Engineering bacterium for co-expressing D-mannitol dehydrogenase and D-glucose dehydrogenase and application

Abstract

The invention discloses construction and application of an engineering bacterium for co-expressing D-mannitol dehydrogenase and D-glucose dehydrogenase, and belongs to the technical field of genetic engineering. The technical problem to be solved by the invention is how to co-express D-mannitol dehydrogenase and D-glucose dehydrogenase through a biosynthetic pathway. In order to solve the technical problem, the invention provides recombinant escherichia coli. The recombinant escherichia coli is characterized by containing a D-mannitol dehydrogenase gene, a D-glucose dehydrogenase gene, a glucokinase gene, an acetyl coenzyme A synthetase gene, a D-lactose transporter gene, a D-glucose PTS permease-free gene and a pyruvate oxidase-free gene. And no regulator gene of galactose operon is contained. The invention establishes a preparation method for co-producing D-mannitol and sodium gluconate, which has guiding significance for the production of D-mannitol and sodium gluconate.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an engineering bacterium for co-expressing D-mannitol dehydrogenase and D-glucose dehydrogenase and an application thereof. Background Art

[0002] D-mannitol dehydrogenase with cofactor NAD + or NADP + Under the presence of NAD, it can catalyze the synthesis of D-fructose into D-mannitol. + The price is relatively cheap, NAD + The D-mannitol dehydrogenase (EC 1.1.1.67) of the dependent type is mostly used for the biosynthesis of D-mannitol. D-mannitol is a natural hexavalent alcohol with a sweetness of 50-70% of sucrose and a caloric value of 1.99 kcal / g. It has been used in the food industry as a sweetener and stabilizer. At present, the synthesis methods of D-mannitol mainly include chemical methods, kelp extraction methods and dual enzyme catalysis methods. However, due to the high pollution of the chemical method, the low efficiency of the extraction method and the high concentration of cofactors added by the dual enzyme catalysis method (mmol / L level), the industrial production scale of D-mannitol is limited.

[0003] NAD + Dependent glucose dehydrogenase (EC 1.1.1.118) can catalyze glucose to obtain gluconolactone, and gluconolactone can be further converted into gluconic acid spontaneously during the reaction process. The pH of the reaction system is regulated by sodium hydroxide to maintain the activity of the enzyme within a certain range, thereby promoting the efficient biocatalysis. At the same time, the obtained sodium gluconate is a sodium salt of an organic acid with a wide range of uses, which is mainly used in industries such as food, medicine, construction, and chemical industry. At present, the main production method of sodium gluconate is to use glucose oxidase and catalase for double enzyme oxidation synthesis. Although this method has the characteristics of simple process, high product purity, and low energy consumption, it also has some disadvantages: the price of enzyme preparations is generally high, resulting in increased production costs.

[0004] To address the above problems, an engineered bacterium co-expressing D-mannitol dehydrogenase and D-glucose dehydrogenase was constructed and then applied to the co-production of D-mannitol and sodium gluconate. Summary of the invention

[0005] The technical problem to be solved by the present invention is: how to co-express D-mannitol dehydrogenase and D-glucose dehydrogenase through a biosynthetic pathway.

[0006] In order to solve the above technical problems, in a first aspect, the present invention provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli has the following characteristics:

[0007] A1), containing D-mannitol dehydrogenase gene (MDH);

[0008] A2), containing the D-glucose dehydrogenase gene (GDH);

[0009] A3), containing the glucokinase gene (glk);

[0010] A4), containing acetyl-CoA synthetase gene (acs);

[0011] A5), containing the D-lactose transporter gene (zglf);

[0012] A6), does not contain the D-glucose PTS permease gene (ptsG);

[0013] A7), does not contain the pyruvate oxidase gene (poxB);

[0014] A8) does not contain the regulator gene (galR) of the galactose operon.

[0015] Furthermore, the recombinant Escherichia coli is prepared by carrying out the following steps B1) to B5) in a recipient bacterium.

[0016] B1), introducing the D-mannitol dehydrogenase gene described in A1) into the recipient bacteria;

[0017] B2), introducing the D-glucose dehydrogenase gene (GDH) described in A2) into the recipient bacteria;

[0018] B3), replacing the D-glucose PTS permease gene (ptsG) described in A6) with the glucokinase gene (glk) described in A3);

[0019] B4), replacing the pyruvate oxidase gene (poxB) described in A7) with the acetyl-CoA synthetase gene (acs) described in A4);

[0020] B5), replacing the regulator gene (galR) of the galactose operon described in A8) with the D-lactose transporter gene (zglf) described in A5).

[0021] Furthermore, in the recombinant Escherichia coli,

[0022] A1) the D-mannitol dehydrogenase gene (MDH) is derived from Leuconostoc rapi, Lentilactobacillus parafarraginis or Thermotoganeapolitana;

[0023] A2) the D-glucose dehydrogenase gene (GDH) is derived from Priestia megaterium;

[0024] A3) the glucokinase gene (glk) is derived from Escherichia coli K12;

[0025] A4) the acetyl-CoA synthetase gene (acs) is derived from Escherichia coli K12;

[0026] A5) The D-lactose transporter gene (zglf) is derived from Zymomonas mobilis.

[0027] Furthermore, in the recombinant Escherichia coli,

[0028] A1) The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of D-mannitol dehydrogenase is WP_204770082.1 (09-AUG-2021), WP_056980373.1 (30-APR-2019) or WP_015918880.1 (03-MAY-2021);

[0029] A2) The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-glucose dehydrogenase is WP_013055759.1 (17-FEB-2022);

[0030] A3) The NCBI Reference Sequence Number of the amino acid sequence of glucokinase is NP_416889.1 (09-MAR-2022);

[0031] A4) The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the acetyl-CoA synthetase is NP_418493.1 (09-MAR-2022);

[0032] A5) The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-lactose transporter is WP_011240287.1 (17-OCT-2022);

[0033] A6) The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-glucose PTS permease is NP_415619.1 (09-MAR-2022);

[0034] A7) The NCBI Reference Sequence Number of the amino acid sequence of the pyruvate oxidase is NP_415392.1 (09-MAR-2022);

[0035] A8) The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the regulator of the galactose operon is NP_417314.1 (09-MAR-2022).

[0036] Furthermore, in the recombinant Escherichia coli,

[0037] A1) the nucleotide sequence of the D-mannitol dehydrogenase gene is SEQ ID No.1, SEQ ID No.5 or SEQ ID No.6;

[0038] A2) the nucleotide sequence of the D-glucose dehydrogenase gene is SEQ ID No. 2;

[0039] A3) the nucleotide sequence of the glucokinase gene is SEQ ID No.7;

[0040] A4) the nucleotide sequence of the acetyl-CoA synthetase gene is SEQ ID No.8;

[0041] A5) the nucleotide sequence of the D-lactose transporter gene is SEQ ID No.9;

[0042] A6) the nucleotide sequence of the D-glucose PTS permease gene is SEQ ID No. 10;

[0043] A7) the nucleotide sequence of the pyruvate oxidase gene is SEQ ID No.11;

[0044] A8) The nucleotide sequence of the regulator gene of the galactose operon is SEQ ID No.12.

[0045] In one embodiment of the present invention, the D-mannitol dehydrogenase gene (MDH) is derived from Leuconostoc rapi, and its nucleotide sequence is SEQ ID No. 1. The amino acid sequence of the D-mannitol dehydrogenase is SEQ ID No. 3.

[0046] In one embodiment of the present invention, the D-mannitol dehydrogenase gene (MDH) is derived from Lentilactobacillus parafarraginis, and its nucleotide sequence is SEQ ID No. 5; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-mannitol dehydrogenase expressed thereby is WP_056980373.1 (30-APR-2019).

[0047] In one embodiment of the present invention, the D-mannitol dehydrogenase gene (MDH) is derived from Thermotoga neapolitana, and its nucleotide sequence is SEQ ID No. 6; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-mannitol dehydrogenase expressed by it is WP_015918880.1 (03-MAY-2021).

[0048] In one embodiment of the present invention, the nucleotide sequence of the D-glucose dehydrogenase gene (GDH) is SEQ ID No. 2. The amino acid sequence of the D-glucose dehydrogenase is SEQ ID No. 4.

[0049] In order to solve the above technical problem, in a second aspect, the present invention provides a method for preparing the above recombinant Escherichia coli, the method comprising the following steps:

[0050] B1), introducing the D-mannitol dehydrogenase gene described in A1) into the recipient bacteria;

[0051] B2), introducing the D-glucose dehydrogenase gene (GDH) described in A2) into the recipient bacteria;

[0052] B3), replacing the D-glucose PTS permease gene (ptsG) described in A6) with the glucokinase gene (glk) described in A3);

[0053] B4), replacing the pyruvate oxidase gene (poxB) described in A7) with the acetyl-CoA synthetase gene (acs) described in A4);

[0054] B5), replacing the regulator gene (galR) of the galactose operon described in A8) with the D-lactose transporter gene (zglf) described in A5).

[0055] Furthermore, in the method, the recipient bacteria is Escherichia coli K12.

[0056] Furthermore, in the method, the replacement can be achieved by homologous recombination.

[0057] In order to solve the above technical problems, in a third aspect, the present invention provides an application, wherein the application is the application of the above recombinant Escherichia coli in any of the following items:

[0058] C1) Application in the preparation of D-mannitol and / or sodium gluconate;

[0059] C2) Application in the preparation of products of D-mannitol and / or sodium gluconate.

[0060] Furthermore, in the application, the product described in C2) is a bacterial agent.

[0061] In order to solve the above technical problems, in a fourth aspect, the present invention provides a bacterial agent, which contains the above-mentioned recombinant Escherichia coli or a culture containing the above-mentioned recombinant Escherichia coli.

[0062] Furthermore, in the bacterial agent, the term "culture" refers to a general term for liquid or solid products (i.e., fermentation products) that have a microbial community after artificial inoculation and culture. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites, or other components produced during the culture process.

[0063] To solve the above technical problems, in a fifth aspect, the present invention provides a method for preparing D-mannitol and / or sodium gluconate, the method comprising using the above-mentioned recombinant Escherichia coli or the above-mentioned bacterial agent to prepare D-mannitol and / or sodium gluconate using D-fructose and D-glucose as substrates.

[0064] Further, the recombinant Escherichia coli (engineered bacteria MG01 in the specific embodiment of the present invention) is applied to the co-production of D-mannitol and sodium gluconate, comprising the following steps:

[0065] (1) Using D-fructose and D-glucose as substrates, adding solvent and MGO1, adjusting the pH of the reaction system to be weakly acidic, controlling the temperature of the reaction system, and collecting the supernatant after the reaction is completed by centrifugation, which is a mixed solution of D-mannitol and sodium gluconate;

[0066] (2) The mixed solution of step (1) is first passed through a cationic resin column, and the collected effluent is then passed through an anionic resin column. The collected effluent is evaporated, concentrated, and crystallized to obtain a D-mannitol product; the anionic resin column is rinsed with a sodium hydroxide solution, and the collected effluent is evaporated, concentrated, and crystallized to obtain a sodium gluconate product.

[0067] The engineered bacteria MG01 is an engineered bacteria that simultaneously expresses the D-mannitol dehydrogenase gene and the glucose dehydrogenase gene.

[0068] As an improved technical solution, the D-mannitol dehydrogenase gene that can be expressed by the engineered bacteria MG01 is derived from Leuconostoc rapi, and the source strain of the glucose dehydrogenase gene is derived from Priestia megaterium.

[0069] As an improved technical solution, in step (1), D-fructose and D-glucose are added at a ratio of 100-300 g / L respectively, and the cofactor NAD + The addition amount is 0-100 μmol / L, the engineered bacteria MG01 is added at a wet weight concentration of 10-30 g / L, the solvent is 0.05-0.1 mol / L sodium phosphate solution; the pH of the reaction system is 5.5-6.5, the reaction temperature is 35-45°C, and the reaction time is 10-12h.

[0070] As a preferred technical solution, in step (1), D-fructose and D-glucose are added at a ratio of 200 g / L respectively, and the cofactor NAD + The addition amount was 50 μmol / L, the engineered bacteria MG01 was added at a wet weight concentration of 20 g / L, the pH of the reaction system was 6.0, the reaction temperature was 40° C., and the reaction time was 10 h.

[0071] The reaction equation in step (1) of co-producing D-mannitol and sodium gluconate by engineering bacteria MG01 in the present invention is as shown in the attached figure: Figure 1 As shown, after adopting the above technical solution, the present invention achieves the following beneficial effects:

[0072] The present invention uses D-fructose and D-glucose as substrates, adjusts the pH of the reaction system to be weakly acidic, and uses an engineered bacterium MG01 that simultaneously expresses the D-mannitol dehydrogenase gene (MDH) and the D-glucose dehydrogenase (GDH) gene to obtain NAD + / NADH regeneration system, catalyzes D-fructose and D-glucose into D-mannitol and sodium gluconate respectively. Using this bioconversion system that co-expresses D-mannitol dehydrogenase (MDH) and glucose dehydrogenase (GDH), D-fructose and D-glucose are catalyzed to co-produce D-mannitol and sodium gluconate. At the same time, the amount of cofactor added is μmol / L level (0-100μmol / L), which reduces production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 This is the reaction equation for the co-production of D-mannitol and sodium gluconate using the engineered bacteria MG01.

[0074] Figure 2 This is the high-phase liquid phase detection spectrum of the supernatant collected from the reaction in step (1) in Example 4. DETAILED DESCRIPTION

[0075] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0076] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0077] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0078] The Escherichia coli K12 strain in the following examples was donated by Baixue Lin from the Institute of Microbiology, Chinese Academy of Sciences, and is recorded in the document "Baixue Lin, Keqiang Fan, Jian Zhao, Junjie Ji, Linjun Wu, Keqian Yang*, Yong Tao*. Reconstitution of TCA cycle with DAOCS to engineer E. coli into an efficient whole cell catalyst of penicillin G. Proc Natl Acad Sci USA 112(32):9855-9(2015)", which is available to the public from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0079] The vector pBAD / HisB in the following examples is a product of Invitrogen, with the catalog number V430-01;

[0080] Escherichia coli DH5α was purchased from Beijing Qingke Biotechnology Co., Ltd. with the product catalog number TSC01.

[0081] Example 1. Construction of an engineered bacterium MG01 that co-expresses D-mannitol dehydrogenase and D-glucose dehydrogenase

[0082] (1) Construction of recombinant plasmid pBAD / HisB-MDH-GDH: pBAD / HisB vector was double-digested with XhoI and SpeI, and the vector fragment was recovered; the artificially synthesized MDH gene fragment and GDH gene fragment (synthesized by Nanjing GenScript Biotechnology Co., Ltd.) were connected with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6: 343-345.) to obtain a connection product. The connection product was transformed into DH5α competent cells and coated on a LB solid plate containing streptomycin. Incubate at 37°C overnight, pick a single clone to extract the plasmid, and use primers MDH F and GDH F for sequencing verification. The vector with correct sequencing was named pBAD / HisB-MDH-GDH.

[0083] Among them, the MDH gene is derived from Leuconostoc rapi; the GDH gene is derived from Priestia megaterium; specifically, the nucleotide sequence of MDH is SEQ ID No.1; and the nucleotide sequence of GDH is SEQ ID No.2.

[0084] The nucleotide sequences of the primers MDH F and GDH F used for sequencing verification are as follows:

[0085] MDH F(5'-3'):ATGGAAGCATTAGTATTAAC;

[0086] GDH F(5'-3'): ATGTATACAGATTTAAAAG.

[0087] (2) The correctly sequenced vector pBAD / HisB-MDH-GDH was transformed into the Escherichia coli mutant SG104 by chemical transformation to obtain the recombinant engineered bacterium MG01.

[0088] (3) MG01 can express D-mannitol dehydrogenase and D-glucose dehydrogenase, wherein the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of D-mannitol dehydrogenase is WP_204770082.1 (09-AUG-2021), that is, the amino acid sequence of D-mannitol dehydrogenase is SEQ ID No. 3; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of D-glucose dehydrogenase is WP_013055759.1 (17-FEB-2022), that is, the amino acid sequence of D-glucose dehydrogenase is SEQ ID No. 4.

[0089] Example 2: Inducible expression of MDH and GDH in engineered bacteria MG01

[0090] (1) Streak the recombinant bacteria MG01 onto an LB plate containing 1.5 g / 100 mL agar (containing 50 μg / mL streptomycin) and culture at 37°C for 12 h. Pick a single clone and inoculate it into liquid LB medium containing 50 μg / mL streptomycin, and culture it at 37°C with shaking for 10 h at 220 rpm;

[0091] (2) The culture was inoculated into 500 mL of LB medium at a volume percentage of 1%, and cultured at 37° C. with shaking for 3 h. Arabinose with a final concentration of 2 g / L was added to induce expression, and cultured at 30° C. with shaking for 12 h.

[0092] The engineered bacteria MG01 after induced expression can be used to co-produce D-mannitol and sodium gluconate.

[0093] Example 3: After induced expression, the engineered bacteria MG01 is used for the co-production of D-mannitol and sodium gluconate. Scheme 1

[0094] After induction expression, the engineered bacteria MG01 is used to co-produce D-mannitol and sodium gluconate, comprising the following steps:

[0095] (1) The substrates D-fructose and D-glucose were 100 g / L and the sodium phosphate solution was 0.05 mol / L, respectively. The amount of engineered bacteria MG01 added was 20 g (wet weight) / L. The pH of the reaction system was adjusted to 5.5, and the temperature of the reaction system was controlled to be 35°C for shaking culture. The reaction was terminated after 12 h of reaction, and the supernatant collected by centrifugation at 6000×g for 30 min was a mixed solution of D-mannitol and sodium gluconate.

[0096] (2) taking the mixed solution of step (1), entering a cationic resin column (the resin column filler is 001*16) at a flow rate of 0.5 bv / h, and the collected effluent enters an anionic resin column (the resin column filler is D941) at a flow rate of 0.5 bv / h, evaporating and concentrating the collected effluent to a solid content of 70-85 wt%, adding 95 wt% ethanol, cooling to 45° C., adding 0.5% seed by mass of the concentrated solution (crystallized sodium gluconate product), and then stirring and slowly cooling to room temperature and centrifuging to obtain a D-mannitol product; using 1 mol / L sodium hydroxide solution to rinse the anionic resin column, evaporating and concentrating the collected effluent to a solid content of 70-80 wt%, cooling the concentrated solution to 45° C., adding 0.5% seed by mass of the concentrated solution, maintaining 45° C., vacuum degree -0.05 MPa, performing constant temperature evaporation crystallization, and centrifuging to obtain a sodium gluconate product.

[0097] Example 4: Scheme 2 of using engineered bacteria MG01 for co-production of D-mannitol and sodium gluconate after induced expression

[0098] After induction expression, the engineered bacteria MG01 is used to co-produce D-mannitol and sodium gluconate, comprising the following steps:

[0099] (1) The substrates D-fructose and D-glucose were 200 g / L, sodium phosphate solution was 0.05 mol / L, the cofactor addition amount was 50 μmol / L, the engineered bacteria MG01 addition amount was 20 g (wet weight) / L, the pH of the reaction system was adjusted to 6.0, the temperature of the reaction system was controlled at 40°C, and the culture was shaken; the reaction was terminated after 10 h of reaction, and the supernatant collected by centrifugation at 6000×g for 30 min was a mixed solution of D-mannitol solution and sodium gluconate; the cofactor was NAD+ (Aladdin Reagent Shanghai Co., Ltd., product catalog number N111609).

[0100] (2) taking the mixed solution of step (1), entering a cation resin column (the resin column filler is 001*16) at a flow rate of 0.5 bv / h, and the collected effluent enters an anion resin column (the resin column filler is D941) at a flow rate of 0.5 bv / h, evaporating and concentrating the collected effluent to a solid content of 70-85 wt%, adding 95 wt% ethanol, cooling to 45° C., adding 0.5% seed by mass of the concentrated solution, stirring and slowly cooling to room temperature, and then centrifuging to obtain a D-mannitol product; washing the anion resin column with sodium hydroxide solution, evaporating and concentrating the collected effluent to a solid content of 70-80 wt%, cooling the concentrated solution to 45° C., adding 0.5% seed by mass of the concentrated solution, maintaining 45° C., vacuum degree -0.05 MPa, performing constant temperature evaporation crystallization, and centrifuging to obtain a sodium gluconate product.

[0101] Example 5: Induced expression of engineered bacteria MG01 for co-production of D-mannitol and sodium gluconate Scheme 3

[0102] After induction expression, the engineered bacteria MG01 is used to co-produce D-mannitol and sodium gluconate, comprising the following steps:

[0103] (1) The substrates D-fructose and D-glucose were 200 g / L, sodium phosphate solution was 0.05 mol / L, the engineered bacteria MG01, the cofactor addition amount was 0 μmol / L, the addition amount was 30 g (wet weight) / L, the pH of the reaction system was adjusted to 6.0, and the temperature of the reaction system was controlled to 40°C for shaking culture;

[0104] (2) After 12 hours of reaction, the reaction was terminated and centrifuged at 6000×g for 30 minutes. The collected supernatant was a mixed solution of D-mannitol solution and sodium gluconate.

[0105] Example 6: Scheme 4 of using engineered bacteria MG01 for co-production of D-mannitol and sodium gluconate after induced expression

[0106] After induction expression, the engineered bacteria MG01 is used to co-produce D-mannitol and sodium gluconate, comprising the following steps:

[0107] (1) The substrates D-fructose and D-glucose were 200 g / L, sodium phosphate solution was 0.05 mol / L, the amount of engineered bacteria MG01 added was 30 g (wet weight) / L, the amount of cofactor added was 100 μmol / L, the pH of the reaction system was adjusted to 6.0, the temperature of the reaction system was controlled to 40°C for shaking culture, the reaction was terminated after 10 hours, and the mixture was centrifuged at 6000×g for 30 minutes. The collected supernatant was the mixed solution of D-mannitol solution and sodium gluconate;

[0108] (2) taking the mixed solution of step (1), entering a cation resin column (the resin column filler is 001*16) at a flow rate of 0.5 bv / h, and the collected effluent enters an anion resin column (the resin column filler is D941) at a flow rate of 0.5 bv / h, evaporating and concentrating the collected effluent to a solid content of 70-85 wt%, adding 95 wt% ethanol, cooling to 45° C., adding 0.5% seed by mass of the concentrated solution, stirring and slowly cooling to room temperature, and then centrifuging to obtain a D-mannitol product; washing the anion resin column with sodium hydroxide solution, evaporating and concentrating the collected effluent to a solid content of 70-80 wt%, cooling the concentrated solution to 45° C., adding 0.5% seed by mass of the concentrated solution, maintaining 45° C., vacuum degree -0.05 MPa, performing constant temperature evaporation crystallization, and centrifuging to obtain a sodium gluconate product.

[0109] Example 7: After induced expression, the engineered bacteria MG01 is used for the co-production of D-mannitol and sodium gluconate. Scheme 5

[0110] After induction expression, the engineered bacteria MG01 is used to co-produce D-mannitol and sodium gluconate, comprising the following steps:

[0111] (1) The substrates D-fructose and D-glucose were 300 g / L, sodium phosphate solution was 0.05 mol / L, the amount of engineered bacteria MG01 added was 30 g (wet weight) / L, the amount of cofactor added was 100 μmol / L, the pH of the reaction system was adjusted to 6.0, and the temperature of the reaction system was controlled to 40°C for shaking culture;

[0112] (2) After 12 hours of reaction, the reaction was terminated and centrifuged at 6000×g for 30 minutes. The collected supernatant was a mixed solution of D-mannitol solution and sodium gluconate.

[0113] In order to better prove that the method of the present invention can simultaneously obtain high-yield D-mannitol product and sodium gluconate product, three comparative examples are given with reference to Example 4. The yield of the substrate and the yield of the product are shown in Table 1.

[0114] Example 8. Construction of E. coli mutant SG104

[0115] Escherichia coli mutant SG104 is a mutant of Escherichia coli K12 obtained by replacing the D-glucose PTS permease gene (ptsG) of Escherichia coli K12 with the glucokinase gene (glk), the regulator gene (galR) of the galactose operon with the D-lactose transporter gene (zglf) from Zymomonas mobilis, and the pyruvate oxidase gene (poxB) with the acetyl-CoA synthetase gene (acs) using CRISPR technology (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514.), and is referred to as SG104 in this application. The genotype of SG104 is E. coli K12ΔptsG::glkΔgalR::zglfΔpoxB::acs.

[0116] The nucleotide sequence of the glucokinase gene (glk) is SEQ ID No. 7. The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of glucokinase encoded by it is NP_416889.1 (09-MAR-2022).

[0117] The nucleotide sequence of the acetyl-CoA synthetase gene (acs) is SEQ ID No. 8. The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the acetyl-CoA synthetase encoded by it is NP_418493.1 (09-MAR-2022).

[0118] The nucleotide sequence of the D-lactose transporter gene (zglf) is SEQ ID No. 9; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-lactose transporter encoded by it is WP_011240287.1 (17-OCT-2022).

[0119] The nucleotide sequence of the D-glucose PTS permease gene (ptsG) is SEQ ID No. 10. The NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-glucose PTS permease encoded by it is NP_415619.1 (09-MAR-2022).

[0120] The nucleotide sequence of the pyruvate oxidase gene (poxB) is SEQ ID No. 11; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the pyruvate oxidase encoded by it is NP_415392.1 (09-MAR-2022).

[0121] The nucleotide sequence of the regulator gene (galR) of the galactose operon is SEQ ID No. 12; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the regulator of the galactose operon encoded by it is NP_417314.1 (09-MAR-2022).

[0122] The specific construction steps of E. coli mutant SG104 are as follows:

[0123] (1) Preparation of electrocompetent cells: The pCas plasmid (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514.) was transformed into Escherichia coli K12 by chemical transformation, and positive clones were screened on LB plates containing kanamycin (kanamycin concentration was 50 μg / ml) at 30°C. Positive clones were inoculated in LB liquid medium containing 2 g / L arabinose and cultured at 30°C until OD 600nm After the concentration is about 0.6, prepare the electrocompetent cells.

[0124] (2) Construction of pTarget plasmid:

[0125] Using the Website https: / / crispy.secondarymetabolites.org Select the knockout site N20, design primers to construct the pTarget plasmid. Using pTargetF (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514.) as a template, use primers pTarget-ptsG-F and pTarget-ptsG-R, pTarget-galR-F and pTarget-galR-R, pTarget-poxBF and pTarget-poxB-R for PCR amplification, and amplify fragments of about 2100 bp in size. After digestion with DpnI methylase for about 3 hours, directly use chemical transformation to transform Escherichia coli DH5α competent state, screen positive clones on LB plates containing streptomycin (streptomycin concentration is 50 μg / ml), and sequence verification with primer pTarget-cexu-F. The recombinant plasmids with correct sequencing were named pTarget-ptsG plasmid, pTarget-galR plasmid and pTarget-poxB plasmid.

[0126] The primer sequences used are as follows (the underlined sequence is that of N20):

[0127] pTarget-ptsG-F:5'-tccttcatttggccgccgatgttttagagctagaaatagc-3';

[0128] pTarget-ptsG-R: 5’-atcggcggccaaatgaaggaactagtattatacctaggac-3’;

[0129] pTarget-galR-F: 5’-cagcaaggtcatacccgcatgttttagagctagaaatagc-3’;

[0130] pTarget-galR-R: 5’-atgcgggtatgaccttgctgactagtattatacctaggac-3’;

[0131] pTarget-poxB-F: 5’-gggttaatcggcttctcgtcgttttagagctagaaatagc-3’;

[0132] pTarget-poxB-R: 5’-gacgagaagccgattaacccactagtattatacctaggac-3’;

[0133] pTarget-cexu-F: 5’-ctttcctgcgttatcccctg-3’.

[0134] (3) Amplify the targeting fragment:

[0135] The primer pairs ptsG-up500-F and ptsG-up500-R, glk-F and glk-R, ptsG-down500-F and ptsG-down500-R were used to perform PCR amplification using the E. coli K12 genome as a template, and fragments of approximately 500 bp, 1000 bp and 500 bp were obtained, respectively. The mixture of the three fragments was used as a template, and the primer pairs ptsG-up500-F and ptsG-down500-R were used to perform PCR amplification, and a ptsG::glk targeting fragment of approximately 2000 bp was obtained. The primer pairs galR-up500-F and galRup500-R, zglf-F and zglf-R, galR-down500-F and galR-down500-R were used to perform PCR amplification using the E. coli K12 genome as a template, and fragments of approximately 500 bp, 1500 bp and 500 bp were obtained, respectively. Using the mixture of the three fragments as a template, PCR amplification was performed with primers galR-up500-F and galR-down500-R to obtain a galR::zglf targeting fragment of about 2500 bp. Using primers poxB-up500-F and poxB-up500-R, acs-F and acs-R, poxB-down500-F and poxB-down500-R, the E. coli K12 genome was used as a template for PCR amplification to obtain fragments of about 500 bp, 2000 bp and 500 bp, respectively. Using the mixture of the three fragments as a template, PCR amplification was performed with primers poxB-up500-F and poxB-down500-R to obtain a poxB::acs targeting fragment of about 3000 bp. The targeting fragments ptsG::glk, galR::zglf and poxB::acs were recovered. The targeting fragment includes a 500 bp upstream homology arm, a replacement gene and a 500 bp downstream homology arm from upstream to downstream.

[0136] The primer sequences used are as follows:

[0137] ptsG-up500-F:5'-gcgttatgtccccctggatc-3';

[0138] ptsG-up500-R:5'-aattgagagtgctcctgagt-3';

[0139] ptsG-down500-F:5'-tccgtaagacgttggggaga-3';

[0140] ptsG-down500-R:5'-cgcctataaagcggtggatg-3';

[0141] glk-F:5'-actcaggagcactctcaattatgacaaagtatgcattagtc-3';

[0142] glk-R:5'-tctccccaacgtcttacggattacagaatgtgacctaagg-3';

[0143] galR-up500-F:5'-cgcgagcgacagtaaattag-3';

[0144] galR-up500-R:5'-gaaaataccttagtgggtaa-3';

[0145] galR-down500-F:5'-ccgcagttaaagcaattcca-3';

[0146] galR-down500-R:5'-tttgggccaccctgtgaaac-3';

[0147] zglf-F:5'-ttacccactaaggtattttcatgagttctgaaagtagtcag-3';

[0148] zglf-R:5'-tggaattgctttaactgcggctacttctgggagcgccaca-3';

[0149] poxB-up500-F:5'-ccggctccgtatatggattg-3';

[0150] poxB-up500-R:5'-ggttctccatctcctgaatg-3';

[0151] poxB-down500-F:5'-aaagggtggcatttcccgtc-3';

[0152] poxB-down500-R:5'-aattcccatgcttctttcag-3';

[0153] acs-F:5'-cattcaggagatggagaaccatgagccaaattcacaaacac-3';

[0154] acs-R:5'-gacgggaaatgccaccctttttacgatggcatcgcgatag-3'.

[0155] (4) Electroconversion:

[0156] 200 ng of pTarget-ptsG plasmid (prepared in step (2)), 400 ng of the targeting fragment ptsG::glk (prepared in step (3)) and 100 μl of the electroporation competent cells prepared in step (4) were mixed and placed in a 2 mm electroporation cuvette, electroporated at 2.5 kV, and 1 ml of LB liquid medium was added to resuscitate at 30°C. After that, the cells were spread on LB plates containing kanamycin and streptomycin (kanamycin concentration was 50 μg / ml and streptomycin concentration was 50 μg / ml), cultured at 30°C, and positive clones were screened. PCR amplification was performed with primers ptsG-up700-F and ptsG-down700-R, and the amplified fragments were sequenced for verification.

[0157] (5) Elimination of pTarget plasmid:

[0158] The positive clones verified by sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and cultured overnight at 30°C to eliminate the pTarget plasmid. The strains after overnight culture were streaked on LB solid plates containing kanamycin and cultured overnight at 30°C to obtain the E. coli mutant BW25113ΔptsG::glk containing the pCas plasmid.

[0159] (6) Pick a single clone from the plate of step (5), prepare electrocompetent cells, mix them with the pTarget-galR plasmid (prepared in step (2)) and the galR::zglf targeting fragment (prepared in step (3)), repeat steps (4)-(5), and sequence and verify with primers galR-up700-F and galRdown700-R to obtain the Escherichia coli mutant BW25113ΔptsG::glkΔgalR::zglf containing the pCas plasmid.

[0160] (7) Prepare electrocompetent cells of the Escherichia coli mutant BW25113ΔptsG::glkΔgalR::zglf containing the pCas plasmid, mix with the pTarget-poxB plasmid (prepared in step (2)) and the poxB::acs targeting fragment (prepared in step (3)), repeat steps (4)-(5), and sequence and verify with primers poxB-up700-F and poxB-down700-R to obtain the Escherichia coli mutant BW25113ΔptsG::glkΔgalR::zglfΔpoxB::acs containing the pCas plasmid.

[0161] (8) Elimination of pCas plasmid:

[0162] The E. coli mutant BW25113ΔptsG::glkΔgalR::zglfΔpoxB::acs containing the pCas plasmid verified by sequencing was inoculated into LB liquid medium and cultured overnight at 37°C to eliminate the pCas plasmid. The strain after overnight culture was streaked on an LB solid plate and cultured overnight at 37°C to obtain the E. coli mutant BW25113ΔptsG::glkΔgalR::zglfΔpoxB::acs, referred to as SG104.

[0163] The primer sequences used for verification and sequencing are as follows:

[0164] ptsG-up700-F:5'-actgaacaagccggttatcg-3';

[0165] ptsG-down700-R:5'-acctacgccagctatacctc-3';

[0166] galR-up700-R:5'-ggcgtaattagaacgcgctc-3';

[0167] galR-down700-R:5'-acatgcacattggttctggc-3';

[0168] poxB-up700-R:5'-attatgtcgatgcgtcgctg-3';

[0169] poxB-down700-R:5'-tcccgccacctgtcattttc-3'.

[0170] Compared with wild-type E. coli K12, mutant E. coli SG104 has a faster growth rate and a higher utilization rate for glucose; the growth rate is represented by the absorbance value at 600nm detected by UV, and the glucose concentration is detected by HPLC. Therefore, the mutant E. coli SG104 is selected as the starting strain in the present invention.

[0171] Comparative Example 1

[0172] The difference from Example 4 is that in step (1), the engineered bacteria MG01 is added at a wet weight concentration of 40 g / L, and the rest of the operations are the same;

[0173] Comparative Example 2

[0174] The difference from Example 4 is that the reaction temperature in step (1) is 45°C, and the other operations are the same;

[0175] Comparative Example 3

[0176] The difference from Example 4 is that the phosphate concentration in step (2) is 0.1 mol / L, and the remaining operations are the same.

[0177] Comparative Example 4

[0178] The difference from Example 4 is that the MDH gene in the engineered bacteria MG01 is derived from Lentilactobacillus parafarraginis, and the other operations are exactly the same.

[0179] The MDH gene derived from Lentilactobacillus parafarraginis is SEQID No. 5; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-mannitol dehydrogenase expressed by it is WP_056980373.1 (30-APR-2019).

[0180] Comparative Example 5

[0181] The difference from Example 4 is that the gene of MDH in the engineered bacteria MG01 is derived from Thermotoga neapolitana, and the other operations are exactly the same.

[0182] The MDH gene derived from Thermotoga neapolitana is SEQ ID No. 6; the NCBI Reference Sequence Number (NCBI Reference Sequence) of the amino acid sequence of the D-mannitol dehydrogenase expressed thereby is WP_015918880.1 (03-MAY-2021).

[0183] Table 1

[0184]

[0185]

[0186] “ / ” The conversion rate was low and no purification process was performed.

[0187] The conversion rate is determined and calculated by multiplying the molar concentration of D-mannitol in the system after the reaction is completed by the final volume to obtain the molar amount of D-mannitol, multiplying the molar concentration of D-fructose in the initial system by the initial volume to obtain the molar amount of D-fructose, and then dividing the molar amount of D-mannitol by the molar amount of D-fructose to obtain the conversion rate, which is expressed as 100%.

[0188] The yield of sodium gluconate is determined and calculated by multiplying the molar concentration of sodium gluconate obtained in the final purification step by its volume to obtain the molar amount of sodium gluconate, multiplying the molar concentration of D-glucose in the initial system by the initial volume to obtain the molar amount of D-glucose, and then dividing the molar amount of sodium gluconate obtained after purification by the molar amount of initial D-glucose to obtain the yield of sodium gluconate, which is expressed as 100%.

[0189] The yield of D-mannitol is determined and calculated by multiplying the molar concentration of D-mannitol obtained in the final purification step by its volume to obtain the molar amount of D-mannitol, multiplying the molar concentration of D-fructose in the initial system by the initial volume to obtain the molar amount of D-fructose, and then dividing the molar amount of D-mannitol obtained after purification by the molar amount of initial D-fructose to obtain the yield of sodium gluconate, which is expressed as 100%.

[0190] It can be found from the data in Table 1 that the engineered bacteria MG01 constructed by the present invention can be suitable for industrial co-production of D-mannitol and sodium gluconate, thereby reducing production costs. The supernatant after the reaction in step (1) of Example 2 was taken, and the concentrations of D-mannitol and sodium gluconate were measured by high performance liquid chromatography (Aminex HPX-87C column (7.8*300mm), external standard method), detector (RID), mobile phase: double distilled water, column temperature 80°C, flow rate: 0.6ml / min). Standard products of D-mannitol (article number M108831) and sodium gluconate (article number G278703) were purchased from Aladdin Reagent (Shanghai) Co., Ltd. The specific test results are detailed in the attached Figure 2 .

[0191] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A recombinant Escherichia coli, characterized in that: The recombinant Escherichia coli has the following characteristics: A1 ), containing the D-mannitol dehydrogenase gene; A2), containing D-glucose dehydrogenase gene; A3), contains the glucokinase gene; A4), containing acetyl-CoA synthetase gene; A5), contains the D-lactose transporter gene; A6), does not contain D-glucose PTS permease gene; A7), does not contain the pyruvate oxidase gene; A8) does not contain the regulator gene of the galactose operon.

2. The recombinant Escherichia coli according to claim 1, characterized in that: The recombinant Escherichia coli is prepared by performing the following steps B1) to B5) in the recipient bacteria. B1), introducing the D-mannitol dehydrogenase gene described in A1) into the recipient bacteria; B2), introducing the D-glucose dehydrogenase gene described in A2) into the recipient bacteria; B3), replacing the D-glucose PTS permease gene described in A6) with the glucokinase gene described in A3); B4), replacing the pyruvate oxidase gene described in A7) with the acetyl-CoA synthetase gene described in A4); B5), replacing the regulator gene of the galactose operon described in A8) with the D-lactose transporter gene described in A5).

3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that: A1) the D-mannitol dehydrogenase gene is derived from Leuconostoc rapi, Lentilactobacillus parafarraginis or Thermotoga neapolitana; A2) the D-glucose dehydrogenase gene is derived from Priestia megaterium; A3) the glucokinase gene is derived from Escherichia coli K12; A4) the acetyl-CoA synthetase gene is derived from Escherichia coli K12; A5) The D-lactose transporter gene is derived from Zymomonas mobilis.

4. The recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that: A1) The NCBI reference sequence number of the amino acid sequence of the D-mannitol dehydrogenase is WP_204770082.1 (09-AUG-2021), WP_056980373.1 (30-APR-2019) or WP_015918880.1 (03-MAY-2021); A2) The NCBI reference sequence number of the amino acid sequence of the D-glucose dehydrogenase is WP_013055759.1 (17-FEB-2022); A3) The NCBI reference sequence number of the amino acid sequence of glucokinase is NP_416889.1 (09-MAR-2022); A4) The NCBI reference sequence number of the amino acid sequence of the acetyl-CoA synthetase is NP_418493.1 (09-MAR-2022); A5) The NCBI reference sequence number of the amino acid sequence of the D-lactose transporter is WP_011240287.1 (17-OCT-2022); A6) The NCBI reference sequence number of the amino acid sequence of the D-glucose PTS permease is NP_415619.1 (09-MAR-2022); A7) The NCBI reference sequence number of the amino acid sequence of the pyruvate oxidase is NP_415392.1 (09-MAR-2022); A8) The NCBI reference sequence number of the amino acid sequence of the regulator of the galactose operon is NP_417314.1 (09-MAR-2022).

5. The recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that: A1) the nucleotide sequence of the D-mannitol dehydrogenase gene is SEQ ID No.1, SEQ ID No.5 or SEQ ID No.6; A2) the nucleotide sequence of the D-glucose dehydrogenase gene is SEQ ID No. 2; A3) the nucleotide sequence of the glucokinase gene is SEQ ID No.7; A4) the nucleotide sequence of the acetyl-CoA synthetase gene is SEQ ID No.8; A5) the nucleotide sequence of the D-lactose transporter gene is SEQ ID No.9; A6) the nucleotide sequence of the D-glucose PTS permease gene is SEQ ID No. 10; A7) the nucleotide sequence of the pyruvate oxidase gene is SEQ ID No.11; A8) The nucleotide sequence of the regulator gene of the galactose operon is SEQ ID No.

12.

6. A method for preparing the recombinant Escherichia coli according to any one of claims 1 to 5, characterized in that: The recombinant Escherichia coli is obtained by carrying out the following preparations B1) to B5) in the recipient bacteria, B1), introducing the D-mannitol dehydrogenase gene described in A1) into the recipient bacteria; B2), introducing the D-glucose dehydrogenase gene described in A2) into the recipient bacteria; B3), replacing the D-glucose PTS permease gene described in A6) with the glucokinase gene described in A3); B4), replacing the pyruvate oxidase gene described in A7) with the acetyl-CoA synthetase gene described in A4); B5), replacing the regulator gene of the galactose operon described in A8) with the D-lactose transporter gene described in A5).

7. The method according to claim 6, characterized in that: The recipient bacteria is Escherichia coli K12.

8. Application, characterized in that: The application is the application of the recombinant Escherichia coli according to any one of claims 1 to 5 in any of the following: C1) Application in the preparation of D-mannitol and / or sodium gluconate; C2) Application in the preparation of products of D-mannitol and / or sodium gluconate.

9. A bacterial agent, characterized in that: The bacterial agent contains the recombinant Escherichia coli according to any one of claims 1 to 5 or a culture containing the recombinant Escherichia coli according to any one of claims 1 to 5.

10. A method for preparing D-mannitol and / or sodium gluconate, the method comprising using the recombinant Escherichia coli according to any one of claims 1 to 5 or the bacterial agent according to claim 9 to prepare D-mannitol and / or sodium gluconate using D-fructose and D-glucose as substrates.

Images