Phage screening method based on digital microfluidics and application thereof

Abstract

The invention relates to a bacteriophage screening method based on digital microfluidics, which adopts interception type washing, greatly improves the positive yield of bacteriophages, optimizes the procedure, reduces the pollution, and greatly saves the reagent cost because the used reagent is only about 0.6% of the original process. The bacteriophage screening method based on digital microfluidics can be well applied to screening of peptide drugs or monoclonal antibodies in a bacteriophage display technology.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and further to phage display technology, and specifically relates to a phage screening method based on digital microfluidics and its application. Background Art

[0002] Since its creation in the early 1990s, phage display techniques (PDT) have become an important research tool in biological research. It has fundamentally changed the traditional monoclonal antibody preparation process and is widely used in the establishment of antigen-antibody libraries, drug design, vaccine research, pathogen detection, gene therapy, antigen epitope research, and cell signal transduction research.

[0003] At present, traditional phage display technology has the disadvantages of requiring a large volume of reagents and high costs. In addition, the experimental operation steps are cumbersome and time-consuming. It takes at least 6 days to complete 3 rounds of screening, which requires high skills of the operator. In addition, due to the long experimental process, there is a risk of experimental failure due to contamination caused by improper operation.

[0004] Traditional microfluidic technology relies on the use of mechanical pumps and valves. The integration of multifunctional modules is difficult, and it is difficult to achieve continuous multi-step processing of samples. It is also difficult to achieve precise control of the positions and reaction times of multiple reagents. It is also difficult to meet the application requirements of high-throughput detection and analysis of multiple reaction systems or multiple reaction conditions in parallel.

[0005] There are a few digital microfluidic phage display technologies available, but overall, the current digital microfluidic phage screening methods still have defects such as poor screening effect, low phage positive yield and high reagent cost. Summary of the invention

[0006] Based on this, the purpose of the present invention is to provide a phage screening method based on digital microfluidics and its application, wherein the screening method has the advantages of good screening effect and high phage positive yield.

[0007] The first aspect of the present invention provides a phage screening method based on digital microfluidics, which is performed on a digital microfluidics chip and comprises the following steps:

[0008] S1. Carry out bacterial culture in the bacterial continuous culture area;

[0009] S2. In the panning experimental area, negative screening magnetic beads and the constructed phage library are mixed, and after incubation, the negative screening magnetic beads are removed by magnetic separation to obtain screened phage droplets;

[0010] S3. Add positive screening magnetic beads, mix with the remaining phages after screening in step S2, incubate, adsorb the positive screening magnetic beads through the automated magnetic adsorption module, tear the droplets containing the positive screening magnetic beads, and remove the excess phage library;

[0011] S4. Use washing liquid to perform interception-flow washing on the positive screening magnetic bead droplets: connect the droplets containing the positive screening magnetic beads to be washed with the adjacent washing liquid droplets in the same moving direction to form a whole droplet, place a magnet at the position in the direction to be moved, move the positive screening magnetic beads to the position to be moved, and then move the middle part of the whole droplet to disconnect it from the whole droplet; then continue the next step of washing in the above manner, repeat the cycle several times to complete a round of washing;

[0012] S5. After washing, add the E. coli host in the logarithmic growth phase, allow the phage on the magnetic beads to infect the host, and culture; after the E. coli recovers its vitality, add antibiotics for resistance screening and culture; tear the solution to remove the magnetic beads;

[0013] S6. In the reagent preparation area, separate the helper phage droplet, move it to the revived E. coli droplet for mixing, and allow the helper phage to super-infect the E. coli;

[0014] S7. In the liquid reserve area, antibiotics are moved and added to the superstained Escherichia coli for resistance screening, and the Escherichia coli after resistance screening are cultured to produce phages, thereby completing the first round of panning;

[0015] S8. As needed, the phages produced by panning are placed in the panning experimental area and subjected to the next round of panning according to the above steps until the panning is completed.

[0016] The second aspect of the present invention is to provide a method for screening polypeptide drugs or monoclonal antibodies based on digital microfluidic phage display technology, which includes the above-mentioned phage screening method.

[0017] The third aspect of the present invention is to provide the application of the above-mentioned phage screening method in the screening of polypeptide drugs or antibodies based on digital microfluidic phage display technology, or in the development of anti-pathogenic microorganism vaccines.

[0018] The digital microfluidics-based phage panning method of the present invention, by adopting the self-created interception-flow washing, greatly improves the yield of phage positives, optimizes the procedure, reduces pollution, and uses only about 0.6% of the original process reagents, greatly saving reagent costs. And by obtaining the surfactant for the appropriate bacterial culture, as well as the particle size of the negative screening magnetic beads and the positive screening magnetic beads, the panning effect is further optimized (fewer non-specific binding clones, fewer rounds required for panning. The number of required washes is reduced, and the total time used is reduced). The digital microfluidics-based phage panning method of the present invention can be well applied to the screening of peptide drugs or monoclonal antibodies in phage display technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a side schematic diagram of the digital microfluidic phage display platform.

[0020] Figure 2 Schematic diagram of the digital microfluidic chip partitioning.

[0021] Figure 3 The figure is a flow chart of phage display on the digital microfluidic chip of the present invention.

[0022] Figure 4.1 to Figure 4.4 This is a schematic diagram of the washing procedure of the intercepting washing method described in Example 1.

[0023] Figure 5 This is a schematic diagram of the three-round screening results of positive phages in the alpaca library in Example 1.

[0024] Figure 6.1 to Figure 6.2 This is a schematic diagram of the effect of different particle sizes of negative screening magnetic beads on the screening process in Example 2. DETAILED DESCRIPTION

[0025] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0026] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0027] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0028] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.

[0029] Infection: The process by which a bacteriophage injects its genetic material into the host E. coli.

[0030] Superinfection: The process by which a helper phage injects genetic material into an E. coli host that has already been infected by the phage.

[0031] In some embodiments of the present invention, a phage screening method based on digital microfluidics is provided, which is performed on a digital microfluidic chip and includes the following steps:

[0032] 1). Cultivating bacteria in a continuous bacterial culture area; during bacterial culture, adding a surfactant to increase the bacterial migration time, the surfactant is preferably F68, more preferably, 0.05-0.15ul F68 surfactant can be added to each 100ul bacterial solution; in one embodiment, 0.09-0.11ul F68 surfactant is added to each 100ul bacterial solution to increase the migration time to 5 hours;

[0033] 2) In the panning experiment area, negative screening magnetic beads and the constructed phage library are mixed, non-specific binding phages are removed after incubation, and negative screening magnetic beads are adsorbed by the automated magnetic adsorption module, and the droplets containing negative screening magnetic beads are torn to remove the negative screening magnetic beads;

[0034] 3) Add positive screening magnetic beads, mix with the remaining phages after screening in step S2, incubate, adsorb the positive screening magnetic beads through the automated magnetic adsorption module, tear the droplets containing the positive screening magnetic beads, and remove the excess phage library; in some embodiments, in order to increase the phage positive ratio, the number of positive screening magnetic beads added is 10-500; more preferably, the number of positive screening magnetic beads is 50-200;

[0035] 4) Use washing liquid to perform interception-flow washing on the positive screening magnetic bead droplets: for the positive screening magnetic bead droplets that need to be washed, connect the positive screening magnetic bead droplets with adjacent washing liquid droplets that are in the same direction as the moving direction to form a whole droplet, place a magnet at the position in the direction to be moved, move the positive screening magnetic beads to the position to be moved, and then move the middle part of the whole droplet to disconnect it from the whole droplet; then continue the next step of washing in the above manner, repeat the cycle, and complete a round of washing;

[0036] 5). After washing, add the E. coli host in the logarithmic growth phase, allow the phage on the magnetic beads to infect the host, and culture; after the E. coli recovers its vitality, add antibiotics for resistance screening and culture; tear the solution to remove the magnetic beads;

[0037] 6) In the reagent preparation area, separate the helper phage droplets, move them to the revived E. coli droplets for mixing, and allow the helper phage to super-infect the E. coli;

[0038] 7) In the liquid reserve area, move the antibiotics and add them to the superstained Escherichia coli for resistance screening, culture the Escherichia coli after resistance screening, produce phages, and complete the first round of screening;

[0039] 8) As needed, the phages produced by panning are placed in the panning experimental area and subjected to the next round of panning according to the above steps until the panning is completed.

[0040] In some embodiments, in order to improve the screening effect, the particle size of the positive screening magnetic beads is 10-20 um, and more preferably, the particle size of the positive screening magnetic beads is 20 um.

[0041] In some embodiments, the incubation time is 0.5-2.5 h, further 1-2 h.

[0042] In some embodiments, the final concentration of the antibiotic added in step 5 is 90-110 ug / mL.

[0043] In some embodiments, the final concentration of the antibiotic added in step 5 is 30-40 ug / mL.

[0044] It is clear to those skilled in the art that the steps included in the method of the present invention do not need to be limited to a specific order, and those skilled in the art can make appropriate adjustments to the order based on their common sense. For example, the bacterial culture in step 1) is carried out continuously and has no strict order with other steps, as long as the phage screening can be achieved.

[0045] In order to better understand the present invention, the automated phage display platform used in the following examples is introduced: a panoramic camera is configured to observe the overall operation of the chip and droplets; a microscopic camera is used to observe the contents in the droplets (such as magnetic beads); a micro-optical measurement module is used to measure the OD of bacteria on the chip 600 absorbance; magnetic adsorption module, which can be programmed according to the preset and automatically move to the area that needs magnetic adsorption with 3 axes; chip structure, the sandwich structure of the chip currently used is displayed; temperature control module, used to control the temperature of the chip area; electric three-axis control platform, used to digitally control the movement of the chip platform under different lenses.

[0046] The whole chip is composed of 16384 electrodes, each of which is a 500um*500um square, and the chip gap is 100um. The chip is distributed with adjustable injection holes for injecting reagents into the chip. Area A is the panning experiment area, which is used for the process of magnetic bead incubation, washing, phage breeding, etc. in multiple rounds of panning experiments; Area B is the reagent storage area, which is used to store spare reagents during the experiment, such as antibiotics, auxiliary phages, etc.

[0047] Bacteria, etc.; Area C is the bacterial continuous culture area, which is used to effectively culture bacteria on the chip.

[0048] The present invention is further described in detail below with reference to specific embodiments.

[0049] Example 1

[0050] The phage screening method based on digital microfluidics described in this embodiment includes the following steps.

[0051] According to the conventional method, the experiment is carried out on a digital microfluidic chip. Various reagents required for the experimental process (such as alpaca natural phage antibody library, negative screening BSA-modified carboxyl magnetic beads, positive screening GFP-modified carboxyl magnetic beads, bacterial culture medium, ampicillin, kanamycin, helper phage, Escherichia coli, etc.) are injected into the chip. By controlling the power on and off of each electrode, each component is moved to the appropriate partition to continue the reaction or standby. Figure 2 Partition diagram.

[0052] 1) In the bacterial culture area, the culture medium and bacteria (Escherichia coli TG1) are mixed by controlling the electrode, and the injected bacterial droplets are cultured at 37°C for about 3 hours to the logarithmic growth phase for subsequent experimental infection processes. At the same time, the bacterial droplets are torn apart by electrode control and mixed with the spare culture medium for transfer culture. The transfer step can be repeated many times to keep the bacteria in the logarithmic growth phase at the specified time. The logarithmic phase bacteria used subsequently are all from the bacteria cultured in the chip, and no additional addition is required. At the same time, the bacterial culture area can be integrated with an absorbance detection module to monitor the bacterial growth status.

[0053] During the culture, 0.1ul of F68 surfactant was added to every 100ul of bacterial solution. It was observed that when only 0.1% F68 was added, the bacterial migration time on the chip increased to 5h. Since the entire experiment time is usually more than 2 hours, when the bacterial migration time is increased to 5h, there is no need to add additional bacteria for culture.

[0054] Serial number Biological reagents Moving time 1 TG1 bacterial liquid 2h 2 TG1 bacterial solution + 0.1% F68 5h 3、 TG1 bacterial solution + 0.1% F127 3h 4、 TG1 bacterial solution + 0.1% Tween 20 0.5h

[0055] 2) In the panning experiment area, a certain amount of negative screening magnetic beads (1 grid original concentration, usually calculated based on the concentration of commercial magnetic beads after coupling operation, is 2 mg / mL) and 10uL of phage library are moved to the designated area for mixing and incubated at room temperature for 30 minutes to remove non-specific binding phages. After the magnetic beads are adsorbed by the automated magnetic adsorption module, the magnetic bead droplets (0.025uL) are torn to remove the magnetic beads.

[0056] 3) Add a certain number of 20um positive screening magnetic beads (100), mix with the remaining phages after negative screening, incubate at room temperature for 2 hours, and then adsorb the positive screening magnetic beads through the automated magnetic adsorption module, tear the droplets containing the positive screening magnetic beads, and remove the excess phage library.

[0057] 4) Wash the positive screening magnetic beads in the interception washing mode (10 times) with washing solution to remove the non-specifically adsorbed phages on the positive screening magnetic beads:

[0058] See also Figure 1 The droplets in the left two grids are the initial droplets containing magnetic beads that need to be washed and need to be moved to the right;

[0059] See also Figure 2 : Liquid connection, after connecting two adjacent washing liquid droplets in the same moving direction to form a whole droplet, a magnet is placed on the right side of the whole droplet to adsorb the magnetic beads to the right side;

[0060] See also Figure 3 : Continue moving the middle droplet of the entire droplet to disconnect it from the entire droplet. At this time, the magnetic bead is on the right.

[0061] Then continue the next step of washing in the above manner, repeat the cycle several times to complete a round of washing;

[0062] The whole process uses the fact that the movement speed of magnetic beads is faster than the free diffusion speed of solution molecules, and the molecules in the droplet are retained in the front droplet before they are completely diffused.

[0063] The intercepting flow washing method greatly saves chip space and washing time while still maintaining a good washing effect.

[0064] 5) After the magnetic beads are washed, 0.2uL of the E. coli host in the logarithmic growth phase cultured in step 1) is added at 37°C to allow the phages on the magnetic beads to infect the host;

[0065] According to the method described in this example, it can be found that there is little difference in the effect of magnetic beads being eluted with HCl and directly infecting TG1, so there is no need to perform the HCl elution step, and the process is optimized.

[0066]

[0067] The host is cultured at a suitable temperature (37° C. in this embodiment) for a certain period of time (30 minutes in this embodiment) to restore the vitality of the host;

[0068] Add an appropriate amount of antibiotic (Amp in this example, final concentration 100 ug / mL) and perform resistance screening culture under certain conditions (37° C., 1 h in this example);

[0069] The magnetic beads were adsorbed using an automated magnetic adsorption module, and the beads (0.025uL) were removed by tearing the solution.

[0070] 6) In the reagent preparation area, the helper phage droplets are separated and moved to the revived E. coli droplets for mixing, and the helper phage is allowed to superinfect the E. coli under appropriate temperature conditions (37° C. in this embodiment).

[0071] 7) Move antibiotics (final concentration Kana 35ug / mL) in the liquid reserve area and add them to the super-infected E. coli, so that the double-infected E. coli are cultured at a suitable temperature (30°C in this embodiment) for a certain period of time (3-5h in this embodiment) to produce phages. (At this time, the total reaction volume is 0.3uL) This completes the first round of panning.

[0072] 8) In the spare area, a certain amount (one grid of 2 mg / mL magnetic bead droplets, the volume is about 25 nL) of negative screening magnetic beads and the phages produced by the first round of panning (0.3 uL) are moved to the designated area for mixing and incubated at room temperature for 30 minutes to remove non-specific binding phages. After the magnetic beads are adsorbed by the automated magnetic adsorption module, the droplets containing magnetic beads are torn to remove the magnetic beads.

[0073] Repeat the above steps to complete the second round of screening.

[0074] Subsequently, the first round of screening is repeated as needed to complete 3 or more rounds of screening.

[0075] This example uses the alpaca phage library (GFP-Phage) as an example, and phage panning is performed according to the above method.

[0076] Two anti-GFP phages (GFP-enhancer and GFP-minimizer) known to bind to GFP protein were mixed into the alpaca phage library that cannot bind to GFP as positive input. The input ratio was 10:1.5×10 8 pfu (5 for each of the two Anti-GFP phages).

[0077] Three rounds of panning were performed using BSA-Beads as negative screening beads and GFP-Beads as positive screening beads.

[0078] The amount of Anti-GFP phage obtained in each round of panning was measured by colony PCR to determine the enrichment effect of each round.

[0079] name Sequence (5'-3') GFP-F GATTACGCCAAGCTTGCATGCA(SEQ ID NO.1) Enhancer-R AGAACTACGATCACCTGCAGA(SEQ ID NO.2) Minimizer-R GTAGTGGTACCATCACGGCAG(SEQ ID NO.3)

[0080] Reaction system:

[0081] Element Volume(uL) 2×PCR Mix 7.5 Forward primer (10uM) 0.3 Reverse primer (10uM) 0.3 template Pick colonies <![CDATA[ddH20]]> 6.9

[0082] Reaction conditions:

[0083] step Temperature(℃) time Pre-denaturation 98 5min transsexual 98 10s annealing 60 10s extend 72 30s Final extension 72 5min

[0084] The final results showed that after three rounds of screening, the proportion of Anti-GFP phage increased from less than 0.0001% at the beginning to 100% at the end.

[0085] The interception washing method of the present invention not only saves chip space, but also makes it stable and feasible to complete only three rounds of panning. For digital microfluidic chips, it reduces the dependence on chip electrodes and reduces the probability of losing control of droplets due to long-term operation.

[0086] In addition, it was found that if 20um magnetic beads are not used, it is difficult to count the magnetic beads. Secondly, the aggregation affects the capture effect, which will increase the probability of losing effective samples. In addition, according to the panning method described in the present invention, the total amount of reagents used in the experiment is only about 0.6% of the traditional phage display panning experiment, which greatly saves the reagent cost. Except for the first round that requires a large volume of 10uL, the total reaction volume of each round is only 0.3uL.

[0087] Example 2 Selection of particle size for screening magnetic beads

[0088] It was accidentally discovered during the study that the particle size of the positive screening magnetic beads has a great influence on the effect of the magnetic beads in the phage screening method of the present invention in capturing phages: it not only causes aggregation and low magnetic attraction efficiency, but also affects the capture effect of positive phages and the infection effect after capture.

[0089] The phage panning method described in Example 1 was followed and experiments were performed with different particle sizes.

[0090] Single magnetic bead capture effect detection: After incubating a single positive screening magnetic bead with a positive phage, wash to remove unbound phage. Mix the positive screening magnetic beads bound to the positive phage with the TG1 host bacteria, and allow the adsorbed phage to infect the TG1 host. Then count the number of clones on the resistance plate to determine the number of phages that can be adsorbed by a single positive screening magnetic bead.

[0091] In addition to microscopic observation, the capture effect and post-capture infection effect are supported by the number of plate clones.

[0092]

[0093] from Figure 6.1 In the figure, from top to bottom are the positive screening magnetic beads of 4.5um, 10um, and 20um. The positive screening magnetic beads of 4.5um can be seen to be obviously aggregated and are not in a monodisperse state.

[0094] from Figure 6.2 It can be seen that under the same time, the positive screening magnetic beads are adsorbed to one side. It can be seen that all the 20um positive screening magnetic beads are adsorbed, a small amount of 4.5um positive screening magnetic beads remain, and a large amount of 10um positive screening magnetic beads remain.

[0095] Example 3

[0096] We found in the experiment that the number of positive screening magnetic beads has a great influence on the phage positive ratio. The experiment was carried out according to the method described in Example 1. The results are shown in Table 3.1.

[0097] Number of captured phages: After incubating the positive screening magnetic beads and phages (including positive and negative), wash to remove unbound phages. Mix the positive screening magnetic beads bound to the positive phages with the TG1 host bacteria, so that the adsorbed phages infect the TG1 host. Then count the number of clones on the resistance plate to determine the number of phages that can be adsorbed by a single positive screening magnetic bead.

[0098] Phage positive ratio: Perform colony PCR verification on the plate clones to detect whether the clones are positive clones to determine the phage positive ratio.

[0099] Residual amount determination: After washing, the droplets containing positive screening magnetic beads are first adsorbed to one side with a magnet, and the opposite side is torn apart to detect the content of bacteriophages in the half of the droplets that do not contain positive screening magnetic beads to determine the washing residual rate.

[0100] Table 3.1 Effect of the number of positive screening beads

[0101]

[0102]

[0103] It can be seen from Table 3.1 that, taking all factors into consideration, the best screening effect is achieved when more than 100 positive screening magnetic beads are used, and when the number of positive screening magnetic beads reaches more than 500, the residual rate increases, but the phage positive ratio decreases.

[0104] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A phage screening method based on digital microfluidics, characterized in that: The process is carried out on a digital microfluidic chip and includes the following steps: S1. Cultivate E. coli in the continuous bacterial culture area; S2. In the panning experimental area, negative screening magnetic beads and the constructed phage library are mixed, and after incubation, the negative screening magnetic beads are removed by magnetic separation to obtain screened phage droplets; S3. Add positive screening magnetic beads, mix with the phage droplets screened in step S2, incubate, adsorb the positive screening magnetic beads through the automated magnetic adsorption module, tear the droplets containing the positive screening magnetic beads, and remove the excess phage library; S4. Use a washing liquid to perform interception-flow washing on the positive screening magnetic bead droplets: connect the droplets containing the positive screening magnetic beads to be washed with adjacent washing liquid droplets in the same direction as the moving direction to form a whole droplet, place a magnet at the position in the direction to be moved, move the positive screening magnetic beads to the position to be moved, and then move the middle part of the whole droplet to disconnect it from the whole droplet; then continue the next step of washing in the above manner, repeat the cycle multiple times to complete a round of washing; S5. After washing, add the E. coli host in the logarithmic growth phase, allow the phage on the magnetic beads to infect the host, and culture; after the E. coli recovers its vitality, add antibiotics for resistance screening and culture; tear the solution to remove the magnetic beads; S6. In the reagent preparation area, separate the helper phage droplet, move it to the revived E. coli droplet for mixing, and allow the helper phage to super-infect the E. coli; S7. In the liquid reserve area, antibiotics are moved and added to the superstained Escherichia coli for resistance screening, and the Escherichia coli after resistance screening are cultured to produce phages, thereby completing the first round of panning; S8. As needed, the phages produced by panning are subjected to the next round of panning in the panning experimental area according to the above steps until the panning is completed.

2. The phage screening method based on digital microfluidics according to claim 1, wherein: When culturing bacteria, a surfactant is added.

3. The phage screening method based on digital microfluidics according to claim 2, wherein: 0.05-0.15ul F68 surfactant was added to every 100ul bacterial solution.

4. The phage screening method based on digital microfluidics according to claim 3, wherein: 0.09-0.11ul F68 surfactant was added to every 100ul bacterial solution.

5. The phage screening method based on digital microfluidics according to claim 1, wherein: The particle size of the positive screening magnetic beads is 10-20 um.

6. The phage screening method based on digital microfluidics according to claim 5, wherein: The particle size of the positive screening magnetic beads is 20 um.

7. The phage screening method based on digital microfluidics according to claim 1, wherein: The number of positive screening magnetic beads added to S3 is 10-500.

8. The phage screening method based on digital microfluidics according to claim 7, wherein: The number of positive screening magnetic beads added to S3 is 50-200.

9. The phage screening method based on digital microfluidics according to claim 1, wherein: The final concentration of the antibiotic added to S5 is 90-110 ug / mL, and / or the final concentration of the antibiotic added to S5 is 30-40 ug / mL.

10. A method for screening polypeptide drugs or monoclonal antibodies based on digital microfluidic phage display technology, wherein: The invention comprises the phage screening method according to any one of claims 1 to 9.

11. Application of the phage panning method according to any one of claims 1 to 9 in the screening of polypeptide drugs or antibodies or anti-pathogenic microorganism vaccines in the research and development based on digital microfluidic phage display technology.

Images