Transcription factor OsLBD40, overexpression vector, recombinant agrobacterium, preparation method and application

Abstract

The invention discloses a transcription factor OsLBD40, an overexpression vector, a recombinant agrobacterium and a preparation method and application thereof. The nucleotide sequence of the transcription factor OsLBD40 is as shown in SEQ ID NO. 1. The transcription factor OsLBD40 can regulate and control gene expression in rice seeds, especially can regulate and control expression of starch-related genes in the rice seeds, so that chalkiness of rice is improved, and yield and quality are improved. Compared with a wild type, the thousand seed weight of an OsLBD40 overexpression plant is increased by 13%, the amylose content is increased by 26%, and chalkiness is also obviously reduced.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and biotechnology, and particularly relates to a transcription factor OsLBD40, an overexpression vector, a recombinant Agrobacterium, and a preparation method and application thereof. Background Art

[0002] Transcription factors refer to a DNA sequence in a gene that can bind to RNA polymerase and other trans factors that affect transcription to achieve accurate and effective initiation of transcription. Transcription factors can guide the holoenzyme to correctly bind to the template, activate RNA polymerase, and start gene transcription, thereby controlling the start time and degree of gene expression (transcription).

[0003] Chalkiness is an important indicator for evaluating the appearance quality of rice. In some rice endosperms, gaps form between loosely packed starch granules, causing obvious random light reflections, making them appear chalky. Chalkiness is a quantitative trait controlled by multiple genes and is also affected by the external environment, so research on chalkiness has been slow. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a transcription factor OsLBD40, an overexpression vector, a recombinant Agrobacterium, and a preparation method and application.

[0005] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0006] A transcription factor OsLBD40 is used in rice breeding. The nucleotide sequence of the transcription factor OsLBD40 is shown in SEQ ID NO.1.

[0007] As a further improvement, the transcription factor OsLBD40 improves rice chalkiness, increases thousand-grain weight and increases the amylose content.

[0008] The present invention also provides an overexpression vector, which contains the transcription factor OsLBD40.

[0009] The present invention also provides a method for preparing the overexpression vector, comprising the following steps:

[0010] 1) Extracting genomic RNA from rice seeds at the filling stage;

[0011] 2) Using the cDNA obtained by reverse transcription of the extracted genomic RNA as a template, primers were designed according to the sequence of OsLBD40 in rice gDNA, and PCR amplification was performed to obtain the target gene fragment;

[0012] 3) Connecting the target gene fragment to the vector, transforming the connection product into competent cells, extracting the plasmid from the positive strain, and obtaining the overexpression vector.

[0013] As a further improvement, the primers include an upstream primer shown in the nucleotide sequence SEQ ID NO.2 and a downstream primer shown in the nucleotide sequence SEQ ID NO.3.

[0014] The invention also provides a recombinant Agrobacterium, which has the overexpression vector.

[0015] The present invention also provides a method for obtaining the recombinant Agrobacterium, comprising:

[0016] The overexpression vector is transformed into Agrobacterium to obtain recombinant Agrobacterium.

[0017] The present invention also provides an application of the overexpression vector or the recombinant Agrobacterium in rice breeding.

[0018] The invention also provides a method for obtaining transgenic rice, which comprises transferring the transcription factor OsLBD40 into rice plants.

[0019] As a further improvement, the following steps are included: allowing the recombinant Agrobacterium to infect rice callus, then performing antibiotic screening and culture, then inducing differentiation and rooting, obtaining T0 generation plants after seedling hardening, and obtaining T1 generation transgenic seedlings after T0 generation seeds germinate.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention shows that the transcription factor OsLBD40 can regulate gene expression in rice seeds, especially can regulate the expression of starch-related genes in rice seeds, thereby improving rice chalkiness, yield and quality. Compared with the wild type, the thousand-grain weight of OsLBD40 overexpressing plants increased by 13%, the amylose content increased by 26%, and the chalkiness was significantly reduced. The present invention helps to promote people's research on the development and growth of rice chalkiness, and provides a new tool and option for genetic modification of rice quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1This is a schematic diagram of the structure of the recombinant plasmid pBWA(V)HU-HA-OsLBD40 in Example 1;

[0024] Figure 2 This is the chalky phenotype of transgenic rice seeds in Example 2;

[0025] Figure 3 It is the bar graph of thousand-grain weight in Example 2;

[0026] Figure 4 is a bar graph of the amylose content in Example 2;

[0027] Figure 5 This is a bar graph of the OsLBD40 expression level in Example 2. DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0029] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0030] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0031] The nucleotide sequence of the transcription factor OsLBD40 of the present invention is shown in SEQ ID NO.1.

[0032] SEQ ID NO.1:

[0033] ATGCGGATGAGTTGCAACGGTTGCCGGGTGCTGCGCAAGGGATGCAGCGAAGGGTGCACCATCCGTCCGTGCCTGCAGTGGATCAAGACCCCCGAGGCGCAGGCCAACGCCACCGTCTTCCTCGCCAAGTTCTACGGCCGCGCCGGGCTTCTCAACCTGCTCGCTGCCGGGCCTGACCACCTCCGCCCCGCCGTCTTCCGCTCGCTCCTCTACGAGGCCTGCGGCCGCATCGTCAACCCGATCTACGGCTCCGTCGGCCTGCTCTGGTCGGGCCAGTGGCAGGCGTGCCAGGCCGCCGTCGAGGCCGTCCTCAAGGGCGACCCCGTCGTGCAGGTCTCCTCTGAGGCCGCCGCCGCCGCCCAGGCCACCCCGCCGCTCAGGGCCTACGACATCCGCCACGTCTCCAAGGACGCCGAGGCCGACGCCGCCGCCAACCTGCTCCGCGTCGCGCGCGGCGGCCGCACCCGCTTCAAGCGCGCCTCCTCCAGCTCCAACTCCAAGCACGGCGCCAAGCTTGCCGGAGCAGCCGCCGCCAAGCGCGCCGCGTCCCCCAGCAGCAGCAGCCCGACGCACGAGACGGAGCCGGAGGCGGTGGTCGTCGTCGGTGACCATGACGACGACCACCACCACCCTGCGCTGAGCCACGAGGTCCACGAGGAGTCGGCTGGCAGCCATGACCACGACGACGACGACCATGTGGACGACGGTGACAACAACGACATGGCCATCGCCGACGTGACGCCGCCGCGGGCGGGATCGGAGGATACCGAGGTCGAGACCGGCTCACACGTGAGCCAGGCCGAGCAGAGCCCCGTGCCGGTGGAGCACGAAGAGGGGGAGGAGGAGGAGGTCGGGCTGGAGCTCACGCTCGGGTTCCAGCCGCTCGTCGTGCGCGCCTCGAGGAGGCCTTCGTCGGCGGAGGCGCGCTGCGACCTTAGCGGCTTGAGCGCGGAGTCGAGTCGCATCGGCCTGCGGCTCGAGCTGCCAGCGTGA

[0034] The OsLBD40 gene provided above is the first to verify its biological function in rice, and it was found that it is involved in sucrose transport and affects rice yield and quality. Overexpression of this gene in rice can promote rice filling, increase rice thousand-grain weight, and ultimately rice yield.

[0035] The OsLBD40 gene of the present invention can be used as the target gene to construct a plant expression vector, wherein any promoter such as the cauliflower mosaic virus (CAMV) 35S promoter, Ubiquitin promoter or other promoters can be used, and the expression vector can include an enhancer if necessary, whether it is a transcription enhancer or a translation enhancer.

[0036] The expression vector used may be Ti plasmid, Ri plasmid, plant virus vector or the like.

[0037] Transformation methods include Agrobacterium-mediated transformation, gene gun method, pollen tube channel method or other methods to transform plants.

[0038] To simplify identification of transformed cells, selectable markers may be used including enzymes that confer antibiotic resistance, enzymes that utilize compounds for recognition by color change (e.g., B-glucuronidase GUS) or luminescence (e.g., luciferase), or marker-free selection.

[0039] The OsLBD40 gene used in the present invention comes from rice and has optimized codons suitable for expression in monocotyledonous plants such as rice. In addition to being applicable to dicotyledonous plants such as soybean, cotton, tobacco, etc., the gene is more suitable for monocotyledonous plants such as rice, corn, and wheat.

[0040] Example 1 PCR amplification of transcription factor OsLBD40 fragment and construction of pBWA(V)HU-HA-OsLBD40 recombinant vector.

[0041] 1. Obtaining the transcription factor OsLBD40 fragment includes the following processes: PCR amplification of the transcription factor OsLBD40 fragment.

[0042] The genomic RNA of rice seeds at the filling stage was extracted using a plant genomic RNA extraction kit (TIANGEN new plant genomic RNA extraction kit). According to the sequence of the transcription factor OsLBD40 in rice gDNA, a pair of PCR specific amplification primers were designed at the beginning and end, respectively. The nucleotide sequences of the primers are shown in Table 1. The cDNA extracted from the rice filling seed RNA was reverse transcribed as a template using 2×Hieff PCR amplification was performed with AdvanceFast PCR Master Mix (With Dye). The PCR reaction system is shown in Table 2.

[0043] Table 1 Primer nucleotide sequences

[0044]

[0045] Table 2 PCR reaction system

[0046]

[0047] The PCR amplification program was as follows: pre-denaturation at 98°C for 30 s, followed by denaturation at 98°C for 10 s, annealing at 61.5°C for 5 s, and extension at 72°C for 10 s for 33 reaction cycles, and finally extension at 72°C for 2 min.

[0048] The DNA fragments were recovered by agarose gel electrophoresis.

[0049] 50 μL of the reaction product was subjected to 1% agarose gel electrophoresis to recover the target gene fragment. The gel recovery kit was purchased from Guangzhou Meiji Biotechnology Co., Ltd.

[0050] 2. Construction of pBWA(V)HU-HA-OsLBD40 recombinant vector

[0051] 1. Enzyme digestion of pBWA(V)HU expression vector

[0052] Plasmid pBWA(V)HU was double-digested with BsaI and Eco31I. The enzyme digestion system is shown in Table 3.

[0053] Table 3 Plasmid double restriction enzyme digestion system

[0054]

[0055] 2. The double-digested vector and the target gene fragment obtained in step 1 were subjected to 1% agarose gel electrophoresis, and gel recovery was performed using a gel recovery kit purchased from Guangzhou Meiji Biotechnology Co., Ltd.

[0056] 3. Connection of target gene fragment and vector

[0057] The recovered and purified target fragment was connected to the recovered and purified vector, and the connection product was named pBWA(V)HU-HA-OsLBD40. The connection system is shown in Table 3 as follows:

[0058] Table 4 Connection system

[0059]

[0060] Ligation reaction conditions: 25°C for 30 min.

[0061] 4. Transformation of ligation products into competent cells

[0062] Take 10 μL of the ligation product to transform 100 μL of DH5α competent cells: mix the product and competent cells, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, immediately place on ice for 2 minutes, add 500 μL of LB medium preheated to room temperature, culture in a constant temperature shaker at 180 rpm and 37°C for 1 hour, centrifuge at 5000 rpm for 3 minutes, discard 500 μL of the culture supernatant, mix the remaining 100 μL with a pipette, and evenly spread it on an LB plate containing 50 μg / mL kanamycin resistance, invert, and culture in a constant temperature incubator at 37°C overnight.

[0063] 5. Sequencing and identification

[0064] Select positive single colonies and send them to Qingke Bioengineering Co., Ltd. for sequencing.

[0065] The sequencing results showed that the transcription factor OsLBD40 sequence in the obtained pBWA(V)HU-HA-OsLBD40 cloning vector was correct, and the sequence of the transcription factor OsLBD40 was shown in SEQ ID NO.1.

[0066] 6. Extract plasmids from positive strains with correct sequencing

[0067] The positive strains with correct sequencing were expanded and cultured in 20 ml LB medium containing corresponding antibiotics at 37°C overnight to extract the plasmid.

[0068] 7. Agrobacterium transformation

[0069] The constructed recombinant plasmid pBWA(V)HU-HA-OsLBD40 was transformed into Agrobacterium strain GV3101 by electroporation to obtain recombinant Agrobacterium (Agrobacterium tumefaciens GV3101 / pBWA(V)HU-HA-OsLBD40). After culturing on kan and Rif resistance medium for two days, single colonies were picked and shaken to identify positive clones. The strain was saved for future use.

[0070] Example 2 Obtaining transgenic plants

[0071] 1. Inducing callus

[0072] Put the peeled rice seeds of Nipponbare into a triangular bottle, soak them in 70% ethanol for 1 minute (to submerge the seeds), pour out the 70% ethanol, soak them in 30% sodium hypochlorite for 30 minutes, and then wash them with sterile water for 5-6 times until they are clear. Use tweezers to move the seeds onto sterilized filter paper, absorb the water, and finally place the seeds on the induction medium and culture them in a 30℃ light incubator for 20-30 days.

[0073] 2. Subculture

[0074] Select the yellow, tough, millet-sized callus tissue that has fallen off, and transfer it to the subculture medium with sterilized tweezers to grow for 7-14 days.

[0075] 3. Preparation of Agrobacterium: Take 20 μL of the stock solution of Agrobacterium GV3101 transformed with pBWA(V)HU-HA-OsLBD40 plasmid obtained in Example 1, inoculate it into 5 mL of YEP (Sambrook, et al. Molecular Cloning Laboratory Guide. 2001) liquid culture medium containing 50 mg L-1 streptomycin and 50 mg L-1 kanamycin, and shake overnight at 28°C. Take 500 μL of the activated bacterial solution, inoculate it into 5 mL of fresh YEP medium containing the same antibiotics, and continue to culture until the absorbance value (OD600) of the bacterial solution at a wavelength of 600 nm is 0.8-1.0.

[0076] 4. Callus infection and co-cultivation

[0077] Pick out the rice callus from the subculture medium and put it into a centrifuge tube. The amount of callus should be above the conical part of the 50mL centrifuge tube (select the light yellow, round and tough callus). Take 1mL of the cultured bacterial solution into a 1.5mL centrifuge tube, centrifuge at 4℃, 5000rpm for 1min, and remove the supernatant. Use 30mL of the infection solution containing 200μmolL-1 acetosyringone (As) to make a suspension of the collected bacteria, pour this suspension into the selected callus, and infect for 5min. Pour out the liquid, take out the callus, and place it on a sterile culture dish containing absorbent paper to drain for 30-40min. Place the callus on the co-culture medium (with a layer of 9cm sterile filter paper on it) and culture it in the dark at 25℃ for 60 hours.

[0078] 5. Bacteria washing and antibiotic screening culture

[0079] The callus tissue was removed from the co-culture medium and washed with sterile water for 5 times, with continuous shaking for 5 minutes each time. Then soaked in sterile water containing 500 mg L-1 carbenicillin (car) for 40 to 60 minutes. Finally, placed on sterile filter paper to drain for 2 hours. The first round of screening: the dried callus tissue was transferred to the selection medium containing 250 mg L-1 carbenicillin (car) and 50 mg L-1 hygromycin (Hyg) for the first screening, 30°C, light culture for 14 days; the second round of screening: the initial callus tissue with resistant callus tissue was transferred to the selection medium containing 250 mg L-1 carbenicillin (car) and 80 mg L-1 hygromycin (Hyg), 30°C, light culture for 10 days, and then transferred to the tissue culture room for 4 days.

[0080] 6. Induction of differentiation and rooting of resistant callus

[0081] Pick the bright yellow resistant callus tissue and transfer it into the differentiation pot containing differentiation medium, put it in the constant temperature culture room, wait for differentiation into seedlings (about 30 days, the culture conditions in the tissue culture room are 24-30℃, 14h light / 8h dark), and when the seedlings grow to about 5cm, put them into the rooting medium to strengthen the seedlings.

[0082] 7. Training and transplanting of transgenic seedlings

[0083] Pick out the test tubes with relatively complete differentiation of seedling roots and stems and leaves (when the seedlings grow to the top of the test tube, open the lid in time), open the sealing film, add appropriate amount of sterile water (to prevent bacteria from growing in the culture medium), harden the seedlings for about 3 to 7 days, then wash off the agar and transplant them to the greenhouse for hydroponic or soil culture growth and testing.

[0084] 8. Rapid detection of transgenic seedlings using hygromycin to obtain T0 generation plants

[0085] Cut and collect fresh green leaves of about 1 cm long (with cuts at both ends) from the seedlings to be tested, place them flat on a medium containing hygromycin (80 mg L-1), and culture them at 30°C, 16h / 8h (light / dark) for 48h. If the leaves remain fresh green, they are positive plants, while the leaves of negative seedlings show block necrosis (Zheng Ye. Establishment and application of rice efficient transgenic system. 2008). 100 positive T0 plant lines were obtained by hygromycin screening, and the overexpression materials were planted in the net room of Hunan Agricultural University to obtain T0 generation seeds.

[0086] 9. Molecular identification of OsLBD40 overexpressing strains

[0087] After germination of T0 seeds, T1 transgenic seedlings were obtained. Total RNA from the roots of different strains of transgenic T1 seedlings was extracted, and total cDNA was reverse transcribed and identified by quantitative PCR. Stable genetic transgenic strains OE-1 and OE-2 were obtained. The expression levels of OsLBD40 in the three strains were 5 to 10 times higher than that of the wild type (NP). Figure 5 ).

[0088] 10. Propagation and physiological assay of overexpression lines

[0089] The overexpression material was propagated in the net room of Hunan Agricultural University, and the T2 generation material with stable inheritance of plant traits was obtained. The phenotypic statistical structure showed that the thousand-grain weight of the transgenic material reached a maximum of 24.32g, which was significantly increased compared with the wild type (WT) ( Figure 3 ); The amylose content of transgenic materials was significantly higher than that of wild type (NP) ( Figure 4 ). The chalkiness rate and chalkiness of the transgenic material (OE) were significantly lower than those of the wild type (WT) ( Figure 2 ).

[0090] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Therefore, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the scope of protection of the technical solution of the present invention.

Claims

1. An application of transcription factor OsLBD40 in rice breeding, characterized in that: The nucleotide sequence of the transcription factor OsLBD40 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The transcription factor OsLBD40 improves rice chalkiness, increases thousand-grain weight and increases the amylose content.

3. An overexpression vector, characterized in that: The overexpression vector comprises the transcription factor OsLBD40 according to claim 1.

4. A method for preparing the overexpression vector according to claim 3, characterized in that: The steps include: 1) Extracting genomic RNA from rice seeds at the filling stage; 2) Using the cDNA obtained by reverse transcription of the extracted genomic RNA as a template, primers were designed according to the sequence of OsLBD40 in rice gDNA, and PCR amplification was performed to obtain the target gene fragment; 3) Connecting the target gene fragment to the vector, transforming the connection product into competent cells, extracting the plasmid from the positive strain, and obtaining the overexpression vector.

5. The method according to claim 4, characterized in that The primers include an upstream primer shown in the nucleotide sequence SEQ ID NO.2 and a downstream primer shown in the nucleotide sequence SEQ ID NO.

3.

6. A recombinant Agrobacterium, characterized in that It has the overexpression vector according to claim 3.

7. A method for obtaining the recombinant Agrobacterium according to claim 6, characterized in that: include: The overexpression vector according to claim 3 is transformed into Agrobacterium to obtain recombinant Agrobacterium.

8. Use of the overexpression vector according to claim 3 or the recombinant Agrobacterium according to claim 6 in rice breeding.

9. A method for obtaining transgenic rice, characterized in that: The transcription factor OsLBD40 according to claim 1 is introduced into rice plants.

10. The method for obtaining according to claim 9, characterized in that: The steps include: The recombinant Agrobacterium of claim 6 is used to infect rice callus tissue, followed by antibiotic screening and culture, followed by induction of differentiation and rooting, and T0 generation plants are obtained after seedling hardening, and T1 generation transgenic seedlings are obtained after T0 generation seeds germinate.

Images