Aroma-producing yeast XW2-1 and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and relates to an aroma-producing yeast XW2-1 and application thereof. The aroma-producing yeast XW2-1 disclosed by the invention is clavipora lusitaniae and is preserved in the general microbiological center of the China Committee for Culture Collection of Microorganisms on June 14, 2024, and the preservation number of the aroma-producing yeast XW2-1 is CGMCC (China General Microbiological Culture Collection Center) No. 30947. The aroma-producing yeast XW2-1 disclosed by the invention is high in growth speed, relatively strong in tolerance and outstanding in aroma-producing effect, and can be used for tobacco aroma enhancement. The strain can ferment tobacco powder in a liquid state, the variety and content of aroma components in fermentation liquor are remarkably increased, and the total amount of the aroma components is increased by two times or above. The tobacco flavor produced by fermentation of the strain has typical aroma characteristics, the aroma enhancement effect is remarkable, the smokeability is high, and the smoking quality of tobacco products can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to an aroma-producing yeast strain XW2-1 and an application thereof. Background Art

[0002] With the new tobacco concept of "reducing tar and reducing harm", the improvement of cigarette processing technology and the increasing quality requirements of tobacco consumers for cigarette products, the tobacco industry has reduced the impact of cigarettes on human health by reducing tar content, but it has also brought a series of problems such as the fading of fragrance and the impact on smoking motivation. At present, the most common way to make up for the deficiency of smoke is to add flavors and fragrances from external sources. This method can directly and effectively improve the aroma quality of cigarettes and cover up the irritation and impurities of tobacco leaves.

[0003] The method of using microorganisms to ferment tobacco leaves / tobacco dust to produce aroma is scientific, green and environmentally friendly. At the same time, the produced aroma comes from tobacco itself and has good coordination with tobacco products. However, there are currently few natural strains that can be used to ferment tobacco leaves / tobacco dust to produce aroma, and yeast strains with outstanding aroma production effects and that can specifically increase floral and sweet aromas have not yet been discovered. Therefore, by screening new strains for fermentation to prepare tobacco flavors, it not only provides a scientific, green and environmentally friendly method for preparing new natural flavors, but also provides a practical path for the realization of comprehensive and high-value utilization of tobacco waste. Summary of the invention

[0004] In view of the above technical problems, the present invention provides a flavor-producing yeast strain XW2-1 and its application, which has a fast growth rate, strong tolerance, and excellent flavor-producing performance. The tobacco flavor prepared by fermentation thereof presents a strong floral and sweet aroma, and after being added to cigarettes, it can significantly improve the aroma quantity and aroma quality of cigarettes.

[0005] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions: In a first aspect, the present invention provides an aroma-producing yeast strain XW2-1, whose classification name is Portuguese corynespora yeast ( Clavispora lusitania e), deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on June 14, 2024, with the deposit number CGMCC No.30947; the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Its rDNA-ITS sequence (as shown in SEQ ID No.3) is as follows: TTCCGTAGGTGAACCTGCGGAAGGATCATTAAAATAATACTTACACTTTGCATTTGCGAACAAAAAAATAAATCTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAAT CTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCTCTAACCCCCGGTTAGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA.

[0007] In a second aspect, the present invention further provides a fermentation product of aroma-producing yeast XW2-1, wherein the fermentation product is obtained by fermenting the aroma-producing yeast XW2-1.

[0008] The fermentation products are various valuable substances generated by the aroma-producing yeast XW2-1 through metabolic activities under suitable fermentation conditions, including primary metabolites and secondary metabolites of the raw materials after microbial metabolism, such as aroma-producing yeast XW2-1 cells, fermentation broth, solid-state fermentation products, etc.

[0009] Preferably, the fermentation product is a fermentation product obtained by fermenting the aroma-producing yeast XW2-1 using a fermentation medium containing tobacco leaves or tobacco dust components as a substrate.

[0010] The fermentation medium can be in liquid or solid form, and contains one or more combinations of tobacco leaves, tobacco dust, tobacco leaf / tobacco dust extract or other forms of tobacco leaf / tobacco dust components. The components and proportions in the medium can be adjusted according to actual needs to optimize the fermentation effect and the yield of the target product.

[0011] More preferably, the fermentation medium containing tobacco leaves or tobacco dust components consists of tobacco dust and deionized water; the mass volume ratio of the tobacco dust to deionized water is 1:10-20.

[0012] In a third aspect, the present invention further provides a method for preparing a fermentation broth of aroma-producing yeast XW2-1, comprising the following steps: S1: inoculating the aroma-producing yeast XW2-1 into an activation medium, and culturing at 25-37° C. and 150-180 r / min with shaking until the logarithmic phase to obtain a seed solution; S2: Take the seed liquid in S1 and inoculate it into the liquid culture medium at an inoculum rate of 8%-15%, ferment it in a shaker at a speed of 150-180 r / min, at a temperature of 28-32°C, and culture for 24-72 h to obtain the fermentation liquid of aroma-producing yeast XW2-1.

[0013] The activation medium can be selected from common medium suitable for yeast strain activation, such as YPD medium, PDA medium, etc.

[0014] The logarithmic phase refers to the period of transition from a dormant state to a logarithmic growth state. The aroma-producing yeast XW2-1 of the present invention can reach or be in the logarithmic growth phase when cultured for 12-36 hours at 25-37°C and 150-180 r / min.

[0015] Preferably, in S2, the seed solution in S1 can be centrifuged to collect the microbial cells, which can be resuspended in sterile water and then inoculated.

[0016] This inoculation method can avoid bringing the culture medium components used in bacterial strain activation into the fermentation culture stage in S2, thereby reducing impurities in the final fermentation liquid.

[0017] Illustratively, the present invention provides a method for preparing a fermentation broth of aroma-producing yeast XW2-1, comprising the following steps: S1: Pick a single colony of aroma-producing yeast XW2-1 and inoculate it into YPD medium, and culture it in a shaking incubator at 28-32°C and 150-180 r / min for 12-36 h for activation to obtain seed solution; S2: The seed solution in S1 is centrifuged at 4000-8000 rpm / min for 10-20 min to collect microbial cells, and the microbial cells are resuspended with sterile water having an equal volume to the seed solution to obtain a suspension; the suspension is inoculated into a liquid fermentation medium at an inoculation rate of 8%-15%, and the medium is placed in a shaking incubator at a speed of 150-180 r / min and a temperature of 28-32° C. for 24-72 h to obtain a fermentation liquid of aroma-producing yeast XW2-1; the liquid fermentation medium is composed of waste cigarette dust and deionized water; and the mass volume ratio of the waste cigarette dust to the deionized water is 1:10-20.

[0018] In a fourth aspect, the present invention also provides the use of the aroma-producing yeast XW2-1 in the preparation of tobacco flavorings.

[0019] The aroma-producing yeast XW2-1 strain provided by the present invention, the microbial composition comprising the aroma-producing yeast XW2-1 and / or the fermentation product obtained by fermenting the aroma-producing yeast XW2-1 can be used to prepare tobacco flavoring.

[0020] In a fifth aspect, the present invention further provides a tobacco flavoring obtained by extracting and preparing the fermentation product of the above-mentioned flavor-producing yeast XW2-1.

[0021] In a sixth aspect, the present invention further provides a method for preparing a tobacco flavoring, comprising the following steps: S1: using the aroma-producing yeast XW2-1 mentioned above to prepare an aroma-producing yeast XW2-1 fermentation broth; S2: performing a primary alcohol extraction, filtering, and a secondary alcohol extraction on the fermentation liquid of the aroma-producing yeast XW2-1 to obtain a fermentation extract; filtering and concentrating the fermentation extract to obtain tobacco flavoring.

[0022] Preferably, in S2, the solvent used for the primary and secondary alcohol extractions is 75%-95% v / v ethanol; the volume ratio of the aroma-producing yeast XW2-1 fermentation broth to the solvent is 1:2-5; the extraction temperature of the primary and secondary alcohol extractions is 85-90°C, and the extraction time is 1.5-3 h; the concentration temperature is 45-60°C, and the rotation speed is 40-55 rpm / min; the density of the tobacco flavor is 1.1-1.2 g / cm 3 .

[0023] In a seventh aspect, the present invention also provides the use of the above-mentioned tobacco flavoring or the tobacco flavoring prepared by the above-mentioned preparation method in the preparation of tobacco products.

[0024] The tobacco flavoring provided by the present invention can be added to tobacco products such as shredded tobacco, cigarettes or electronic cigarettes, which can enrich the tobacco flavor level and enhance the overall experience of users.

[0025] Beneficial effects of the present invention: Compared with the prior art, the aroma yeast XW2-1 provided by the present invention is an endophyte of tobacco, which has a fast growth rate, strong tolerance, and outstanding aroma production ability. The strain ferments a culture medium containing tobacco dust components, and can produce a variety of typical aroma substances that enhance tobacco aroma, such as megastigmatrienone and vinyl guaiacol, and significantly increases the types and contents of aroma components in the fermentation liquid, giving the fermentation liquid a floral and sweet aroma. The tobacco flavor obtained by fermenting waste tobacco dust with the aroma yeast XW2-1 has a high content of esters and ketones in the aroma components of the flavor, and has outstanding floral and sweet aromas. Adding the tobacco flavor to cigarettes can significantly improve the aroma quantity and aroma quality of the cigarettes. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1The colony morphology (a) and Gram staining results (b, c) of aroma-producing yeast strain XW2-1; Figure 2 This is the phylogenetic tree of aroma-producing yeast strain XW2-1 based on ITS sequences; Figure 3 This is a comparison of different types of volatile aroma components in the fermentation broth of aroma-producing yeast XW2-1. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0029] The culture medium used in the following examples of the present invention is as follows: LB medium: Dissolve 10 g of peptone, 5 g of yeast extract and 10 g of sodium chloride in 900 mL of water. For solid medium, add 10 g of agar powder and make the volume up to 1000 mL. Sterilize with high pressure steam at 121°C for 15-20 min.

[0030] YPD medium: dissolve 10 g yeast extract and 20 g peptone in 900 mL water. If making plates, add 20 g agar powder. After autoclaving at 121°C for 20 min, add 100 mL 20 g glucose (add after the glucose solution is sterilized).

[0031] The following examples of the present invention refer to GB 5606.4-2005 "Cigarettes Part 4: Sensory Technical Requirements" for sensory evaluation of finished cigarettes, and slightly modify the sensory evaluation method (as shown in Table 1). The evaluation team members are asked to make qualitative descriptions according to six indicators, namely gloss, aroma, harmony, miscellaneous smell, irritation and aftertaste (because the same finished cigarettes are used for sensory evaluation, the gloss index score is fixed at 5 points), record the sensory experience during the entire smoking process, and compare the differences before and after smoking.

[0032] Table 1 Sensory evaluation results of cigarettes

[0033] Example 1 This embodiment provides an aroma-producing yeast strain XW2-1, which is isolated from tobacco leaves and waste tobacco.

[0034] 1. Isolation and screening of aroma-producing yeast XW2-1 1.1 Strain isolation Weigh 5 g of discarded Yunnan Xuanwei C2F tobacco leaves in a conical flask, add 100 mL of sterile water and shake for 24 h, then filter, take 2 mL of the filtrate and add it to LB liquid culture medium, and enrich and culture at 30 ° C and 180 r / min for 1 day to obtain the bacterial source. Use sterile water to dilute each enrichment solution in a gradient manner, and select dilutions of 10 -2 , 10 -4 , 10 -6 100 μL of each dilution was evenly spread on LB and YPD solid culture media, and cultured in a constant temperature box at 28℃ and 30℃ for 2-3 days until single colonies grew. A total of 37 strains were isolated.

[0035] 1.2 Initial screening of aroma-producing fungi The isolated strains were inoculated into YPD liquid seed culture medium and cultured in a shaker (30°C, 180 r / min) for 24 h. The aroma-producing fungi were initially screened by olfactory identification.

[0036] 1.3 Rescreening of aroma-producing fungi The seed culture solution was inoculated with 10% of the tobacco waste fermentation medium (the mass volume ratio of waste tobacco waste to deionized water was 1:15) and fermented in a shaker at 30°C and 180 r / min for 48 h. The aroma changes of the fermentation solution were observed and recorded during the culture process. The blank control group was inoculated with 10% of deionized water into the fermentation medium and fermented under the same fermentation conditions for 48 h.

[0037] The fermentation liquid with different aroma from the control group was taken out for olfactory identification. At the same time, the fermentation liquid was centrifuged to obtain the supernatant, and then 75% (v / v) ethanol was used as the solvent to prepare a flavoring solution. The solution was injected into blank cigarette sample cigarettes using a cigarette flavoring injection machine, and the injection volume was 6 μL / cigarette. The blank control group was injected with the same volume of 75% v / v ethanol. After balancing for 48 hours at 22°C and a relative humidity of 60%, the professional team evaluated and screened the strain with the best aroma production effect, named XW2-1. The sensory evaluation results of the fermentation liquid of the aroma-producing strain XW2-1 are shown in Table 2.

[0038] Table 2 Sensory evaluation results of cigarettes

[0039] 2. Identification of aroma-producing yeast strain XW2-1 2.1 Colony and bacterial morphology of strain XW2-1 The isolated and purified strain was activated, inoculated into YPD medium, and cultured at 30°C until colonies were formed. The strain was then identified by morphology and molecular biology. Figure 1 It can be seen that the aroma-producing strain XW2-1 has a white edge on the YPD medium, and the colonies are all concave in the middle, wrinkle-free, shiny, dry, opaque, and have regular edges. Figure 1 b. Figure 1 c, The cell morphology is oval.

[0040] 2.2 Molecular biological identification of strain XW2-1 Using the DNA of strain XW2-1 as a template, the 5.8 S-ITS region gene was amplified using fungal internal transcribed spacer (ITS) primers, and the amplified product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The amplification primers are: ITS1 (SEQ ID NO.1): 5'-TCCGTAGGTGAACCTGCGG-3', ITS4 (SEQ ID NO.2): 5'-TCCTCCGCTTATTGATATGC-3'.

[0041] The PCR amplification system (20 μL) was as follows: 10 μL of 2×Taq Master Mix; 0.5 μL of upstream and downstream primers; 2 μL of template DNA; and ddH2O added to make up to 20 μL.

[0042] PCR amplification conditions were as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 52°C for 50 s, extension at 72°C for 40 s, 35 cycles; extension at 72°C for another 7 min, and storage at 4°C.

[0043] The sequencing results are shown in SEQ ID NO. 3.

[0044] SEQ ID NO. 3: TTCCGTAGGTGAACCTGCGGAAGGATCATTAAAATAATACTTACACTTTGCATTTGCGAACAAAAAAATAAATCTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAAT CTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCTCTAACCCCCGGTTAGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA.

[0045] The obtained ITS sequence was compared with the NCBI database by BLAST homology, which showed that the strain had a sequence similarity of 99% with that of Portuguese Corynosporum, which was highly homologous. The strain was analyzed using the software MEGA 7 to determine its taxonomic status, and a phylogenetic tree was constructed using the MEGA software ( Figure 2 ), strain XW2-1 and Portuguese yeast clustered together.

[0046] In summary, combined with morphological characteristics and molecular biological analysis, strain XW2-1 was identified as Portuguese coryneformis ( Clavispora lusitaniae ) strain, named aroma-producing yeast XW2-1. The strain was deposited in the China Center for Typical Microbiological Collection on June 14, 2024, with the deposit number CGMCC No.30947; the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0047] Example 2 This embodiment provides a fermentation broth of aroma-producing yeast XW2-1, which is prepared by the following steps: S1: The glycerol stock solution of aroma-producing yeast XW2-1 was inoculated into YPD liquid medium, and cultured in a shaking incubator at 28°C and 180 r / min for 36 h for activation to obtain seed solution; S2: Take the seed liquid in S1 and inoculate it into the tobacco fermentation medium at an inoculum rate of 8%, place it in a shaker at a speed of 150 r / min, a temperature of 28°C, and culture for 72 hours to obtain the fermentation liquid of aroma yeast XW2-1. The mass volume ratio of waste tobacco to deionized water in the tobacco fermentation medium is 1:10.

[0048] Example 3 This embodiment provides a fermentation broth of aroma-producing yeast XW2-1, which is prepared by the following steps: S1: Pick a single colony of aroma-producing yeast XW2-1 and inoculate it into YPD liquid medium, and culture it in a shaking incubator at 32°C and 180 r / min for 12 h for activation to obtain seed liquid; S2: Take the seed liquid in S1 and inoculate it into the tobacco fermentation medium at a rate of 15%, place it in a shaker at a speed of 180 r / min, a temperature of 32° C., and culture it for 72 h to obtain the fermentation liquid of the aroma-producing yeast XW2-1. The mass volume ratio of the waste tobacco to the deionized water in the tobacco fermentation medium is 1:15.

[0049] Example 4 This embodiment provides a fermentation broth of aroma-producing yeast XW2-1, which is prepared by the following steps: S1: Pick a single colony of aroma-producing yeast XW2-1 and inoculate it into YPD liquid medium, and culture it in a shaking incubator at 30°C and 180 r / min for 24 h for activation to obtain seed liquid; S2: Take the seed liquid in S1 and centrifuge it at 6000 rpm / min for 10-20 min to collect microbial cells, resuspend the microbial cells with sterile water of the same volume as the seed liquid to obtain a suspension; inoculate the suspension into the tobacco fermentation medium at an inoculum of 10%, place it in a shaking table at a speed of 180 r / min, and culture it at a temperature of 30°C for 72 h to obtain the fermentation liquid of aroma yeast XW2-1. The mass volume ratio of waste tobacco to deionized water in the tobacco fermentation medium is 1:20.

[0050] The aroma components of the fermentation broth of the aroma yeast XW2-1 provided in this example were determined. A blank control group was set up, and deionized water was inoculated into the fermentation medium at a rate of 10%, and fermented under the same fermentation conditions for 48 h.

[0051] The aroma components of the fermentation broth of aroma-producing yeast XW2-1 (experimental group) and the control group were determined by headspace solid phase microextraction. The results are shown in Table 3. The different types of components in the two fermentation broths were compared. The results are shown in Table 3. Figure 3 .

[0052] Headspace solid phase microextraction method: take 1 mL of centrifuged fermentation liquid into a 20 mL headspace bottle, add 10 uL of internal standard, heat and adsorb at 70℃ for 30 min, insert the injection handle after adsorption into the injection port, and desorb for 4 min.

[0053] GC conditions: chromatographic column: HP-5MS (60 m*250 μm*0.25 m); carrier gas (He) flow rate 3 mL / min; injection volume 1 μL; inlet temperature: 280℃; split ratio: splitless; heating program: 50℃ for 4 min, increase to 120℃ at 3℃ / min, maintain for 5 min; then increase to 180℃ at 5℃ / min and maintain for 5 min; then increase to 250℃ at 20℃ / min and maintain for 2 min.

[0054] MS conditions: EI ion source: ion source temperature 270°C, electron energy 70 eV, quadrupole temperature 150°C: acquisition mode: full ion scan (Scan) mode: scan range: 35-550 m / z.

[0055] Table 3 Volatile aroma components (μg / g)

[0056] As can be seen from Table 3, the experimental group (aroma yeast XW2-1 fermentation broth) has a significant increase in the total amount of volatile aroma compounds and the types and contents of specific aroma components compared with the control group. The total amount increased from 60.91 μg / g in the control group to 157.89 μg / g in the experimental group, an increase of nearly 2.6 times, and the components closely related to the aroma characteristics of tobacco were also enhanced. Among them, the contents of benzyl alcohol, phenylethyl alcohol, megastigmatrienone, longifolene, 2,3'-bipyridine, β-ionone, etc., which can bring floral and sweet aromas, increased by 49.4%, 128%, 78%, 201.8%, 565%, and 835.7%, respectively. At the same time, a variety of aroma components with floral temperament were added, such as linalool, trans-geraniol, spirulinatone, 2-phenylethyl 4-nitrobenzoate, ethyl stearate, and methyl linolenate.

[0057] Figure 3 The results are a comparison of different types of volatile aroma components in the fermentation broth of aroma-producing yeast XW2-1. Figure 3 It can be seen that the contents of ketones and alcohols in the fermentation broth of aroma-producing yeast XW2-1 are relatively high. Compared with the control group, the contents and types of alcohols, phenols, esters, ketones and heterocyclic substances in the volatile aroma components are increased, and although the types of acids and olefins are slightly decreased compared with the control group, the contents of the two substances are increased.

[0058] All of the above indicate that the aroma-producing yeast XW2-1 provided by the present invention has an outstanding aroma-producing ability. The strain ferments a medium containing tobacco dust components to produce a variety of typical aroma substances that enhance the aroma of tobacco. The synergistic effect of these components gives the fermented liquid a floral and sweet aroma, enriches the overall aroma characteristics and aroma levels, can effectively cover up the off-flavors in tobacco, improve the aroma quality of tobacco products, and make the smoke more mellow, smooth, sweet and mild.

[0059] Example 5 The embodiment provides a tobacco flavoring, which is prepared by the following steps: Preparation of aroma-producing yeast XW2-1 fermentation broth: The preparation method is the same as Example 4.

[0060] Extraction: The fermentation broth is subjected to a first extraction, filtration, and a second extraction. The solvent used for the two extractions is 75% v / v ethanol, the volume ratio of the fermentation broth to the solvent used is 1:5, and the extraction conditions are: temperature 90°C, time 3 h; after the first alcohol extraction, the extract is filtered with gauze, and the same volume of solvent as the first extraction is added to the filter residue for a second extraction; the filtrates obtained from the two extractions are combined to obtain the fermentation extract.

[0061] Concentration: The fermentation extract obtained above was filtered, and the filtrate was concentrated under reduced pressure to prepare a density of 1.10 g / cm 3 Concentration parameters: temperature 60℃, speed 40 rpm.

[0062] The aroma components of the tobacco flavor obtained in this example were analyzed by headspace solid phase microextraction. The results are shown in Table 4.

[0063] Table 4 Volatile aroma components

[0064] As shown in Table 4, the aroma components of the obtained spices have a high content of esters and ketones, among which methyl palmitate, methyl linolenate, and ethyl linoleate have waxy and sweet aromas, and ethyl stearate can increase the sweetness, purity, and fullness of smoke. Megastigmatrienone has a sweet tobacco-like aroma and dried fruit aroma, which can be coordinated with the smoke aroma, giving the tobacco leaves a sweet aroma while covering up the miscellaneous smell; spirulinatone has a floral and woody aroma, making the smoke mellow, delicate, and full. There are also many aroma components in alcohols, phenols, and olefins, such as rubotrys, which have a woody and mild sweet aroma. Vinyl guaiacol has a spicy and fermented aroma, which makes the smoke full. In addition, there are heterocyclic compounds such as pyridine, pyrrole, and furan. Most of these compounds have the aroma of nuts and cocoa, which have a modifying effect on smoke.

[0065] Example 6 The embodiment provides a tobacco flavoring, which is prepared by the following steps: Preparation of aroma-producing yeast XW2-1 fermentation broth: The preparation method is the same as Example 4.

[0066] Extraction: The fermentation liquid is subjected to a first extraction, filtration, and a second extraction. The solvent used for the two extractions is ethanol with a volume fraction of 95% v / v, the volume ratio of the fermentation liquid to the solvent used is 1:2, and the extraction conditions are: temperature 85°C, time 1.5h; after the first alcohol extraction, the extract is filtered with gauze, and the same volume of solvent as the first extraction is added to the filter residue for a second extraction; the filtrates obtained from the two extractions are combined to obtain a fermentation extract.

[0067] Concentration: The fermentation extract obtained above was filtered, and the filtrate was concentrated under reduced pressure to prepare a density of 1.20 g / cm 3 Concentration parameters: temperature 45℃, speed 55 rpm.

[0068] Example 7 This embodiment provides an application of the fermentation broth of aroma-producing yeast XW2-1.

[0069] Cigarettes were prepared using the tobacco flavoring provided in Example 5, and the flavored cigarettes were evaluated for smoking.

[0070] Weigh 1 mL of the tobacco flavoring provided in Example 5, dilute it to 10 mL with 75% v / v ethanol, and then inject 6 μL into the cigarette with a micro syringe, and use the same volume of 75% v / v ethanol as a blank control. The cigarette after injection is placed in an environment with a temperature of (22±1)℃ and a relative humidity of (60±2)% for 48 hours to obtain a flavored cigarette.

[0071] The overall cycle method was adopted, and a professional smoking evaluation team conducted a comprehensive sensory description of the above cigarettes. The sensory evaluation of the finished cigarettes was carried out with reference to GB 5606.4-2005 "Cigarettes Part 4: Sensory Technical Requirements", and the sensory evaluation method was slightly modified (as shown in Table 1). The results are shown in Table 5.

[0072] Table 5 Comprehensive sensory evaluation score table for flavored cigarettes

[0073] From the results in Table 5, it can be seen that compared with the blank control group, after adding tobacco flavorings, the aroma quality and aroma volume of the cigarette are improved, the floral and cream aromas are more obvious, the smoke is softer, the irritation is reduced, the impurities are reduced, the aftertaste is more coordinated, and the sweetness of the cigarette is increased.

[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A flavor-producing yeast strain XW2-1, characterized in that: Its taxonomic name is Portuguese coryneformis ( Clavispora lusitaniae ), deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on June 14, 2024, with the deposit number CGMCC No.30947; the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. A fermentation product of aroma-producing yeast XW2-1, characterized in that: The fermentation product is obtained by fermenting the aroma-producing yeast XW2-1 according to claim 1.

3. The fermentation product of aroma yeast XW2-1 according to claim 2, characterized in that: The fermentation product is a fermentation product obtained by fermenting the aroma-producing yeast XW2-1 using a fermentation medium containing tobacco leaves or tobacco dust components as a substrate.

4. The fermentation product of aroma-producing yeast XW2-1 according to claim 3, characterized in that: The fermentation medium containing tobacco leaves or tobacco dust components is composed of tobacco dust and deionized water; the mass volume ratio of the tobacco dust to the deionized water is 1:10-20.

5. A method for preparing a fermentation broth of aroma-producing yeast XW2-1, characterized in that: The following steps are involved: S1: inoculating the aroma-producing yeast XW2-1 described in claim 1 into an activation medium, and culturing at 25-37° C. and 150-180 r / min with shaking until the logarithmic phase to obtain a seed solution; S2: Take the seed liquid in S1 and inoculate it into the liquid culture medium at an inoculum rate of 8%-15%, ferment it in a shaker at a speed of 150-180 r / min, at a temperature of 28-32°C, and culture for 24-72 h to obtain the fermentation liquid of aroma-producing yeast XW2-1.

6. Use of the aroma-producing yeast XW2-1 according to claim 1 in preparing tobacco flavoring.

7. A tobacco flavoring, characterized in that: The aroma-producing yeast XW2-1 is extracted and prepared by fermentation products according to any one of claims 2 to 4.

8. A method for preparing tobacco flavoring, characterized in that: The following steps are involved: S1: using the aroma-producing yeast XW2-1 according to claim 1 to prepare an aroma-producing yeast XW2-1 fermentation liquid; S2: performing a primary alcohol extraction, filtering, and a secondary alcohol extraction on the fermentation liquid of the aroma-producing yeast XW2-1 to obtain a fermentation extract; filtering and concentrating the fermentation extract to obtain tobacco flavoring.

9. The preparation method according to claim 8, characterized in that: In S2, the solvent used for the primary and secondary alcohol extractions is 75%-95% v / v ethanol; the volume ratio of the aroma-producing yeast XW2-1 fermentation liquid to the solvent is 1:2-5; the extraction temperature of the primary and secondary alcohol extractions is 85-90°C, and the extraction time is 1.5-3 h; the concentration temperature is 45-60°C, and the rotation speed is 40-55 rpm / min; the density of the tobacco flavor is 1.1-1.2 g / cm 3 .

10. Use of the tobacco flavoring according to claim 7 or the tobacco flavoring prepared by the preparation method according to any one of claims 8 to 9 in the preparation of tobacco products.

Images