, without the need to install a motor to consume electric energy.

[0102] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the attached claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims are included in the present invention. Any figure mark in the claims should not be regarded as limiting the claims involved.

[0103] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This description method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. A strain of Aspergillus sojae HSCY6012, characterized in that: The soy sauce Aspergillus is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC NO.41133 and the deposit date April 1, 2024.

2. A microbial agent, characterized in that: The microbial agent comprises the Aspergillus sojae HSCY6012 according to claim 1.

3. Use of the soy sauce Aspergillus HSCY6012 described in claim 1 and the microbial agent described in claim 2 in soy sauce brewing.

4. A method for brewing soy sauce, characterized in that: The method comprises the steps of raw material screening, steaming, koji making, tanking, fermentation, pressing, sterilization and optional detection; wherein the koji making adopts the seed koji prepared by the Aspergillus sojae HSCY6012 described in claim 1 or the microbial agent described in claim 2.

5. The method according to claim 4, characterized in that The tanking process is to suck the finished koji obtained by koji making into a pneumatic stirring sauce and mash fermentation tank, then add 1.8 times (w / v) the mass of 18°Bé brine, and ventilate and stir evenly.

6. The method according to claim 5, characterized in that The pneumatic stirring sauce mash fermentation tank comprises a compressed air inlet pipeline (1), a stirring shaft mechanical seal (2), a feed port (3), a stirring shaft inlet pipeline (4), a stirring paddle (5), a jacket water outlet (6), a rotor flowmeter (7), an air outlet pipeline (8), a stirring shaft (9), a jacket water inlet (10), a sauce mash fermentation tank body (11), and a discharge port (12); the feed port (3), the jacket water outlet (6), the air outlet pipeline (8), the jacket water inlet (10), and the discharge port (12) are connected to the sauce mash fermentation tank body (11), and the stirring paddle (5) and the stirring shaft (9) are located on the sauce mash fermentation tank body (11). Inside, the stirring paddle (5) is connected to the stirring shaft (9); the compressed air intake pipeline (1) is connected to the stirring shaft (9) through the stirring shaft mechanical seal (2); the stirring shaft (9) is hollow to form a stirring shaft intake pipeline (4); the rotor flowmeter (7) is located at the upper end of the processing pipeline (8); the stirring paddle (5) comprises a stirring blade (51), an air path (52), and a blade end (53); the stirring blade (51) is fixed on the stirring shaft (9); the blade end (53) is evenly distributed with ventilation holes (54); the ventilation pipeline (4) is connected to the air path (52) on the stirring paddle (5); The vent hole (54) on the blade tip (53) is connected to the air path (52).

7. The method according to claim 5, characterized in that The compressed air passes through the compressed air intake pipeline, enters the stirring shaft mechanical seal (2) and is connected to the stirring shaft intake pipeline (4), and is discharged from the vent hole (54) on the end (53) of the blade after reaching the air path (52), generating a strong reverse thrust to drive the stirring blade (51), thereby making the stirring paddle (5) and the stirring shaft (9) located in the sauce and mash fermentation tank body (11) move quickly, so that the sauce and mash in the sauce and mash fermentation tank body are fully stirred, and the discharged bubbles are broken by the stirring paddle (5) to have smaller particle size and more uniform distribution, without the need to install a motor to consume electrical energy.

8. The method according to claim 4, characterized in that The fermentation includes low temperature fermentation, warm fermentation and natural fermentation.

9. The method according to claim 8, characterized in that The low-temperature fermentation is to control the temperature of the fermentation tank to ≤15°C and ferment for 20 days; the heat preservation fermentation is to maintain the temperature at 30°C, inoculate 5‰ of the mass of the raw material with pre-activated commercial Torulopsis seed liquid on the 25th day of fermentation, and inoculate 5‰ of the mass of the raw material with pre-activated commercial Saccharomyces cerevisiae seed liquid on the 40th day of fermentation, during which ventilation and stirring are performed for 3 minutes every 3 days, and the constant temperature fermentation is continued for 90 days; the late natural fermentation is to maintain the temperature below 28°C for continued after-ripening, during which ventilation and stirring are performed for 3 minutes every 8 days, and the fermentation is continued for 180 days to obtain fermented mature sauce mash.

10. A soy sauce product brewed using the soy sauce Aspergillus HSCY6012 according to claim 1, the microbial agent according to claim 2, or the preparation method according to any one of claims 4 to 9.

Images