Micro-fluidic chip for detecting quarantine disease original substances of unprocessed grains

Abstract

The invention discloses a micro-fluidic chip for detecting quarantine pathogens of unprocessed grains. According to the micro-fluidic chip, each micro-fluidic chip at least comprises 8 detection channels, each detection channel at least comprises 48 reaction areas, and the 48 reaction areas are used for detecting 11 kinds of quarantine disease raw materials of unprocessed grains; the 11 raw grain quarantine disease raw materials comprise soybean northern stem canker germs, soybean stem brown rot germs, North American soybean sudden death syndrome germs, phaseolus vulgaris bacterial wilt germs, wheat tilletia indica, ryegrass Tilletia tillea, wheat streak mosaic viruses, corn bacterial wilt germs and corn fusarium wilt germs. , maize chlorotic mottle virus and tomato canker pathogen. The micro-fluidic chip provided by the invention can be used for simultaneously detecting 11 kinds of raw grain quarantine pathogens of 8 to-be-detected samples, so that the detection efficiency is improved, and the micro-fluidic chip has important significance on inspection and quarantine work of the raw grain quarantine pathogens.

Description

Technical Field

[0001] The present application relates to the technical field of raw grain pathogen detection, and in particular to a microfluidic chip for raw grain quarantine pathogen detection. Background Art

[0002] Raw grain refers to unprocessed grains or crops such as soybeans, wheat, and corn. Raw grain pathogens include fungi, bacteria, viruses, and oomycetes, which are important factors that seriously affect raw grain production and trade. Among the numerous pathogens of raw grains, quarantine pathogens are particularly harmful; they include northern soybean stem canker (Diaporthe phaseolorum var. caulivora), soybean stem brown rot (Cadophora gregata), North American soybean sudden death syndrome (Fusarium virguliforme), bean bacterial wilt (Curtobacterium flaccumfaciens pv. flaccumfaciens), wheat Indian bunt (Tilletia indica), ryegrass bunt (Tilletia walkeri), wheat streak mosaic virus (WSMV), corn bacterial wilt (Pantoeastewartii subsp. stewartii), corn inner state wilt (Clavibacter michiganensis subsp. nebraskensis), maize chlorotic mottle virus (MCMV), tomato canker (Clavibactermichiganensis subsp. michiganensis), etc.

[0003] Existing detection methods for quarantine pathogens in raw grains include traditional morphological identification detection methods based on Koch's postulates, serological detection methods, conventional PCR detection methods, isothermal amplification detection methods, real-time fluorescence PCR detection methods, etc. These methods can only detect a single pathogen each time, or can only detect a few pathogens at the same time, and their efficiency is relatively low.

[0004] In addition, the existing detection methods all have different defects and deficiencies. Traditional morphological identification detection method: 1. The culture takes a long time, generally 7 to 14 days; 2. The workload is large, and a large amount of selective culture medium is usually required for culture; 3. For pathogens such as bacteria and viruses that are not easy to observe under a microscope, it is difficult to obtain the test results directly, quickly and accurately; 4. Factors such as culture medium selection and laboratory environment (such as pH, temperature, etc.) will affect the growth of microorganisms, and there is a risk of contamination in the culture medium, which will affect the identification results. Serological detection method: 1. The preparation of antiserum takes a long time, and there are often false positive reactions, which reduces the sensitivity of the detection; 2. When the amount of antibodies and antigens is small or the quality is not high, this method cannot be used for detection. Conventional PCR detection method: 1. Operations such as gel making and gel running are harmful to the human body; 2. Opening the lid of the PCR tube during the operation is prone to aerosol contamination. Disadvantages of isothermal amplification method: 1. This detection method has high requirements for primer design; 2. This method is very easy to contaminate and produce false positives. Disadvantages of real-time fluorescence PCR detection technology: The preparation process of working solution is cumbersome and time-consuming.

[0005] In short, there is currently a lack of simple, effective, high-throughput rapid detection technology for quarantine pathogens in raw grains, which has greatly affected the inspection and quarantine work of quarantine pathogens in raw grains. Summary of the invention

[0006] The purpose of this application is to provide a new microfluidic chip for detecting quarantine pathogens in raw grains.

[0007] This application adopts the following technical solutions:

[0008] One aspect of the present application discloses a microfluidic chip for detecting quarantine pathogens of raw grains, each microfluidic chip comprises 8 detection channels, each detection channel comprises 48 reaction areas, and the 48 reaction areas are used to detect 11 kinds of quarantine pathogens of raw grains; the 11 kinds of quarantine pathogens of raw grains include northern stem canker of soybean, brown stem rot of soybean, North American sudden death syndrome of soybean, bacterial wilt of bean, Indian bunt of wheat, bunt of ryegrass, wheat streak mosaic virus, bacterial wilt of corn, internal wilt of corn, corn chlorotic mottle virus, and tomato canker.

[0009] It should be noted that the microfluidic chip of the present application creatively integrates 11 quarantine pathogens that are more harmful to raw grains into a microfluidic chip, and by designing detection primers and probes for the 11 quarantine pathogens of raw grains, the 11 quarantine pathogens of raw grains can be simultaneously detected with high throughput on the same microfluidic chip, thereby improving the detection efficiency of quarantine pathogens of raw grains, which is of great significance to the inspection and quarantine of quarantine pathogens of raw grains.

[0010] In one implementation of the present application, the reaction zone for detecting northern soybean stem canker pathogen contains specific detection primers and probes for northern soybean stem canker pathogen, the reaction zone for detecting soybean stem brown rot pathogen contains specific detection primers and probes for soybean stem brown rot pathogen, the reaction zone for detecting North American soybean sudden death syndrome pathogen contains specific detection primers and probes for North American soybean sudden death syndrome pathogen, the reaction zone for detecting bean bacterial wilt pathogen contains specific detection primers and probes for bean bacterial wilt pathogen, the reaction zone for detecting wheat Indian smut pathogen contains specific detection primers and probes for wheat Indian smut pathogen, and the reaction zone for detecting ryegrass stinking pathogen contains specific detection primers and probes for The reaction zone for detecting smut contains primers and probes specific for detecting ryegrass smut, the reaction zone for detecting wheat streak mosaic virus contains primers and probes specific for detecting wheat streak mosaic virus, the reaction zone for detecting corn bacterial wilt contains primers and probes specific for detecting corn bacterial wilt, the reaction zone for detecting corn internal wilt contains primers and probes specific for detecting corn internal wilt, the reaction zone for detecting corn chlorotic mottle virus contains primers and probes specific for detecting corn chlorotic mottle virus, and the reaction zone for detecting tomato canker contains primers and probes specific for detecting tomato canker.

[0011] In one implementation of the present application, the upstream and downstream primers of the specific detection primers and probe of soybean northern stem canker pathogen are the sequences shown in Seq ID No.1 and 2 in sequence, and the probe is the sequence shown in Seq ID No.3; the upstream and downstream primers specific for soybean stem brown rot pathogen are the sequences shown in Seq ID No.4 and 5 in sequence, and the probe is the sequence shown in Seq ID No.6; the upstream and downstream primers specific for North American soybean sudden death syndrome pathogen are the sequences shown in Seq ID No.7 and 8 in sequence, and the probe is the sequence shown in Seq ID No.9; the upstream and downstream primers of the specific detection primers and probe of bean bacterial wilt pathogen are the sequences shown in Seq ID No.10 and 11 in sequence, and the probe is the sequence shown in Seq ID No.12; the upstream and downstream primers of the specific detection primers and probe of wheat Indian smut pathogen are the sequences shown in Seq ID No.13 and 14 in sequence, and the probe is the sequence shown in Seq ID No.15; the upstream and downstream primers of the specific detection primers and probe of ryegrass smut pathogen are the sequences shown in Seq ID No.16 and 17, and the probe is the sequence shown in Seq ID No.18; the wheat streak mosaic virus specific detection primer and the upstream and downstream primers of the probe are the sequences shown in Seq ID No.19 and 20, respectively, and the probe is the sequence shown in Seq ID No.21; the corn bacterial wilt pathogen specific detection primer and the upstream and downstream primers of the probe are the sequences shown in Seq ID No.22 and 23, respectively, and the probe is the sequence shown in Seq ID No.24; the corn wilt pathogen specific detection primer and the upstream and downstream primers of the probe are the sequences shown in Seq ID No.25 and 26, respectively, and the probe is the sequence shown in Seq ID No.27; the corn chlorotic mottle virus specific detection primer and the upstream and downstream primers of the probe are the sequences shown in Seq ID No.28 and 29, respectively, and the probe is the sequence shown in Seq ID No.30; the tomato canker pathogen specific detection primer and the upstream and downstream primers of the probe are the sequences shown in Seq ID No.31 and 32, respectively, and the probe is Seq ID No. The sequence shown in ID No.33.

[0012] In one implementation of the present application, specific detection primers and probes corresponding to quarantine pathogens in raw grains are pre-embedded in corresponding detection reaction areas. For example, specific detection primers and probes for northern soybean stem canker pathogens are pre-embedded in the reaction area for detecting northern soybean stem canker pathogens. When performing the detection, it is only necessary to pass the mixed solution of the reaction solution and the test sample into the detection channel. In one implementation of the present application, the microfluidic chip includes 8 detection channels, which can realize the simultaneous detection of 8 different samples.

[0013] In one implementation of the present application, the volume of each reaction zone is 1 μL.

[0014] Another aspect of the present application discloses the use of the microfluidic chip of the present application in the preparation of a raw grain quarantine pathogen detection kit.

[0015] The present application further discloses a reagent kit for detecting quarantine pathogens in raw grains, which contains the microfluidic chip of the present application.

[0016] In one implementation of the present application, the kit also contains positive controls and / or negative controls for 11 types of quarantine pathogens in raw grains.

[0017] In one implementation of the present application, the positive control is a plasmid containing a fragment for detecting quarantine pathogens in raw grains.

[0018] In one implementation of the present application, the kit also contains a probe-based real-time fluorescence quantitative PCR detection reagent.

[0019] It should be noted that for ease of use, the microfluidic chip of the present application and the supporting positive control, negative control, probe-based real-time fluorescence quantitative PCR detection reagents, etc. are assembled into a kit; it can be understood that, except for the microfluidic chip of the present application, other components can be purchased separately on the market.

[0020] The beneficial effects of this application are:

[0021] The microfluidic chip of the present application has high detection efficiency. Each chip can simultaneously detect 11 types of quarantine pathogens in raw grains on 8 samples to be tested, thereby improving the detection efficiency of quarantine pathogens in raw grains, which is of great significance to the inspection and quarantine of quarantine pathogens in raw grains. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a schematic diagram of the design of the microfluidic chip in the embodiment of the present application;

[0023] Figure 2 is a schematic diagram of reaction condition parameters on a microfluidic chip in an embodiment of the present application;

[0024] Figure 3 This is the chip specificity verification result of soybean northern stem canker pathogen in the examples of this application;

[0025] Figure 4 This is the chip specificity verification result of soybean stem brown rot pathogen in the example of this application;

[0026] Figure 5 This is the chip specificity verification result of the North American soybean sudden death syndrome pathogen in the embodiment of the present application;

[0027] Figure 6 This is the chip specificity verification result of bean bacterial wilt pathogen in the examples of this application;

[0028] Figure 7 This is the chip specificity verification result of wheat Indian bunt fungus in the examples of this application;

[0029] Figure 8 This is the chip specificity verification result of Tilletia perenne in the examples of the present application;

[0030] Fig. 9 This is the chip specificity verification result of wheat streak mosaic virus in the example of this application;

[0031] Fig.10 This is the chip specificity verification result of corn bacterial wilt pathogen in the examples of this application;

[0032] Fig.11 This is the chip specificity verification result of corn wilt pathogen in the example of this application;

[0033] Fig.12 This is the chip specificity verification result of the maize chlorotic mottle virus in the examples of this application;

[0034] Fig.13 This is the chip specificity verification result of tomato canker pathogen in the examples of this application;

[0035] Fig.14 This is the chip sensitivity verification result of soybean northern stem canker pathogen in the examples of this application;

[0036] Fig.15 This is the chip sensitivity verification result of soybean stem brown rot fungus in the embodiment of the present application;

[0037] Fig.16 This is the chip sensitivity verification result of the North American soybean sudden death syndrome pathogen in the embodiment of the present application;

[0038] Fig.17 This is the chip sensitivity verification result of bean bacterial wilt pathogen in the embodiment of the present application;

[0039] Fig.18 This is the chip sensitivity verification result of wheat Indian bunt fungus in the examples of this application;

[0040] Fig.19 This is the chip sensitivity verification result of Tilletia perenne in the embodiment of the present application;

[0041] Fig. 20 This is the chip sensitivity verification result of wheat streak mosaic virus in the example of this application;

[0042] Fig.21 This is the chip sensitivity verification result of corn bacterial wilt pathogen in the embodiment of the present application;

[0043] Fig. 22 This is the chip sensitivity verification result of corn wilt pathogen in the embodiment of this application;

[0044] Fig.23 This is the chip sensitivity verification result of maize chlorotic mottle virus in the examples of this application;

[0045] Fig.24 This is the chip sensitivity verification result of tomato canker bacteria in the examples of this application;

[0046] Fig.25 It is the result of the microfluidic chip detecting soybeans carrying soybean northern stem canker pathogen in the embodiment of the present application;

[0047] Fig.26 This is the result of the microfluidic chip detecting soybeans carrying bean bacterial wilt pathogen in the embodiment of the present application;

[0048] Fig. 27 It is the result of the microfluidic chip detecting the soybean northern stem canker pathogen carried in the mixed sample in the embodiment of the present application;

[0049] Fig.28 It is the result of the microfluidic chip detecting bean bacterial wilt pathogens carried in the mixed sample in the embodiment of the present application;

[0050] Fig.29 It is the specific detection result of the existing soybean northern stem canker pathogen primers and probes in the examples of this application;

[0051] Fig.30 It is the sensitivity test result of the existing soybean northern stem canker pathogen primers and probes in the examples of the present application;

[0052] Fig.31 It is the specific detection result of the existing wheat Indian bunt fungus primers and probes in the examples of the present application;

[0053] Fig.32 This is the sensitivity test result of the existing wheat Indian bunt fungus primers and probes in the examples of this application. DETAILED DESCRIPTION

[0054] A microfluidic chip is a chip that can accurately control nanoliter to microliter droplets to enter the corresponding area in a tiny channel for reaction. Its basic structure includes a sample addition hole, a liquid storage area, a one-way microfluidic droplet channel and a reaction area. It is generally combined with various sensors, flow meters, gas or liquid power devices, etc. The principle is to use microfluidic channels or flow meters to detect and control the direction, flow rate, flow rate and pressure of the fluid. Through the characteristics of multiple outlets and single-channel input of the microfluidic tube, it can effectively control the flow, pressure, flow direction and flow rate of the liquid when controlled by a signal. If necessary, the microfluidic tube can be programmed to adjust and control the microfluidic droplets according to the needs of different experiments.

[0055] The present application creatively combines a microfluidic chip with Taqman probe real-time fluorescence PCR, that is, combines specific primers and probes for 11 kinds of quarantine pathogens of raw grains, including quarantine fungi, bacteria, viruses, and oomycetes, with a microfluidic chip to achieve simultaneous detection of these quarantine pathogens, thereby improving the detection efficiency and quality of quarantine pathogens of raw grains.

[0056] The microfluidic chip used in the present application for the detection of quarantine pathogens in raw grains can realize the simultaneous and high-throughput detection of quarantine fungi, bacteria, viruses, oomycetes and other pathogens of different nucleic acid types on raw grains, which is not possible in the prior art. Therefore, compared with the existing methods for detecting quarantine pathogens in raw grains, the microfluidic chip of the present application has the following advantages:

[0057] High throughput: Each chip can complete 176 reactions for 8 samples.

[0058] High detection efficiency: Each chip can detect 11 quarantine pathogens in 8 samples at the same time.

[0059] Less consumption of experimental materials and reagents: The volume of each reaction zone is only 1μL, which can effectively reduce the consumption of samples and reagents.

[0060] High accuracy: 11 target pathogens can be accurately detected.

[0061] High specificity: It can specifically distinguish 11 target quarantine pathogens and their similar species.

[0062] High sensitivity: sensitivity can reach single copy per μL;

[0063] Convenience: The operation is simple. Specific primers and probes are pre-embedded in the reaction area of ​​the microfluidic chip. The operator only needs to mix the sample to be tested with the Taqman reaction Mix solution, and then add the sample to the microfluidic chip through the sample port for detection.

[0064] The present application is further described in detail below through specific examples. The following examples are only used to further illustrate the present application and should not be construed as limiting the present application.

[0065] Example

[0066] 1 Materials and methods

[0067] 1.1 Main reagents and instruments

[0068] ABI TaqPath TM 1-Step RT-qPCR MM, CG, 1.5mL RNase-Free centrifuge tube, 1.5mL DNase-Free centrifuge tube, 11 pathogen qPCR primers and probes, ddH 2 O, QIAGEN DNeasy Plant Pro Kit, TIANGEN RNAprep pure Plant Kit, DTT solution, microfluidic chip (Thermo Fisher Scientific (China) Co., Ltd.

[0069] Thermo Fisher Scientific), PCR 96-Well reaction plate, etc. Some of the instruments are shown in Table 1.

[0070] Table 1 List of main instruments

[0071] Instrument Name model Manufacturer Microfluidic chip detector <![CDATA[QuantStudio TM 7Flex]]> Thermo Fisher Scientific (China) Co., Ltd. Clean bench HERAGUARD ECO Thermo Fisher Scientific (China) Co., Ltd. Microfluidic chip centrifuge ST40R Thermo Fisher Scientific (China) Co., Ltd. Benchtop microcentrifuge Spectrafuge 24D American Leipert Corporation Vortex mixer Vortex Mixer 200 American Leipert Corporation Water Purifier OSJ-PLUS-UP-250VF Shandong Olaibo Instrument Co., Ltd. High-speed centrifuge 5418R Eppendorf Automatic sample crusher TissuelyserⅡ QIAGEN, Germany

[0072] 1.2 Test samples

[0073] Soybeans carrying soybean northern stem canker pathogen and soybeans artificially inoculated with bean bacterial wilt pathogen were detected at the port. The other tested pathogens are shown in Table 2.

[0074] Table 2 Test pathogens

[0075]

[0076]

[0077] 1.3 Nucleic acid extraction

[0078] DNA was extracted using QIAGEN DNeasy Plant Pro Kit and RNA was extracted using TIANGEN RNAprep purePlant Kit. The specific steps are as follows:

[0079] DNA extraction and purification steps:

[0080] a) Homogenization: 100 mg of soybean sample was quickly ground into powder in liquid nitrogen, 500 μL of lysis buffer 1 was added to a 2 mL tissue grinding tube, and the mixture was vigorously vortexed to mix.

[0081] b) Centrifuge at 12,000 rpm for 2 min and transfer the supernatant solution to a 1.5 mL centrifuge tube.

[0082] c) Add 200 μL of Lysis Buffer 2 to the centrifuge tube and vortex for 5 seconds.

[0083] d) Centrifuge at 12,000 rpm for 1 min at room temperature. To prevent precipitation, quickly transfer the supernatant to a clean 1.5 mL centrifuge tube.

[0084] e) Add 500 μL of Wash Solution 1 to the centrifuge tube and vortex for 5 seconds.

[0085] f) Add 600 μL of lysate solution to the adsorption column MB and centrifuge at 12,000 rpm for 1 min.

[0086] g) Discard the filtrate and repeat step f until all the lysate has passed through the column.

[0087] h) Place the adsorption column MB in a clean 2 mL collection tube, add 650 μL of washing solution 2 to the adsorption column MB, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and place the adsorption column MB in the same 2 mL collection tube.

[0088] i) Add 650 μL of washing solution 3 to the adsorption column MB, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and place the adsorption column MB in the same 2 mL collection tube.

[0089] j) Centrifuge at 16,000 g for 2 min, place the adsorption column MB in a new clean 1.5 mL centrifuge tube, add 100 μL of elution buffer to the white center of the adsorption column MB, centrifuge at 12,000 rpm for 1 min, discard the adsorption column MB, and obtain the DNA solution.

[0090] RNA extraction and purification steps:

[0091] a) Homogenization: 100 mg of soybean sample was quickly ground into powder in liquid nitrogen, 450 μL of lysis buffer was added, and the mixture was vortexed vigorously to mix.

[0092] b) Transfer all the solution to the filter column (the filter column is placed in the collection tube), centrifuge at 12,000 rpm for 5 min, and carefully pipette the supernatant in the collection tube into an RNase-Free centrifuge tube, trying to avoid the pipette tip from touching the cell debris precipitate in the collection tube.

[0093] c) Slowly add 0.5 times the volume of the supernatant (usually 225 μL) of anhydrous ethanol, mix well (precipitate may appear at this time), transfer the resulting solution and precipitate into the adsorption column CR3, centrifuge at 12,000 rpm for 60 seconds, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube. If the supernatant volume is lost, adjust the amount of ethanol added.

[0094] d) Add 350 μL of deproteinized solution to the adsorption column CR3, centrifuge at 12,000 rpm for 60 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0095] e) Preparation of DNase 1 working solution: Take 10 μL of DNase 1 stock solution and put it into a new RNase-Free centrifuge tube, add 70 μL of RDD buffer and mix gently.

[0096] f) Add 80 μL of DNase 1 working solution to the center of adsorption column CR3 and leave at room temperature for 15 minutes.

[0097] g) Add 350 μL of deproteinized solution to the adsorption column CR3, centrifuge at 12,000 rpm for 60 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.

[0098] h) Add 500 μL of rinse solution to the adsorption column CR3, let stand at room temperature for 2 min, centrifuge at 12,000 rpm for 60 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube. Repeat once.

[0099] i) Centrifuge at 12,000 rpm for 2 min and discard the waste liquid. Place the adsorption column CR3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0100] j) Note: The purpose of this step is to remove the residual rinse solution in the adsorption column CR3. The residual rinse solution may affect subsequent RT experiments. Place the adsorption column CR3 in a new RNase-Free centrifuge tube and drop 30-100 μL RNase-Free ddH 2 O, place at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min to obtain RNA solution.

[0101] 1.4 Primer and probe design and sequence optimization

[0102] This experiment uses TaqMan qPCR microfluidic chip technology to collect information based on the target pathogens on the raw grains, and to transform and design specific qPCR primers and probes.

[0103] Specifically, primer probe sequences were designed for the coat protein-like gene target of wheat streak mosaic virus, primer probe sequences were designed for the ITS gene fragment target of soybean northern stem canker pathogen, primer probe sequences were designed for the mitochondrial target of wheat Indian smut pathogen, and primer probe sequences were designed for the mitochondrial target of ryegrass smut pathogen.

[0104] Probe sequences were designed for the coat protein gene target of maize chlorotic mottle virus, the 16SrRNA gene target of bean bacterial wilt pathogen, the cpsA-cpsBintergenic spacer target of maize bacterial wilt pathogen, the 16SrRNA gene target of corn internal wilt pathogen, the 16SrRNA gene target of tomato canker pathogen, the coat protein-like gene target of southern bean mosaic virus, the coat protein gene target of Arabidopsis mosaic virus, the coat protein-like gene target of tomato ringspot virus, the NTS gene fragment target of soybean stem brown rot pathogen, and the IGS gene target of North American soybean sudden death syndrome pathogen.

[0105] The sequences of primers and probes are shown in Table 3. All primers and probes were synthesized by Shanghai Bioengineering Co., Ltd. The amplified fragments of the primers in this example are shown in Table 4.

[0106] In this experiment, the target fragment was cloned into pUC57 plasmid for the amplification of specific primers and used as a positive control. The plasmid cloning was performed by Shanghai Bioengineering Co., Ltd.

[0107] Table 3 Primer and probe sequences

[0108] name Sequence (5'-3') SEQ ID No. Soybean Northern Stem Canker F CCAGAAACCCTTTGTGAACTT 1 Soybean Northern Stem Canker ATGTTTATTTCTCAGAGTTTCAGTG 2 Soybean northern stem canker P FAM-CGGCCAAGCTAACTCTTG-MGB 3 Soybean stem brown rot F GGAATTGGTGGGAGAGG 4 Soybean stem brown rot GACTTCTAGGGTATGTCTACAGTG 5 Soybean stem brown rot FAM-AGG CTA CTC TTA CAG GCT CTC-MGB 6 North American soybean sudden death F GGTGCAGGGTAGGTCAGATTTG 7 North American soybean sudden death ACCATCCGTCTGGGAATTTTAACTA 8 North American soybean sudden death FAM-TCCCACTAAATCTGGT-MGB 9 Bean bacterial wilt F GTTATGACTGAACTTCACTCC 10 Bean bacterial wilt R GATGTTCCCGGTGTTCAG 11 Bean bacterial wilt P TCAATTGCCGCCACCCGGTC 12 Triticum indica F GGCACCAGAGTACAGCTG 13 Triticum indica R GCGAAGCGGTCCATGTC 14 Triticum indica P FAM-ATGATGGCCTCGATACCA-MGB 15 Ryegrass black powder F ATGACTTTCATGATGGCCTCT 16 Ryegrass black powder GCGAAGCGGTCCATGTT 17 Ryegrass black powder P CCGACGTTGGTCTC 18 Wheat Line Mosaic F ACGACAATCAGCAAGAGACCAA 19 Wheat Line Mosaic R TGAGGATCGCTGTGTTTCAGTC 20 Wheat Line Mosaic P FAM-ATGGAGTTCAAGAGAATATGA-MGB 21 Corn bacterial wilt F AGAAAACGCTGATGCCAGAC 22 Corn bacterial wilt ACTATCCTGACTCAGGCACT 23 Corn bacterial wilt FAM-CAACCGTTTTCATAGTACCA-MGB 24 Corn Wilting F TGTCGAGGGCATGTTGCACG 25 Corn Wilting in the State GGAGACAGAATTGACCAATGAT 26 Corn Wilting in the State FAM-TCGGACCCTTTCCGTC-MGB 27 Corn Chlorotic Mottle F CCATGTCCGAAATTCTGCTTG 28 Corn chlorosis R GATGCGCACAGAGTTGAACAC 29 Corn Chlorotic Mottled FAM-CGAGATTCCAGTGTGCG-MGB 30 Tomato Canker F TCAGGCGTCTGTTCTGGC 31 Tomato canker CCCACCACCATCCACAAC 32 Tomato canker FAM-TCGGGCTGCTAGTACG-MGB 33

[0109] Table 4 Primer amplification fragments

[0110]

[0111]

[0112] It should be noted that the 11 kinds of quarantine pathogens of raw grains detected in this example have primers and probes for separate detection in public literature or materials; however, in order to meet the simultaneous detection of 11 kinds of quarantine pathogens of raw grains by the microfluidic chip in this example, primers or probes that meet the use requirements of this example were redesigned for the detection targets of these quarantine pathogens of raw grains. For example, for the northern soybean stem canker pathogen, the newly designed primers and probes in this example have better specificity and are less likely to form hairpin structures and dimer structures. The experimental results show that the newly designed primers and probes in this example have higher amplification efficiency and better specificity than the existing primers and probes.

[0113] In this example, the specificity and sensitivity tests were conducted using the existing soybean northern stem canker pathogen primers and probes: DC2F, DC2R, and DC2Pb. The existing primer and probe sequences are as follows:

[0114] DC2F, SEQ ID No.34: 5'-CCGGCGGCCAAGCTA-3'

[0115] DC2R, SEQ ID No.35: 5'-AGAACCAAGAGATCCGTTGTTGAA-3'

[0116] DC2Pb, SEQ ID No.36: 5'-FAM-CATTTATGTTTATTTCTCAGAGTTT-MGB-3'

[0117] The above primer probes were tested in the same microfluidic chip using the same reaction system and conditions as in this example.

[0118] The existing standard method for detecting the North American soybean sudden death syndrome pathogen is the dual PCR method, and there is no qPCR detection method. In this case, a new qPCR primer probe was designed for it.

[0119] With respect to the existing qPCR detection method for wheat Indian bunt fungus, the newly designed front and rear primers and probe in this example all have good specificity; moreover, the newly designed primers are less likely to form hairpin structures than the original primers.

[0120] In this example, the specificity and sensitivity tests were conducted using the existing primers and probes for wheat Indian smut fungus: wheat Indian smut F, wheat Indian smut R, and wheat Indian smut P as a comparison. The sequences of the existing primers and probes are as follows:

[0121] Wheat stigma F, SEQ ID No. 37: 5'-AGCCATCACTGGAGTTGTCATG-3'

[0122] Triticum aestivum R, SEQ ID No. 38: 5'-CCCAGCAAGGTCACCTTTGA-3'

[0123] Triticum aestivum P, SEQ ID No. 39: 5'-FAM-CCGACCGTATCGGTCT-MGB-3'

[0124] The above primer probes were tested in the same microfluidic chip using the same reaction system and conditions as in this example.

[0125] 1.5 Microfluidic chip design

[0126] The upper layer of the microfluidic chip is a sealing cover to prevent liquid evaporation and aerosol contamination; the lower layer is an eight-channel reaction chip made of polycarbonate (PC) and polyethylene (PE) materials. Each channel corresponds to a sample injection port and contains 48 reaction areas with a volume of 1 μL, so 384 qPCR reactions can be run independently at the same time. The qPCR primers and probes corresponding to the target pathogens are pre-embedded in each reaction area of ​​the microfluidic chip, and also include a sample nucleic acid extraction quality control gene 18S internal reference, which is provided by Thermo Fisher. For details on the design of the microfluidic chip, see Figure 1 .

[0127] 1.6 Specificity test

[0128] The target pathogen positive plasmid and nucleic acid were used for specific detection on the prepared microfluidic chip. The nucleic acid of 11 kinds of important quarantine plant pathogens on raw grains was used for TaqMan qPCR microfluidic chip detection, and specific analysis was performed to determine whether there was cross-reaction between different pathogens. After the concentration of each target pathogen nucleic acid solution was measured, the concentration was converted into DNA / RNA copy number and ddH2O was used without nucleic acid. 2 O for dilution and specificity experiments.

[0129] The soybean stem canker pathogen Diaporthe phaseolorum var.caulivora was isolated from three different strains of DNA, labeled as 2012SC01 DNA, 2013SA01 DNA, and 2013SC02 DNA, as positive controls. Diaporthe phaseolorum var.meridionalis, Diaporthe helianthi, Cadophora gregata, Phytophthora sojae, Fusarium virguliforme, and Fusarium tucumaniae were used as negative controls. ddH 2 O served as blank control.

[0130] The soybean stem brown rot pathogen Cadophora gregata used DNA extracted from three different strains (labeled as 2015SU85 DNA, 2014SU85 DNA, and 2014SU84 DNA) as positive controls, and Fusariumvirguliforme, Fusariumtucumaniae, Diaporthe phaseolorum var.caulivora, Diaporthe phaseolorum var.meridionalis, and Phytophthora sojae as negative controls. 2 O served as blank control.

[0131] The North American soybean sudden death syndrome pathogen Fusarium virguliforme used DNA extracted from three different source strains (labeled as 22490DNA, 22825DNA, and ARG1.1 DNA) as positive controls, and Fusariumgraminearum, Fusariumbrsiliense, Fusariumtucumaniae, Diaporthephaseolorumvar.caulivora, Diaporthephaseolorumvar.meridionalis, Cadophoragregata, and Phytophthorasojae as negative controls. 2 O served as blank control.

[0132] Curtobacterium flaccumfaciens pv.flaccumfaciens, the bacterial wilt pathogen of kidney bean, used DNA extracted from three different strains (labeled as 470360DNA, 470359DNA, and 470358DNA) as positive controls, and Curtobacterium flaccumfaciens.pv.oortii, Curtobacterium flaccumfacienspv.betae, Pantoea stewartii subsp.stewartii, Clavibacter michiganensissubsp.nebraskensis, and Clavibacter michiganensis subsp.michiganensis as negative controls, and set ddH 2 O served as blank control.

[0133] The wheat Indian bunt fungus Tilletia indica used DNA extracted from three different strains (labeled as 5114DNA, TIM2-180926DNA, and TIM1-180919DNA) as positive controls, and Tilletia walkeri, Tilletia controversa, Tilletia fusca, Tilletia foetida, and Tilletia laevis as negative controls. 2 O served as blank control.

[0134] DNA extracted from three different strains of Tilletia walkeri (CBS121956DNA, CBS121955DNA, and T39 DNA) was used as a positive control, and Tilletia indica, Tilletia controversiala, Tilletia fusca, Tilletia foetida, and Tilletia laevis were used as negative controls. 2 O served as blank control.

[0135] Wheat streak mosaic virus WSMV used RNA extracted from three different strains (labeled as WSMVC2725RNA, WSMV JC RNA, and WSMV 1RNA) as positive controls, and BPMV, SBMV, MCMV, ArMV, ToRSV, and BYMV as negative controls. 2 O served as blank control.

[0136] The corn bacterial wilt pathogen Pantoea stewartii subsp. stewartii used DNA extracted from three different strains (labeled as 470524DNA, 470522DNA, and 470523DNA) as positive controls, and Pantoea.dispersa, Clavibacter michiganensis subsp.nebraskensis, Curtobacteriumflaccumfaciens pv.oortii, and Curtobacterium flaccumfaciens pv.betae as negative controls, and ddH 2 O served as blank control.

[0137] The maize wilt pathogen Clavibacter michiganensis subsp. nebraskensis used DNA extracted from three different strains (labeled as 470321DNA, 470324DNA, and 470322DNA) as positive controls, and Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, and Pantoeastewartii subsp. stewartii as negative controls, and ddH 2 O served as blank control.

[0138] The maize chlorotic mottle virus MCMV used RNA extracted from three different strains (labeled as MCMVC2453RNA, MCMV JC1 RNA, and MCMV+RNA) as positive controls, and BPMV, SBMV, WSMV, ArMV, ToRSV, and BYMV as negative controls. 2 O served as blank control.

[0139] The tomato canker pathogen Clavibacter michiganensis subsp. michiganensis used DNA extracted from three different strains (labeled as 470302DNA, 470307DNA, and 470303DNA) as positive controls, and Clavibacter michiganensis subsp. nebraskensis, Clavibacter michiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, and Pantoeastewartii subsp. stewartii as negative controls. 2 O served as blank control.

[0140] Microfluidic chip qPCR reaction system includes: TaqPath TM 1-Step RT-qPCR MM, CG (4×) 25μL, nucleic acid sample 50μL, ddH 2 25 μL of HO for a total volume of 100 μL.

[0141] The working solution was added to the sample wells of the microfluidic chip through the sample port, and centrifuged at 1000g for 2 minutes in an ST40R microfluidic chip centrifuge to evenly distribute the working solution to the 384 PCR reaction areas. The passages of each reaction chamber on the microfluidic chip were sealed with a sealer to prepare for the reaction.

[0142] In QuantStudio TM On the 7Flex Real-Time PCR instrument, the qPCR amplification reaction running parameters are as follows: Figure 2 As shown, specifically including: 25°C for 2 min, 50°C for 15 min, 95°C for 10 min, then enter 40 cycles: 95°C for 3 s, 60°C for 1 min, and standby at 4°C after the cycle ends.

[0143] 1.7 Sensitivity test

[0144] 1.7.1 Sensitivity of plasmid standards

[0145] Add 1000 μL of nuclease-free ddHO to each plasmid tube. 2 O was prepared into a plasmid solution with a concentration of 4 ng / μL, and then diluted to 10 according to the length of the plasmid fragment using the Thermo Fisher DNA Copy Number and Dilution Calculator. 7 The concentration of plasmid is 10 7 10 μL of each target pathogen positive plasmid with a copy / μL was added to 880 μL of enzyme-free water to obtain 1000 μL of a concentration of 10 5 The sensitivity verification was performed by setting 7 gradient concentrations, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 Copies / μL, which corresponds to the detection limit. The microfluidic chip qPCR reaction system and qPCR amplification reaction operating parameters are the same as "1.6 Specificity Test".

[0146] 1.8 Accuracy Verification

[0147] The accuracy experiment was carried out simultaneously with the sensitivity test, that is, the plasmid with the lowest stable detection limit was tested 5 times repeatedly to evaluate the accuracy and stability of the detection system.

[0148] 1.9 Actual sample inspection

[0149] Soybeans carrying soybean northern stem canker pathogens and soybeans artificially inoculated with bean bacterial wilt pathogens were selected as materials, and nucleic acid was extracted from them using the silicon-based membrane column method and tested by microfluidic chip method. Among them, the DNA kit used for nucleic acid extraction by silicon-based membrane column method is QIAGEN DNeasy Plant Pro Kit, and the RNA kit is TIANGEN RNAprep pure Plant Kit. For the specific extraction process, please refer to the instructions. The microfluidic chip qPCR reaction system and qPCR amplification reaction operation parameters are the same as "1.6 Specificity Test".

[0150] 2 Results

[0151] 2.1 Specificity test results

[0152] The specific detection results of 11 kinds of quarantine pathogens in raw grains are as follows Figures 3 to 13 As shown, Figures 3 to 13 These are the specific detection results of soybean northern stem canker pathogen Diaporthe phaseolorum var.caulivora, soybean stem brown rot pathogen Cadophora gregata, North American soybean sudden death syndrome pathogen Fusarium virguliforme, bean bacterial wilt pathogen Curtobacterium flaccumfaciens pv.flaccumfaciens, wheat Indian bunt pathogen Tilletiaindica, ryegrass bunt pathogen Tilletia walkeri, wheat streak mosaic virus WSMV, corn bacterial wilt pathogen Pantoea stewartii subsp.stewartii, corn inner state wilt pathogen Clavibacter michiganensissubsp.nebraskensis, maize chlorotic mottle virus MCMV, and tomato canker pathogen Clavibacter michiganensissubsp.michiganensis.

[0153] Figure 3The results showed that the Cq values ​​of the two replicates of soybean stem canker pathogen 2012SC01 were 28.407 and 28.080, respectively; the Cq values ​​of the two replicates of 2013SA01 DNA were 27.122 and 27.036; the Cq values ​​of the two replicates of 2013SC02 DNA were 22.920 and 22.039; the negative control n (Diaporthe phaseolorum var.meridionalis, Diaporthe helianthi, Cadophora gregata, Phytophthora sojae, Fusariumvirguliforme, Fusarium tucumaniae) and the blank control CK were not detected.

[0154] Figure 4 The results showed that the Cq values ​​of the two replicates of soybean stem brown rot fungus 2014SU84 DNA were 21.250 and 21.383, respectively; the Cq values ​​of the two replicates of 2014SU85 DNA were 28.378 and 28.435; the Cq values ​​of the two replicates of 2015SU85 DNA were 20.758 and 20.744; the negative control n (Fusarium virguliforme, Fusarium tucumaniae, Diaporthephaseolorum var.caulivora, Diaporthe phaseolorum var.meridionalis, Phytophthorasojae) and the blank control CK were not detected.

[0155] Figure 5 The results showed that the Cq values ​​of the two replicates of North American soybean sudden death syndrome pathogen 22490 DNA were 25.890 and 25.422 respectively; the Cq values ​​of the two replicates of 22825 DNA were 17.004 and 17.407; the Cq values ​​of the two replicates of ARG1.1 DNA were 18.258 and 18.543; the negative control n (Fusarium graminearum, Fusarium brasiliense, Fusariumtucumaniae, Diaporthe phaseolorum var.caulivora, Diaporthe phaseolorumvar.meridionalis, Cadophora gregata, Phytophthora sojae) and the blank control CK were not detected.

[0156] Figure 6The results showed that the Cq values ​​of two replicates of DNA of bacterial wilt pathogen NCPPB1446 of kidney bean were 26.794 and 26.037 respectively; the Cq values ​​of two replicates of 470359 DNA were 22.656 and 22.767; the Cq values ​​of two replicates of 470358 DNA were 25.134 and 25.638; the negative control n (Curtobacterium flaccumfaciens.pv.oortii, Curtobacterium flaccumfaciens pv.betae, Pantoea stewartii subsp.stewartii, Clavibacter michiganensis subsp.nebraskensis, Clavibacter michiganensissubsp.michiganensis) and the blank control CK were not detected.

[0157] Figure 7 The results showed that the Cq values ​​of the two replicates of wheat bunt fungus 5114 DNA were 26.737 and 26.294 respectively; the Cq values ​​of the two replicates of TIM2-180926 DNA were 27.974 and 27.731 respectively; the Cq values ​​of the two replicates of TIM1-180919 DNA were 28.980 and 29.108 respectively; the negative control n (Tilletia walkeri, Tilletia controversa, Tilletia fusca, Tilletia foetida, Tilletia laevis) and the blank control CK were not detected.

[0158] Figure 8 The results showed that the Cq values ​​of two replicates of Tilletia perenne CBS121956 DNA were 23.146 and 23.082 respectively; the Cq values ​​of two replicates of CBS121955 DNA were 31.951 and 30.853 respectively; the Cq values ​​of two replicates of T39 DNA were 29.379 and 29.409 respectively; the negative control n (Tilletia indica, Tilletia controversa, Tilletia fusca, Tilletia foetida, Tilletia laevis) and the blank control CK were not detected.

[0159] Fig. 9The results showed that the Cq values ​​of wheat streak mosaic virus WSMV C2725 RNA were 31.866 and 32.666 respectively; the Cq values ​​of WSMV JC RNA were 27.145 and 26.691 respectively; the Cq values ​​of WSMV 1RNA were 30.764 and 30.438 respectively; the negative control n (BPMV, SBMV, MCMV, ArMV, ToRSV, BYMV) and the blank control CK were not detected.

[0160] Fig.10 The results showed that the Cq values ​​of the two replicates of corn bacterial wilt fungus 470524 DNA were 20.314 and 19.933 respectively; the Cq values ​​of the two replicates of 470522 DNA were 25.785 and 25.243 respectively; the Cq values ​​of the two replicates of 470523 DNA were 24.166 and 24.173 respectively; the negative control n (Pantoea.dispersa, Clavibacter michiganensissubsp.nebraskensis, Curtobacterium flaccumfaciens pv.oortii, Curtobacteriumflaccumfaciens pv.betae) and the blank control CK were not detected.

[0161] Fig.11 The results showed that the Cq values ​​of the two replicates of corn wilt pathogen 470321 DNA were 21.162 and 20.765 respectively; the Cq values ​​of the two replicates of 470324 DNA were 24.365 and 24.808 respectively; the Cq values ​​of the two replicates of 470322 DNA were 21.605 and 21.519 respectively; the negative control n (Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, Pantoea stewartii subsp. stewartii) and the blank control CK were not detected.

[0162] Fig.12The results showed that the Cq values ​​of two replicates of maize chlorotic mottle virus MCMV C2453 RNA were 10.493 and 10.472, respectively; the Cq values ​​of two replicates of MCMV JC1 RNA were 11.172 and 10.997, respectively; the Cq values ​​of two replicates of MCMV+RNA were 33.682 and 26.235, respectively; the negative control n (BPMV, SBMV, WSMV, ArMV, ToRSV, BYMV) and the blank control CK were not detected.

[0163] Fig.13 The results showed that the Cq values ​​of the two replicates of tomato canker pathogen 470302 DNA were 21.763 and 21.866 respectively; the Cq values ​​of the two replicates of 470303 DNA were 22.855 and 22.936 respectively; the Cq values ​​of the two replicates of 470307 DNA were 27.311 and 27.290 respectively; the negative control n (Clavibacter michiganensis subsp. nebraskensis, Clavibactermichiganensis subsp. tessellarius, Clavibacter michiganensis subsp. sepedonicus, Pantoea stewartii subsp. stewartii) and the blank control CK were not detected.

[0164] The above results show that the specific primer probe designed in this experiment only has specific amplification for the detection target, but not for other similar pathogens, indicating that the microfluidic chip in this experiment has good specificity.

[0165] 2.2 Sensitivity test results

[0166] Sensitivity test results are as follows Figures 14 to 24 As shown, Figures 14 to 24 The numbers in the digits correspond to copies that are powers of 10. Figures 14 to 24The sensitivity test results are, in order, for the northern soybean stem canker pathogen Diaporthe phaseolorum var.caulivora, the soybean stem brown rot pathogen Cadophora gregata, the North American soybean sudden death syndrome pathogen Fusarium virguliforme, the bean bacterial wilt pathogen Curtobacterium flaccumfaciens pv.flaccumfaciens, the wheat Indian bunt pathogen Tilletia indica, the ryegrass bunt pathogen Tilletia walkeri, the wheat streak mosaic virus WSMV, the corn bacterial wilt pathogen Pantoea stewartii subsp.stewartii, the maize inner state wilt pathogen Clavibactermichiganensis subsp.nebraskensis, the maize chlorotic mottle virus MCMV, the rapeseed stem base canker pathogen Leptosphaeria maculans, and the tomato canker pathogen Clavibacter michiganensissubsp.michiganensis.

[0167] Fig.14 The sensitivity test results of soybean northern stem canker pathogen Diaporthe phaseolorum var.caulivora showed that 10 5 The Cq values ​​of the plasmid copies / μL were 18.473 and 18.481; 10 4 The Cq values ​​of the plasmids with copies / μL were 22.554 and 22.375 respectively; 10 3 The Cq values ​​of the plasmids with copies / μL were 25.901 and 25.410; 10 2 The Cq values ​​of the plasmids with copies / μL were 28.213 and 28.973; 10 1 The Cq values ​​of the plasmid copies / μL were 31.995 and 31.860; 10 0 The Cq values ​​of the copies / μL plasmid were 35.699, and the other one was not detected; 10 -1 No Cq values ​​of 10 copies / μL plasmid were detected. 1 The minimum stable detection limit of 10 copies / μL plasmid was tested for 5 times, and the Cq values ​​were 32.947, 32.231, 32.843, 31.965, and 32.804, respectively. In summary, the detection sensitivity of soybean northern stem canker pathogen can reach 10 copies / μL.

[0168] Fig.15 The sensitivity test results of soybean stem brown rot pathogen Cadophora gregata showed that 10 5The Cq values ​​of the plasmids with copies / μL were 17.461 and 17.255; 10 4 The Cq values ​​of the plasmid copies / μL were 20.669 and 20.863; 10 3 The Cq values ​​of the plasmids with copies / μL were 24.072 and 23.979; 10 2 The Cq values ​​of the plasmids with copies / μL were 27.156 and 27.196 respectively; 10 1 The Cq values ​​of the plasmids with copies / μL were 31.112 and 30.928; 10 0 The Cq values ​​of the plasmids with copies / μL were 34.347 and 34.436 respectively; 10 -1 No Cq values ​​of 10 copies / μL plasmid were detected. 0 The minimum stable detection limit of 1 copy / μL plasmid was tested for 5 times, and the Cq values ​​were 33.055, 33.363, 32.414, 32.801, and 32.891 respectively. In summary, the detection sensitivity of soybean stem brown rot pathogen can reach 1 copy / μL.

[0169] Fig.16 The sensitivity test results of Fusarium virguliforme, the pathogen of soybean sudden death syndrome in North America, showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 20.908 and 20.549; 10 4 The Cq values ​​of the plasmids with copies / μL were 24.407 and 24.643; 10 3 The Cq values ​​of the plasmids with copies / μL were 27.514 and 27.141; 10 2 The Cq values ​​of the plasmids with copies / μL were 30.272 and 30.834; 10 1 The Cq values ​​of the plasmid copies / μL were 33.633 and 35.496; 10 0 The Cq values ​​of the plasmid copies / μL were 35.896, undetectable; 10 -1 No Cq values ​​of 10 copies / μL plasmid were detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 33.688, 33.799, 33.219, 33.102, and 33.728 respectively. In summary, the detection sensitivity of North American soybean sudden death syndrome pathogen can reach 10 copies / μL.

[0170] Fig.17 The sensitivity test results of Curtobacterium flaccumfaciens pv.flaccumfaciens, the bacterial wilt pathogen of kidney beans, showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 24.557 and 24.315 respectively; 104 The Cq values ​​of the plasmids with copies / μL were 27.899 and 28.198 respectively; 10 3 The Cq values ​​of the plasmids with the copies / μL were 31.453 and 30.986; 10 2 The Cq values ​​of the plasmids with copies / μL were 34.235 and 32.379; 10 1 Copies / μL plasmid Cq value not detected; 10 0 Copies / μL plasmid Cq value not detected; 10 -1 No Cq values ​​of 10 copies / μL plasmid were detected. 2 The minimum stable detection limit of 1000 copies / μL plasmid was tested for 5 times, and the Cq values ​​were 32.581, 31.746, 32.323, 33.983, and 32.536, respectively. 3 The actual concentration of the positive plasmid was 6.34 copies / μL by digital PCR quantification, and the positive plasmid was degraded. Therefore, the lowest stable detection limit of the microfluidic chip was 0.634 copies / μL. In summary, the detection sensitivity of bacterial wilt pathogen of bean can reach 1 copy / μL.

[0171] Fig.18 The sensitivity test results of wheat Indian bunt fungus showed that 10 5 The Cq values ​​of the plasmid copies / μL were 20.063 and 19.667; 10 4 The Cq values ​​of the plasmids with copies / μL were 22.793 and 22.311; 10 3 The Cq values ​​of the plasmids with copies / μL were 25.057 and 25.238 respectively; 10 2 The Cq values ​​of the plasmids with copies / μL were 28.118 and 28.375; 10 1 The Cq values ​​of the plasmid copies / μL were 32.718 and 32.066; 10 0 The Cq values ​​of the plasmid copies / μL were not detected, 32.414; 10 -1 The Cq values ​​of the plasmid copies / μL were not detected. 1 The minimum stable detection limit test of 1000 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 32.183, 31.548, 31.576, 31.022, and 32.007, respectively. In summary, the detection sensitivity of Indian smut fungus can reach 10 copies / μL.

[0172] Fig.19 The sensitivity test results of Tilletia perenne showed that 10 5 The Cq values ​​of the plasmid copies / μL were 20.299 and 19.765; 10 4The Cq values ​​of the plasmid copies / μL were 22.887 and 22.997; 10 3 The Cq values ​​of the plasmids with copies / μL were 26.321 and 25.816; 10 2 The Cq values ​​of the plasmid copies / μL were 29.048 and 29.196; 10 1 The Cq values ​​of the plasmids with copies / μL were 33.526 and 32.132 respectively; 10 0 Copies / μL plasmid Cq value not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 32.803, 31.887, 31.514, 31.974, and 32.415, respectively. In summary, the detection sensitivity of T. perenne can reach 10 copies / μL.

[0173] Fig. 20 The sensitivity test results of wheat streak mosaic virus showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 21.071 and 20.716; 10 4 The Cq values ​​of the plasmids with copies / μL were 23.591 and 23.623; 10 3 The Cq values ​​of the plasmids with copies / μL were 26.596 and 27.010; 10 2 The Cq values ​​of the plasmids with copies / μL were 29.929 and 30.232; 10 1 The Cq values ​​of the plasmids with copies / μL were 35.606 and 31.974; 10 0 The Cq values ​​of the copies / μL plasmid were 35.632, and the other one was not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 31.666, 32.589, 31.860, 32.730, and 32.461 respectively. In summary, the detection sensitivity of wheat streak mosaic virus can reach 10 copies / μL.

[0174] Fig.21 The sensitivity test results of corn bacterial wilt pathogens showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 20.073 and 19.787; 10 4 The Cq values ​​of the plasmids with copies / μL were 22.851 and 23.216; 10 3 The Cq values ​​of the plasmids with copies / μL were 25.837 and 26.009; 10 2 The Cq values ​​of the plasmids with copies / μL were 29.155 and 29.318; 101 The Cq values ​​of the plasmids with copies / μL were 31.961 and 33.803; 10 0 The Cq values ​​of the plasmid copies / μL were 34.587 and the other one was not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 1000 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 32.759, 32.003, 31.717, 32.371, and 33.041, respectively. In summary, the detection sensitivity of corn bacterial wilt pathogen can reach 10 copies / μL.

[0175] Fig. 22 The sensitivity test results of corn wilt pathogen showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 19.361 and 18.283; 10 4 The Cq values ​​of the plasmids with copies / μL were 22.037 and 22.311; 10 3 The Cq values ​​of the plasmids with copies / μL were 25.270 and 25.342 respectively; 10 2 The Cq values ​​of the plasmids with copies / μL were 28.077 and 28.520 respectively; 10 1 The Cq values ​​of the plasmids with copies / μL were 32.942 and 34.788 respectively; 0 The Cq values ​​of the plasmid copies / μL were 34.801 and the other one was not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 33.083, 31.868, 32.785, 32.555, and 31.795 respectively. In summary, the detection sensitivity of corn wilt pathogen can reach 10 copies / μL.

[0176] Fig.23 The sensitivity test results of maize chlorotic mottle virus showed that 10 5 The Cq values ​​of the plasmid copies / μL were 20.008 and 20.172; 10 4 The Cq values ​​of the plasmids with copies / μL were 23.285 and 23.050; 10 3 The Cq values ​​of the plasmid copies / μL were 26.385 and 26.429; 10 2 The Cq values ​​of the plasmids with copies / μL were 29.472 and 29.583; 10 1 The Cq values ​​of the plasmids with copies / μL were 32.773 and 34.717 respectively; 10 0 The Cq values ​​of the plasmid copies / μL were 35.294 and the other one was not detected; 10 -1The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit test of 10 copies / μL plasmid was repeated 5 times, and the Cq values ​​were 32.794, 33.215, 31.262, 32.682, and 32.481, respectively. In summary, the detection sensitivity of maize chlorotic mottle virus can reach 10 copies / μL.

[0177] Fig.24 The sensitivity test results of tomato canker pathogens showed that 10 5 The Cq values ​​of the plasmids with copies / μL were 19.430 and 19.282; 10 4 The Cq values ​​of the plasmids with copies / μL were 22.259 and 22.628 respectively; 10 3 The Cq values ​​of the plasmids with copies / μL were 25.323 and 25.575; 10 2 The Cq values ​​of the plasmids with copies / μL were 28.581 and 29.398 respectively; 10 1 The Cq values ​​of the plasmids with copies / μL were 32.487 and 32.473; 10 0 Copies / μL plasmid Cq value not detected; 10 -1 The Cq value of the plasmid copies / μL was not detected. 1 The minimum stable detection limit of 10 copies / μL plasmid was tested for 5 times, and the Cq values ​​were 32.119, 31.659, 30.769, 32.185, and 32.016, respectively. In summary, the detection sensitivity of tomato canker pathogen can reach 10 copies / μL.

[0178] The above results show that among the 11 pathogens, two reached 1 copy / μL, namely soybean stem brown rot and bean bacterial wilt; nine reached 10 copies / μL, namely soybean northern stem canker, North American soybean sudden death syndrome, wheat Indian bunt, ryegrass bunt, wheat streak mosaic virus, corn bacterial wilt, corn internal wilt, corn chlorotic mottle virus, and tomato canker.

[0179] 2.3 Primer and probe alignment

[0180] The results of specific detection using the soybean northern stem canker pathogen primers and probes: DC2F, DC2R, DC2Pb are as follows Fig.29 The sensitivity test results are shown in Fig.30 shown. Fig.29 The results showed that the existing primers and probes for soybean northern stem canker pathogen also produced amplification signals for the negative control n, indicating that the specificity of the existing primers and probes was weak. Fig.30 The results showed that the detection limit of the existing primer probe was about 10 2copies / μL, which is 10 lower than the lowest stable detection limit of the new primer probe designed in this example. 1 The copies / μL were one order of magnitude lower.

[0181] The existing standard method for North American soybean sudden death syndrome pathogen is the dual PCR method, and there is no qPCR detection method. In this case, the qPCR primer probe designed for it has a primer hairpin structure and a dimer structure energy level of less than 4.5. The experimental results show that the specificity is good and the sensitivity can reach 10 copies / μL.

[0182] For the existing qPCR detection method for wheat Indian bunt, the newly designed front and rear primers and probes in this example have good specificity, and the newly designed primers are less likely to form hairpin structures than the original primers; the experimental results show that the new primer probes have higher amplification efficiency and better specificity than the original primer probes.

[0183] The results of specificity test using the existing wheat Indian smut primers and probes: wheat Indian smut F, wheat Indian smut R, wheat Indian smut P are as follows Fig.31 The sensitivity test results are shown in Fig.32 shown. Fig.31 The results showed that the amplification signal of the existing primers and probes for the same positive sample was weaker than the amplification signal of the newly designed primers and probes in this example. Fig.32 The results showed that the detection limit of the existing primer probe was about 10 2 copies / μL, which is 10 lower than the lowest stable detection limit of the new primer probe designed in this example. 1 The copies / μL were also an order of magnitude lower.

[0184] In summary, the primers and probes that were redesigned to meet the usage requirements of the microfluidic chip in this example have better specificity and sensitivity, so that the microfluidic chip in this example can achieve high-throughput detection of 11 kinds of quarantine pathogens in raw grains of 8 samples with high specificity and high sensitivity in one detection chip, thereby improving the quality and efficiency of inspection and quarantine work.

[0185] 2.4 Accuracy test

[0186] The results showed that all target pathogen positive controls were amplified normally, among which 18s was the internal reference well of the chip, which was used to confirm whether the chip was working normally.

[0187] 2.5 Actual sample test results

[0188] The actual sample test results are as follows Figures 25 to 28 As shown, Fig.25 The results of testing soybeans for the pathogenic bacteria of soybean northern stem canker are shown in Figure 1. Fig.26These are the test results of soybeans carrying bacterial wilt pathogen of Phaseolus vulgaris. Fig. 27 To detect the results of northern stem canker of soybean from mixed soybean samples, Fig.28 Results for the detection of bacterial wilt pathogen of Phaseolus vulgaris in mixed soybean samples.

[0189] Fig.25 The results showed that the Cq values ​​of the two replicates of the positive control of soybean northern stem canker pathogen were 19.109 and 18.996, respectively; the Cq values ​​of the two replicates of soybean northern stem canker pathogen DNA were 24.360 and 24.170, respectively; the negative control n (soybean southern stem canker pathogen, negative soybean sample) was not detected; and the blank control CK was not detected.

[0190] Fig.26 The results showed that the Cq values ​​of the two replicates of the positive control of bacterial wilt pathogen of kidney bean were 18.312 and 18.165, respectively; the Cq values ​​of the two replicates of bacterial wilt pathogen of kidney bean DNA were 25.866 and 25.742, respectively; the negative control n (Bacillus wilt pv. oortii, negative soybean sample) was not detected; the blank control CK was not detected.

[0191] Fig. 27 The results showed that the Cq values ​​of soybean sample DNA 1 were repeated twice and were 16.466 and 16.396 respectively; the Cq values ​​of DNA2 were repeated twice and were 26.370 and 25.549 respectively; the Cq values ​​of DNA3 were repeated twice and were 19.388 and 19.123 respectively; the Cq values ​​of the positive control of soybean northern stem canker pathogen were repeated twice and were 28.615 and 28.516 respectively; the negative control n (soybean southern stem canker pathogen, negative soybean sample) was not detected; the blank control CK was not detected.

[0192] Fig.28 The results showed that the Cq values ​​of soybean sample DNA1 were repeated twice and were 10.108 and 10.601 respectively; the Cq values ​​of DNA2 were repeated twice and were 20.227 and 19.733 respectively; the Cq values ​​of DNA3 were repeated twice and were 11.919 and 11.390 respectively; the Cq values ​​of the positive control of bean bacterial wilt pathogen were repeated twice and were 20.192 and 21.192 respectively; the negative control n (Cfpv.oortii, negative soybean sample) was not detected; the blank control CK was not detected.

[0193] The results showed that the microfluidic chip can be used to detect samples carrying soybean northern stem canker pathogen and bean bacterial wilt pathogen without any false positive or false negative results.

[0194] The above contents are further detailed descriptions of the present application in combination with specific implementation methods, and it cannot be determined that the specific implementation of the present application is limited to these descriptions. For ordinary technicians in the technical field to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A microfluidic chip for detecting quarantine pathogens in raw grains, characterized in that: Each microfluidic chip includes at least 8 detection channels, each detection channel includes at least 48 reaction areas, and the 48 reaction areas are used to detect 11 kinds of quarantine pathogens in raw grains; The 11 types of quarantine pathogens of raw grains include northern stem canker of soybean, brown stem rot of soybean, North American sudden death syndrome of soybean, bacterial wilt of bean, Indian bunt of wheat, ryegrass bunt, wheat streak mosaic virus, bacterial wilt of corn, internal wilt of corn, corn chlorotic mottle virus, and tomato canker.

2. The microfluidic chip according to claim 1, characterized in that: The reaction zone for detecting northern soybean stem canker pathogen contains specific detection primers and probes for northern soybean stem canker pathogen, the reaction zone for detecting soybean stem brown rot pathogen contains specific detection primers and probes for soybean stem brown rot pathogen, the reaction zone for detecting North American soybean sudden death syndrome pathogen contains specific detection primers and probes for North American soybean sudden death syndrome pathogen, the reaction zone for detecting bean bacterial wilt pathogen contains specific detection primers and probes for bean bacterial wilt pathogen, the reaction zone for detecting wheat Indian bunt pathogen contains specific detection primers and probes for wheat Indian bunt pathogen, the reaction zone for detecting ryegrass bunt pathogen contains specific detection primers and probes for The reaction zone contains primers and probes specific for detecting ryegrass smut, the reaction zone for detecting wheat streak mosaic virus contains primers and probes specific for detecting wheat streak mosaic virus, the reaction zone for detecting corn bacterial wilt contains primers and probes specific for detecting corn bacterial wilt, the reaction zone for detecting corn internal wilt contains primers and probes specific for detecting corn internal wilt, the reaction zone for detecting corn chlorotic mottle virus contains primers and probes specific for detecting corn chlorotic mottle virus, and the reaction zone for detecting tomato canker contains primers and probes specific for detecting tomato canker.

3. The microfluidic chip according to claim 2, characterized in that: The upstream and downstream primers of the soybean northern stem canker pathogen-specific detection primer and probe are the sequences shown in Seq ID No. 1 and 2, respectively, and the probe is the sequence shown in Seq ID No. 3; The upstream and downstream primers of the soybean stem brown rot pathogen-specific detection primer and probe are the sequences shown in Seq ID No. 4 and 5, respectively, and the probe is the sequence shown in Seq ID No. 6; The upstream and downstream primers of the North American soybean sudden death syndrome pathogen-specific detection primer and probe are the sequences shown in Seq ID No. 7 and 8, respectively, and the probe is the sequence shown in Seq ID No. 9; The upstream and downstream primers of the bean bacterial wilt pathogen-specific detection primer and probe are the sequences shown in Seq ID No. 10 and 11, respectively, and the probe is the sequence shown in Seq ID No. 12; The upstream and downstream primers of the wheat Indian smut specific detection primer and probe are the sequences shown in Seq ID No. 13 and 14, respectively, and the probe is the sequence shown in Seq ID No. 15; The upstream and downstream primers of the Tilletia perenne specific detection primer and probe are the sequences shown in Seq ID No. 16 and 17, respectively, and the probe is the sequence shown in Seq ID No. 18; The upstream and downstream primers of the wheat streak mosaic virus specific detection primer and probe are the sequences shown in Seq ID No. 19 and 20, respectively, and the probe is the sequence shown in Seq ID No. 21; The upstream and downstream primers of the corn bacterial wilt specific detection primer and probe are the sequences shown in Seq ID No. 22 and 23, respectively, and the probe is the sequence shown in Seq ID No. 24; The upstream and downstream primers of the specific detection primers and probe for corn wilt pathogen are the sequences shown in Seq ID No. 25 and 26, respectively, and the probe is the sequence shown in Seq ID No. 27; The upstream and downstream primers of the maize chlorotic mottle virus specific detection primer and probe are the sequences shown in Seq ID No. 28 and 29, respectively, and the probe is the sequence shown in Seq ID No. 30; The tomato canker pathogen-specific detection primers and the upstream and downstream primers of the probe are the sequences shown in Seq ID No.31 and 32, respectively, and the probe is the sequence shown in Seq ID No.

33.

4. The microfluidic chip according to claim 2, characterized in that: Specific detection primers and probes corresponding to quarantine pathogens in raw grains are pre-embedded in corresponding detection reaction areas.

5. The microfluidic chip according to claim 1, characterized in that: The volume of each reaction zone was 1 μL.

6. Use of the microfluidic chip according to any one of claims 1 to 5 in preparing a kit for detecting quarantine pathogens in raw grains.

7. A kit for detecting quarantine pathogens in raw grains, characterized in that: A microfluidic chip comprising any one of claims 1 to 5.

8. The kit according to claim 7, characterized in that: It also contains positive and / or negative controls for 11 quarantine pathogens in raw grains.

9. The kit according to claim 8, characterized in that: The positive control is a plasmid containing a fragment for detecting quarantine pathogens in raw grain.

10. The kit according to any one of claims 7 to 9, characterized in that: It also contains TaqMan probe method real-time fluorescence quantitative PCR detection reagent.

Images