Antibodies to new bunyavirus and uses thereof

Abstract

The invention relates to the technical field of in-vitro diagnosis, in particular to a new bunyavirus antibody and application thereof. The invention provides a novel bunyavirus antibody and application thereof. The new bunyavirus antibody obtained by screening can be specifically combined with different mutation types of new bunyavirus, is high in sensitivity and strong in specificity, and has a very good market application prospect. The detection sensitivity of the SFTSV is measured by using a double-antibody sandwich method, and the result shows that the antibody detection sensitivity of the novel bunyavirus provided by the invention is as low as 0.5 ng / mL, and the novel bunyavirus can be used for early diagnosis and detection of the SFTSV.

Description

Technical Field

[0001] The present invention relates to the technical field of in vitro diagnosis, and in particular to antibodies against new bunyaviruses and applications thereof. Background Art

[0002] In 2009, a new infectious disease was first reported in China. Its clinical manifestations are mainly fever, thrombocytopenia, leukopenia and multiple organ dysfunction, with a high mortality rate. It is reported that the pathogen, Severe fever with thrombocytopenia syndrome virus (SFTSV), is a new virus isolated and confirmed by the Chinese Center for Disease Control and Prevention in 2010. The disease caused by this virus is named Severe fever with thrombocytopenia syndrome (SFTS). This virus is a species of Phlebovirus. Tick bites are the main route of transmission of Severe fever with thrombocytopenia syndrome, which has been reported in China, Japan and South Korea.

[0003] SFTSV is a spherical virus particle with a diameter of 80-100 nm. The viral envelope consists of a lipid bilayer and two transmembrane glycoproteins Gn / Gc arranged regularly on the surface, forming a spike-shaped surface. The SFTSV genome consists of three single-stranded negative-sense RNA segments: large (L), medium (M), and small (S). Similar to other viruses in the Bunyaviridae family, the 3′ and 5′ end sequences of the viral genome are complementary to form a non-covalent closed-loop RNA. The L segment encodes an RNA-dependent RNA polymerase consisting of 2084 amino acids; the M segment encodes a membrane protein precursor with 1073 amino acids, which is modified by proteases in the host cell after translation to form two glycoproteins, Gn and Gc; the S segment is a bi-sense RNA, encoding the nucleocapsid protein NP and the non-structural protein NSs, respectively.

[0004] Since specific therapeutic drugs and effective vaccines have not yet been successfully developed, early diagnosis has become an important measure to prevent and control the epidemic. At present, early nucleic acid diagnosis and clinical diagnosis are important bases for diagnosis. Although nucleic acid diagnosis is fast, it is affected by the testing site, and the test results have a certain lag. Serological diagnosis is to detect the body's immune response after pathogen infection. It lasts for a long time, the immune response is stable, and the immune response shows a dynamic trend as the disease progresses. Therefore, serological diagnosis is also an important means of early diagnosis and evaluation of the current status of infection.

[0005] At present, there are no antibodies suitable for SFTSV antigen detection on the market at home and abroad. Therefore, the establishment and development of antibody-based detection and diagnosis and treatment products are of great practical significance for the detection and intervention of SFTSV. Summary of the invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide antibodies to new bunyavirus and their applications. The present invention provides antibodies to new bunyavirus with high titer, affinity and sensitivity, which can be used for detecting new bunyavirus by double antibody sandwich method and can be used for early diagnosis and detection of SFTSV.

[0007] The present invention provides an antibody against a new bunyavirus, comprising the following amino acid sequence

[0008] (1) The three CDR regions of the heavy chain have the amino acid sequence shown in any one of SEQ ID NOs: 1 to 6; the three CDR regions of the light chain have the amino acid sequence shown in any one of SEQ ID NOs: 7 to 12;

[0009] (2) an amino acid sequence that has one or more amino acids substituted, added or deleted from the amino acid sequence shown in (1), but has the same or similar function as the amino acid sequence shown in (1); or

[0010] (3) An amino acid sequence having at least 80% homology with the amino acid sequence shown in (1) or (2).

[0011] In some embodiments, the three CDR regions of the heavy chain of the antibody against the new Bunyavirus have the amino acid sequences shown in SEQ ID NOs: 1, 2 and 3, respectively;

[0012] In some embodiments, the three CDR regions of the heavy chain of the antibody against the new Bunyavirus have the amino acid sequences shown in SEQ ID NOs: 4, 5 and 6, respectively;

[0013] In some embodiments, the three CDR regions of the light chain of the antibody against the new bunyavirus have the amino acid sequences shown in SEQ ID NOs: 7, 8 and 9, respectively;

[0014] In some embodiments, the three CDR regions of the light chain of the antibody against the new bunyavirus have the amino acid sequences shown in SEQ ID NOs: 10, 11 and 12, respectively.

[0015] In the present invention, the antibody against the new bunyavirus is:

[0016] (i) The four FR regions of its heavy chain have the amino acid sequence shown in any one of SEQ ID NOs: 13 to 20; the four FR regions of its light chain have the amino acid sequence shown in any one of SEQ ID NOs: 21 to 28;

[0017] (ii) an amino acid sequence that has one or more amino acids substituted, added or deleted from the amino acid sequence shown in (i), but has the same or similar function as the amino acid sequence shown in (i); or

[0018] (iii) An amino acid sequence having at least 80% homology with the amino acid sequence shown in (i) or (ii).

[0019] In the present invention, the sequence having at least 80% homology is an amino acid sequence obtained by replacing, adding or deleting one or more amino acids on the basis of the original sequence, and the plurality is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 or 38.

[0020] In some embodiments, the four FR regions of the heavy chain of the antibody against the new Bunyavirus have the amino acid sequences shown in SEQ ID NOs: 13, 14, 15 and 16, respectively;

[0021] In some embodiments, the four FR regions of the heavy chain of the antibody against the new Bunyavirus have the amino acid sequences shown in SEQ ID NOs: 17, 18, 19 and 20, respectively;

[0022] In some embodiments, the four FRs of the light chain of the antibody against the new bunyavirus have the amino acid sequences shown in SEQ ID NOs: 21, 22, 23 and 24, respectively;

[0023] In some embodiments, the four FRs of the light chain of the antibody against the new bunyavirus have the amino acid sequences shown in SEQ ID NOs: 25, 26, 27 and 28, respectively.

[0024] In some specific embodiments, the antibody heavy chain variable region of the new bunyavirus comprises the CDR regions shown in SEQ ID NOs: 1, 2 and 3 and the FR regions shown in SEQ ID NOs: 13, 14, 15 and 16.

[0025] In some specific embodiments, the antibody heavy chain variable region of the new bunyavirus comprises the CDR regions shown in SEQ ID NOs: 4, 5 and 6 and the FR regions shown in SEQ ID NOs: 17, 18, 19 and 20.

[0026] In some specific embodiments, the antibody light chain variable region of the new bunyavirus comprises the CDR region shown in SEQ ID NOs: 7, 8 and 9 and the FR region shown in SEQ ID NOs: 21, 22, 23 and 24.

[0027] In some specific embodiments, the antibody light chain variable region of the new bunyavirus comprises the CDR regions shown in SEQ ID NOs: 10, 11 and 12 and the FR regions shown in SEQ ID NOs: 25, 26, 27 and 28.

[0028] In some embodiments, the variable region of the antibody heavy chain of the new bunyavirus has an amino acid sequence as shown in SEQ ID NO: 29 or 30;

[0029] The antibody light chain variable region of the new bunyavirus has an amino acid sequence as shown in SEQ ID NO: 31 or 32.

[0030] In some specific embodiments, the variable region of the antibody heavy chain of the new bunyavirus has the amino acid sequence shown in SEQ ID NO: 29;

[0031] The antibody light chain variable region of the new bunyavirus has an amino acid sequence as shown in SEQ ID NO:31.

[0032] In some specific embodiments, the variable region of the antibody heavy chain of the new bunyavirus has the amino acid sequence shown in SEQ ID NO: 30;

[0033] The antibody light chain variable region of the new bunyavirus has an amino acid sequence as shown in SEQ ID NO:32.

[0034] In some embodiments, the antibody to the new bunyavirus further comprises a constant region, the constant region of the heavy chain is IgG1, and the constant region of the light chain is a κ chain.

[0035] The present invention provides a biomaterial comprising at least one of the following items I to VI:

[0036] Ⅰ. Nucleic acid encoding antibodies to the new bunyavirus;

[0037] II. an expression vector comprising the nucleic acid;

[0038] III. transforming or transfecting a host cell with the expression vector;

[0039] IV. A conjugate prepared by coupling the antibody of the new bunyavirus with a solid medium or a semi-solid medium;

[0040] V. Chemically or biologically labeled antibodies to the new bunyavirus;

[0041] VI. A conjugate prepared by coupling a chemically or biologically labeled antibody to the new bunyavirus with a solid medium or a semi-solid medium.

[0042] The expression vector of the present invention can express and produce the antibody of the new bunyavirus in the host cell, and the host cell is selected from Escherichia coli, yeast, insect cell or mammalian cell.

[0043] The chemical label is an isotope, an immunotoxin and / or a chemical drug; the biological label is biotin, avidin or an enzyme label. The enzyme label is preferably horseradish peroxidase or alkaline phosphatase.

[0044] The solid phase medium or semi-solid medium refers to any support to which the antibody or labeled antibody described in the present invention can be attached, including but not limited to nitrocellulose membrane, polyvinylidene fluoride (PVDF) membrane, iPDMS chip, microplate, polystyrene plate, microparticles, microcarriers, gel, etc.

[0045] The present invention provides a method for preparing the antibody, comprising: culturing host cells in the biological material to induce the expression of the antibody of the new bunyavirus.

[0046] The present invention provides the use of at least one of the following items ⅰ to ⅲ in the preparation of a detection reagent or a detection kit for a new bunyavirus:

[0047] i. Antibodies to the new bunyavirus;

[0048] ii. the biological material;

[0049] iii. Antibodies against new bunyavirus are obtained by the above-mentioned preparation method.

[0050] The present invention provides a detection reagent or a detection kit, comprising at least one of the following ① to ③:

[0051] 1. Antibodies to the new bunyavirus;

[0052] ②, the biological material;

[0053] ③. Antibodies against new bunyavirus are obtained by the preparation method.

[0054] In some embodiments, the detection kit includes a double antibody sandwich detection kit, which includes a coating antibody and a labeled antibody, wherein:

[0055] The heavy chain variable region of the coated antibody has the amino acid sequence shown in SEQ ID NO: 29; the light chain variable region of the coated antibody has the amino acid sequence shown in SEQ ID NO: 31;

[0056] The heavy chain variable region of the labeled antibody has an amino acid sequence as shown in SEQ ID NO: 30; the light chain variable region of the labeled antibody has an amino acid sequence as shown in SEQ ID NO: 32.

[0057] The present invention provides a method for detecting new bunyavirus, comprising: using the detection reagent or detection kit to detect a sample.

[0058] The present invention provides antibodies to new bunyavirus and applications thereof. The antibodies to new bunyavirus screened by the present invention can specifically bind to new bunyaviruses of different mutation types, have high sensitivity and strong specificity, and have good market application prospects. The detection sensitivity of SFTSV was determined by the double antibody sandwich method, and the results showed that the detection sensitivity of the antibodies to new bunyavirus provided by the present invention was as low as 0.5 ng / mL, and can be used for early diagnosis and detection of SFTSV. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 The figure shows the result of detecting the sensitivity of antibody detection using the double antibody sandwich method, wherein the first antibody in the mark is the coating antibody and the second antibody is the labeled antibody. DETAILED DESCRIPTION

[0060] The present invention provides antibodies to new bunyaviruses and their applications. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the same. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content and relevant scope of the present invention to implement and apply the technology of the present invention.

[0061] The test materials used in the present invention are all common commercial products and can be purchased in the market. The present invention is further described below in conjunction with the embodiments.

[0062] Example 1

[0063] (1) Antigen immunization

[0064] The nucleocapsid protein S fragment of the recombinant SFTSV (NCBI Sequence: NC_043452.1) was mixed with an equal volume of Freund's complete adjuvant. The emulsion was subcutaneously injected into BALB / c mice at a dose of 0.15 mL. 14 days after the first immunization, intraperitoneal booster immunization was performed (equal amounts of antigen were mixed with Freund's incomplete adjuvant). After four injections of booster immunization, tail blood was collected for titer detection to determine whether the titer met the fusion requirements. Three days before fusion, the same dose of antigen was intraperitoneally injected for booster immunization, and the immunization method was the same as above.

[0065] (2) Preparation of hybridoma cell lines

[0066] The spleen of the mouse was taken three days after the last immunization, placed in a plate, rinsed once with RPMI 1640 basic culture medium, ground and filtered to prepare a cell suspension. Centrifuged, the supernatant was discarded, and the cell suspension was resuspended in RPMI 1640 basic culture medium. This was repeated three times to obtain immune spleen cells. Mouse myeloma cells were selected by 8-azaguanine, cultured to the logarithmic growth phase, prepared into a cell suspension, centrifuged, the supernatant was discarded, and the cell suspension was resuspended in RPMI 1640 basic culture medium. This was repeated three times to obtain myeloma cells.

[0067] Myeloma cells and immune spleen cells were mixed at a ratio of 1:10, washed once with RPMI 1640 basal culture medium in a centrifuge tube, centrifuged, supernatant discarded, cells mixed, 2 mL 50% PEG1500 slowly added for fusion, 20 mL RPMI 1640 basal culture medium added after fusion for 1 minute to terminate cell fusion. Centrifuged, supernatant discarded, resuspended with RPMI 1640 screening culture medium, divided into 96-well plates at a dosage of 50 μL / well, cultured at 37°C, 5% CO2, cultured until the sixth day, and replaced with HAT culture medium (RPMI 1640 complete culture medium containing HAT) twice.

[0068] (3) Hybridoma cell screening

[0069] The nucleocapsid protein of recombinant SFTSV was diluted with 0.05M pH9.6 carbonate buffer solution to a final concentration of 1μg / mL. 0.1mL was added to each well of a 96-well polystyrene plate and incubated at 4°C overnight. The next day, 0.15mL / well of 0.02M pH7.2PBS containing 10% calf serum was used to block the plate at 37°C for 2 hours for detection. On the seventh day after fusion, 0.1mL of cell supernatant was taken and placed in the above 96-well detection plate, incubated at 37°C for 30 minutes, washed the plate six times with PBST, and then added with 2000-fold diluted horseradish peroxidase-labeled goat anti-mouse IgG, washed the plate at 37°C for 30 minutes as above, and 100µl TMB colorimetric solution was added to each well. After color development for 10 minutes, 100µl stop solution was added to each well; the OD value of each well was detected using an enzyme reader; RPMI 1640 complete culture medium was used as a negative control, and the ratio of the measured value to the control value ≥ 2.1 was considered a positive cell well.

[0070] The antibody-secreting positive cell wells were cloned by limiting dilution method at 1 cell / well in 96-well culture plates. The positive cell wells were cloned three times in succession according to the above method. After expansion culture, they were frozen in culture medium containing 10% DMSO at a cell density of 10 6 Three stable hybridoma cell lines were obtained and named 2B5, 3C1 and 6E3.

[0071] (4) Preparation of monoclonal antibodies

[0072] Select healthy BALB / c mice of 6 to 8 weeks old and inject 0.5 mL of pristane intraperitoneally into each mouse. Ten days later, inject 1×10 6 Hybridoma cells. Ascites will be produced 7-10 days after inoculation of cells. Closely observe the health status of the animals and the signs of ascites. When ascites is as much as possible and the mice are about to die, kill the mice and use a dropper to suck the ascites into a test tube. Generally, 5-10 mL of ascites can be obtained from one mouse. Collect the ascites, centrifuge and take the supernatant, and store it in a -20℃ refrigerator.

[0073] Take the ascites supernatant, dilute it with 3 times the volume of PBS, and filter it with filter paper. Add the obtained filtrate to a protein G affinity chromatography column that has been equilibrated with PBS at a flow rate of 1 mL / min. Then wash the substances not adsorbed by protein G with PBS at a flow rate of 1 mL / min until the absorbance value at OD280nm reaches the baseline. Then elute and recover the antibody with 0.1M glycine eluent (pH2.5). The recovered solution is neutralized with 0.1M Tris (pH8.8), and the antibody concentration is adjusted to an appropriate concentration by ultrafiltration, and stored in aliquots at -20℃.

[0074] (5) Potency determination

[0075] The recombinant SFTSV nucleocapsid protein was diluted to 1 μg / mL with 0.05 mmol / L, pH=9.6 CB buffer, and 50 μL / well was added to the ELISA plate, overnight at 4°C. After coating, it was blocked with Casein, 100 μL / well, and blocked at 37°C for 2 hours; the antibodies prepared in step (4) diluted into different gradients were added to the ELISA plate coated with SFTSV, 50 μL / well, and reacted at 37°C for 30 minutes (at the same time, a negative control well was made, where the negative control well was 0.05 mmol / L, pH=9.6 CB buffer); horseradish peroxidase-labeled sheep anti-mouse IgG enzyme-labeled secondary antibody (diluted 6000 times with blocking solution) was added, 100 μL / well, and reacted at 37°C for 30 minutes; 100 μl TMB color development solution was added to each well, and after color development for 10 minutes, 100 μl stop solution was added to each well; the OD value of each well was detected using an ELISA reader; The test results are shown in Table 1 below.

[0076] Table 1 Absorbance at different dilution multiples

[0077]

[0078] It can be seen that the titers of the three monoclonal antibodies obtained in the present invention can all reach 1:128K, especially the titer of monoclonal antibody 2B5 is 1:512K, which has a higher titer.

[0079] (6) Affinity testing

[0080] The antibody affinity was determined using a Biacore T200 workstation. The affinity results are shown in Table 2. The antigen was the SFTSV nucleocapsid protein.

[0081] The results are shown in Table 2. It can be seen that the three monoclonal antibodies 2B5, 3C1, and 6E3 can all efficiently bind to the nucleocapsid protein of SFTSV.

[0082] Table 2 Affinity determination data of three monoclonal antibodies

[0083] (7) Identification of monoclonal antibody type

[0084] The antibody subclass identification kit was used to identify the subtypes of the three SFTSV monoclonal antibodies obtained. The absorbance was measured at a wavelength of 450nm by ELISA. It was finally found that the three monoclonal antibodies 2B5, 3C1, and 6E3 were all IgG1, and the light chain was a κ chain.

[0085] (8) Double antibody sandwich method for detecting SFTSV

[0086] Step A: The three monoclonal antibodies 2B5, 3C1, and 6E3 were coated on ELISA plates at a concentration of 10 μg / mL, respectively, at 4°C overnight, blocked with 1% BSA for 2 h the next day, and washed three times.

[0087] Step B: Add 0.1 μg / ml of inactivated SFTSV, then dilute to 0.5 ng / ml, incubate at 37°C for 1 h, and wash 3 times.

[0088] Step C: Add other HRP-labeled antibodies with different sites from the coated antibody (1:1000 dilution), incubate at 37°C for 1 h, wash 5 times with PBST, add luminescent substrate, and read the luminescence value on a luminometer.

[0089] Results Figure 1 (The first antibody in the label is the coating antibody, and the second antibody is the labeling antibody). It can be seen that the three monoclonal antibodies 2B5, 3C1, and 6E3 can be paired for the double antibody sandwich method to detect SFTSV. Among them, the pairing effect of 2B5 as a coating antibody and 3C1 as a labeling antibody is the best, and its detection limit can reach below 0.5 ng / mL. The detection limits of the other two paired antibodies are also below 5ng / mL.

[0090] (9) Monoclonal antibody sequencing

[0091] Primers were synthesized based on the constant region sequences of the antibody genes, and the two monoclonal antibodies 2B5 and 3C1 were sequenced. The results are shown below and in Table 3.

[0092] Monoclonal antibody 2B5 antibody sequence:

[0093] The sequences of the heavy chain variable regions CDR1 to CDR3 are shown in SEQ ID NOs: 1 to 3, respectively;

[0094] The sequences of light chain variable region CDR1 to CDR3 are shown in SEQ ID NOs: 7 to 9, respectively;

[0095] The sequences of the heavy chain variable regions FR1 to FR4 are shown in SEQ ID NOs: 13 to 16, respectively;

[0096] The sequences of the light chain variable regions FR1 to FR4 are shown in SEQ ID NOs: 21 to 24, respectively;

[0097] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:29, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO:33;

[0098] The amino acid sequence of the light chain variable region is shown in SEQ ID NO:31, and the nucleic acid sequence of the light chain variable region is shown in SEQ ID NO:34;

[0099] GAGGTGCAGCTGGTGGAGTCTGGGGGAGACTTGGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATGCCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAACCATTACTAGTGGTGGTAGTTACACCTAC TACCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGACCAGTCTGCGGTCTGAGGACACAGCCATGTATTTTTGTGCAAGACGGGATTACGACTATTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA (SEQ ID NO:33);

[0100] GACATCCAGATGACTCAGTCTCCAGCCTCCCTATCTGTATCTGTGGGACAAACTGTCACCATCACATGTCGTGCAAGTGAGAATATTAACAGTAATTTAGCATGGTATCAGCAGAAACAGGGAAAATCTCCTCAGCTCCTGGTCTATGCTGCAACAAACTTAG CAGATGGTGTGCCATCAAGGTTCAGTGGCAGTGGATCAGGCACACAGTACTCCCTCAAGATCAACAGCCTGCAGTCTGAAGATTTTGGGAGTTATTATTGCCAACATTTTTGGGGTAGTCCTCCGACGTTCGGTGGAGGCACCAACCTGGAAATCAAAC (SEQ ID NO:34).

[0101] Monoclonal antibody 3C1 antibody sequence:

[0102] The sequences of the heavy chain variable regions CDR1 to CDR3 are shown in SEQ ID NOs: 4 to 6, respectively;

[0103] The sequences of light chain variable region CDR1 to CDR3 are shown in SEQ ID NOs: 10 to 12, respectively;

[0104] The sequences of the heavy chain variable regions FR1 to FR4 are shown in SEQ ID NOs: 17 to 20, respectively;

[0105] The sequences of the light chain variable regions FR1 to FR4 are shown in SEQ ID NOs 25 to 28, respectively;

[0106] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:30, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO:35;

[0107] The amino acid sequence of the light chain variable region is shown in SEQ ID NO:32, and the nucleic acid sequence of the light chain variable region is shown in SEQ ID NO:36;

[0108] GAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTTGTGAGGCCAGGGGCCTTAGTCAAGTTGTCCTGCAAAGCTTCTGCCTTCAACATTAAAGACTACTATATACATTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGCTTGATCCTGAGAATGGTAATACTTATAG ATATGATCCGAAGTTCCAGGACAAGGCCAGTATGACAGCAGACACATCCTCCAACACAGCCTACCTACAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGCCTCTGGGACGACCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO:35);

[0109] GACATTGTGATGACCCAGTCTCACAAATCCATGTCCGCATCAGTTGGAGACAGGGTCAGCATTACCTGCAAGGCCAGTCAGGATGTGACTACTACTATAGCCTGGTATCAACAGAAACCAGGACAATCACCTAAACTATTGATTTATTCGGCATCCTACCGGT ACACTGGAGTCCCTGATCGCTTCACTGGCAGTGGATCTGGGACGGATTTCACTTTCACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTTACTGTCAGCATTATTATACAAATCCTCCCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAAC (SEQ ID NO:36).

[0110] Table 3 Amino acid sequence information of 2B5 and 3C1 monoclonal antibodies

[0111]

[0112] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Antibodies against new bunyaviruses, characterized in that Contains the following amino acid sequence: (1) the three CDR regions of its heavy chain have the amino acid sequence shown in any one of SEQ ID NOs: 1 to 6; the three CDR regions of its light chain have the amino acid sequence shown in any one of SEQ ID NOs: 7 to 12; or (2) an amino acid sequence that has one or more amino acids substituted, added or deleted from the amino acid sequence shown in (1), but has the same or similar function as the amino acid sequence shown in (1); or (3) An amino acid sequence having at least 80% homology with the amino acid sequence shown in (1) or (2).

2. The antibody according to claim 1, characterized in that The antibody comprises the following amino acid sequence: The three CDR regions of its heavy chain have the amino acid sequences shown in SEQ ID NOs: 1, 2 and 3, respectively, and the three CDR regions of its light chain have the amino acid sequences shown in SEQ ID NOs: 7, 8 and 9, respectively; or The three CDR regions of its heavy chain have the amino acid sequences shown in SEQ ID NOs: 4, 5 and 6, respectively, and the three CDR regions of its light chain have the amino acid sequences shown in SEQ ID NOs: 10, 11 and 12, respectively.

3. The antibody according to claim 1 or 2, characterized in that The four FR regions of the heavy chain have an amino acid sequence as shown in any one of SEQ ID NOs: 13 to 20; The four FRs of the light chain have an amino acid sequence as shown in any one of SEQ ID NOs: 21 to 28.

4. The antibody according to any one of claims 1 to 3, characterized in that The antibody comprises the following amino acid sequence: The four FR regions of its heavy chain have the amino acid sequences shown in SEQ ID NOs: 13, 14, 15 and 16, respectively, and the four FR regions of its light chain have the amino acid sequences shown in SEQ ID NOs: 21, 22, 23 and 24, respectively; or The four FR regions of its heavy chain have the amino acid sequences shown in SEQ ID NOs: 17, 18, 19 and 20, respectively, and the four FR regions of its light chain have the amino acid sequences shown in SEQ ID NOs: 25, 26, 27 and 28, respectively.

5. The antibody according to any one of claims 1 to 4, characterized in that Its heavy chain variable region has the amino acid sequence shown in SEQ ID NO: 29 or 30; The light chain variable region thereof has the amino acid sequence shown in SEQ ID NO: 31 or 32.

6. The antibody according to any one of claims 1 to 5, characterized in that It also includes a constant region, wherein the constant region of the heavy chain is IgG1, and the constant region of the light chain is a kappa chain.

7. Biomaterial, characterized in that Include at least one of the following Ⅰ~Ⅵ: Ⅰ. A nucleic acid encoding an antibody against the new bunyavirus according to any one of claims 1 to 6; II. an expression vector comprising the nucleic acid; III. transforming or transfecting a host cell with the expression vector; IV. A conjugate prepared by coupling an antibody against the new bunyavirus according to any one of claims 1 to 6 with a solid medium or a semisolid medium; V. A chemically or biologically labeled antibody against the new bunyavirus according to any one of claims 1 to 6; VI. A conjugate prepared by coupling a chemically labeled or biologically labeled antibody against the new bunyavirus according to any one of claims 1 to 6 with a solid medium or a semi-solid medium.

8. The method for preparing an antibody according to any one of claims 1 to 6, characterized in that: include: Cultivate the host cells in the biological material of claim 7 to induce the expression of antibodies against the new bunyavirus.

9. Use of at least one of the following items ⅰ to ⅲ in the preparation of a detection reagent or a detection kit for a new bunyavirus: i. An antibody against the new bunyavirus according to any one of claims 1 to 6; ii. The biomaterial according to claim 7; iii. Antibodies against new bunyavirus are obtained by the preparation method according to claim 8.

10. A detection reagent or a detection kit, characterized in that: Include at least one of the following ①~③: ①. Antibodies against the new bunyavirus according to any one of claims 1 to 6; ② The biological material according to claim 7; ③. Antibodies against the new bunyavirus are obtained by the preparation method described in claim 8.

Images