Gene detection method for porcine epidemic diarrhea virus

Abstract

The invention provides a gene detection method of a porcine epidemic diarrhea virus. The gene detection method is an RAA-CRISPR / Cas12a-LFD detection method established by combining a recombinase-mediated isothermal amplification (RAA) technology with a gene editing tool CRISPR / Cas system through a screened primer probe combination. The screened RAA primer pair can effectively amplify target fragments, and has high specificity and higher sensitivity. A rapid and visual nucleic acid detection method of PEDV is established, in the detection method, an ssDNA probe with an FAM fluorophore is added, green fluorescence is emitted after the probe is cut and reported through Cas12a, and the detection result can be seen by naked eyes under a blue light lamp / ultraviolet lamp. The method disclosed by the invention is high in sensitivity, high in amplification speed, short in reaction time, efficient, simple and convenient, free of complex instruments and equipment, visible in detection result and suitable for on-site rapid detection of the porcine epidemic diarrhea virus.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection of pathogenic microorganisms, and specifically relates to a gene detection method for porcine epidemic diarrhea virus. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) is one of the main pathogens causing diarrhea in pigs. Porcine epidemic diarrhea (PED) caused by PEDV is an acute intestinal infectious disease characterized by intractable diarrhea, dehydration and vomiting. The disease only occurs in pigs, and pigs of all ages are susceptible. The incidence rate is high in suckling piglets, fattening pigs or growing pigs, and the mortality rate is extremely high. The virus is very similar to infections with transmissible gastroenteritis virus (TGEV) and porcine rotavirus (PoRV), and it is difficult to distinguish them by clinical symptoms.

[0003] At present, technologies such as real-time fluorescence quantitative RT-PCR, RT-PCR, indirect immunofluorescence (IFA), enzyme-linked immunosorbent assay (ELISA) and loop-mediated isothermal amplification (LAMP) have been widely used in the detection of PEDV. However, the existing detection methods have high requirements on equipment, personnel and environment, and have disadvantages such as cumbersome operation process and long time consumption, which are not suitable for on-site detection at the grassroots level.

[0004] Although the source of recombinase in recombinase-mediated isothermal amplification (RAA) is wider, compared with other nucleic acid detection technologies, RAA has the advantages of short time consumption, simple operation and weak equipment dependence, and is suitable for rapid on-site detection at the grassroots level. At present, this method has been applied to the detection of various infectious pathogens such as ASFV, PCV2, PCV3, and feline coronavirus. However, RAA technology still has certain limitations, such as the need for product purification before AGE detection, otherwise non-specific amplification is prone to occur. Summary of the invention

[0005] One of the purposes of the present invention is to provide a method for detecting porcine epidemic diarrhea virus, by combining the recombinase-mediated isothermal amplification technology RAA with the gene editing tool CRISPR / Cas system through a screened primer probe combination to establish a RAA-CRISPR / Cas12a-LFD detection method.

[0006] The present invention first provides a RAA primer pair for detecting porcine epidemic diarrhea virus, wherein the primer pair comprises:

[0007] PEDV-RAA-4F: 5′-AAATTCTCTCAACAGCTCCCCAGTGTAGTT-3′ (SEQ ID NO: 1),

[0008] PEDV-RAA-4R: 5′-CTCCTCTGTTCTGAGAAGCTCCACGACCC-3′ (SEQ ID NO: 2);

[0009] The sequence of the nucleic acid fragment amplified by the primer pair of the present invention is SEQ ID NO: 3. AAATTCTCTCAACAGCTCCCCAGTGTAGTTGAGATTGTTGAACCTAACACACCTCCTGCTTCACGTACAAATTCGCGTAGCAGGAGTCGTGGCAATGGCAACAACAGGTCCAGATCTCCGAGTAACAACAGAGGCAACAACCAGTCCCGTGGTAATTCACAGAATCGTGGAAATAACCAGGGTCGTGGAGCTTCTCAGAACAGAGGAG.

[0010] In another aspect, the present invention further provides a kit for detecting porcine epidemic diarrhea virus, comprising the above-mentioned primer pair, ssDNA probe, crRNA and Cas12a protein;

[0011] The ssDNA probe has a nucleotide sequence of TTATT;

[0012] Furthermore, the ssDNA probe is labeled with a fluorescent group and a quenching group at both ends, respectively; for example, the 5′ end is labeled with a biotin group, and the 3′ end is labeled with a quenching group BHQ1.

[0013] The crRNA is an RNA molecule, and its sequence is UAAUUUCUACUAAGUGUAGAUCACGATTCTGTGAATTACCACGG (SEQ ID NO: 4).

[0014] Furthermore, the kit also includes an LFD test strip, on which a FITC antibody corresponding to the fluorescent group of the ssDNA probe is carried.

[0015] Furthermore, in the kit, the optimal concentration ratio of Cas12a protein and crRNA is 100nM:200nM.

[0016] In another aspect, the present invention also provides a method for detecting porcine epidemic diarrhea virus for non-disease treatment purposes, which uses the kit for detection;

[0017] Furthermore, the method comprises using the cDNA of the sample to be tested as a template, using the above-mentioned RAA primer pair to perform RAA reaction to obtain an amplification product; using the above-mentioned ssDNA probe and the above-mentioned crRNA to perform CRISPR / Cas12a reaction on the amplification product to obtain a reaction product; and determining whether the sample to be tested contains porcine epidemic diarrhea virus based on the fluorescence of the reaction product.

[0018] The method of determining whether the sample to be tested contains porcine epidemic diarrhea virus based on the fluorescence of the reaction product is to observe the reaction product under a blue light lamp / ultraviolet lamp (wavelength of 440-460nm / 400nm). If the reaction product produces green fluorescence, the sample to be tested contains porcine epidemic diarrhea virus. If the reaction product does not produce color fluorescence, the sample to be tested does not contain porcine epidemic diarrhea virus.

[0019] Furthermore, the concentration of the ssDNA probe or ssDNA-LFD probe in the CRISPR / Cas12a reaction system is 100 nM; the concentration of crRNA in the CRISPR / Cas12a reaction system is 200 nM; the concentration of Cas12a protein in the CRISPR / Cas12a reaction system is 100 nM.

[0020] Optionally, according to the above method, the system volume of the CRISPR / Cas12a reaction is 50 μL, the concentration of the ssDNA probe or ssDNA-LFD probe is 50nM-250nM, for example, 100nM, the crRNA concentration is 50nM-250nM, for example, 200nM, and the Cas12a protein concentration is 50nM-250nM, for example, 100nM.

[0021] The RAA reaction conditions may be 37-42° C. for 25 min-40 min, and the CRISPR / Cas12a reaction conditions may be 37° C. for 15 min-30 min, for example, 37° C. for 30 min. The LFD test strip reaction conditions described above may be 20-42° C. for 20 min-35 min.

[0022] The RAA primer pair screened by the present invention can effectively amplify the target fragment, has a high degree of specificity, and has higher sensitivity. The present invention combines RAA nucleic acid amplification technology, CRISPR / Cas12a detection system, and lateral flow test strip LFD technology to establish a rapid visualization nucleic acid detection method for PEDV. In the detection method of the present invention, a ssDNA probe with a FAM fluorescent group is added, and green fluorescence is emitted after Cas12a cuts the reporter probe, and the test result is visible to the naked eye under a blue light / ultraviolet light (440-460nm / 400nm). In the detection method of the present invention, a ssDNA-LFD probe with a FAM fluorescent group is added, and a detection line appears by LFD test strip detection after Cas12a cutting. Compared with traditional RT-PCR detection, the method of the present invention has high sensitivity, fast amplification speed, short reaction time, high efficiency and simplicity, does not require complex instruments and equipment, and the test results are visible to the naked eye, which is suitable for on-site rapid detection of porcine epidemic diarrhea virus. It solves the key technical problem that PED is difficult to diagnose at the epidemic and quarantine sites due to similar clinical symptoms and needs to be sent to the laboratory for differential diagnosis. It provides a basis for grassroots veterinary departments to conduct early diagnosis and timely prevention and control of the disease, which is of great significance for preventing and controlling the occurrence and spread of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the result of RAA primer screening.

[0024] Figure 2 This is a graph showing the optimization results of Cas12a / crRNA concentration.

[0025] Figure 3 This is a graph showing the specificity validation results of the method for detecting porcine epidemic diarrhea virus provided in Example 2, wherein 1-8: TGEV, PoRV, PRRSV, PCV2, PCV3, PCV4, CSFV, PRV, 9: positive control, 10: negative control;

[0026] Figure 4 This is a graph showing the specificity validation results of the method for detecting porcine epidemic diarrhea virus provided in Example 3; wherein 1: positive control, 2-9: TGEV, PoRV, PRRSV, PCV2, PCV3, PCV4, CSFV, PRV, 10: negative control.

[0027] Figure 5 The sensitivity verification result diagram of the method for detecting porcine epidemic diarrhea virus provided in Example 4, wherein 1-5: 2.45×10 2 , 1.24×10 2 , 6.2×10 1 , 3.1×10 1 , 1.5×10 1copies / μL of pMD19T-PEDV-N plasmid standard; 6: negative control.

[0028] Figure 6 The sensitivity verification result diagram of the method for detecting porcine epidemic diarrhea virus provided in Example 5, 1-5: 2.45×10 2 , 1.24×10 2 , 6.2×10 1 , 3.1×10 1 , 1.5×10 1 copies / μL of pMD19T-PEDV-N plasmid standard; 6: negative control. Specific implementation methods

[0030] The present invention combines RAA technology with CRISPR to give full play to the high amplification of RAA and the high specificity of CRISPR. The detection limit can reach 1 copies / μL, and the characteristics are extremely high. The amplified product presents the detection result through a lateral flow dipstick (LFD), which is more suitable for on-site rapid detection at the grassroots level.

[0031] The present invention is further described in detail below in conjunction with specific embodiments. Unless otherwise specified, all conventional methods are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources. The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0032] Example 1: Establishment of a method for detecting porcine epidemic diarrhea virus

[0033] 1. Design of RAA Primers

[0034] 1. Using the relatively conservative PEDV N gene as a template, we searched for CrRNA-guided PAM sequences in the conservative region of the N gene, and designed primers upstream and downstream of the potential PAM sequences. The length of RAA primers is generally 18-25 bp. Primers that are too short are prone to nonspecific amplification. We lengthened the primer length to about 30 bp to reduce the generation of nonspecific amplification. A total of 8 primers were designed (as shown in Table 1).

[0035] Table 1: Sequence list of PEDV RAA detection primers

[0036]

[0037] 2. Combine the 8 primers designed in step 1 into 4 pairs of primer combinations (as shown in Table 2).

[0038] Table 2: PEDV detection primer combination information

[0039]

[0040] 2. Screening of the best primer combination

[0041] 1. Taking the copy number as 1×10 5 The pMD19T-PEDV-N plasmid standard with a concentration of copies / μL was used as the cDNA template.

[0042] 2. Using the cDNA obtained in step 1 as a template, the four primer combinations shown in Table 2 were used to perform RAA reactions respectively.

[0043] The configuration method of the RAA reaction system is as follows:

[0044] Add 2.5 μL of magnesium acetate to the lid of the reaction unit tube, and add 25.0 μL of basic RAA buffer (B00000A, Qitian Gene Biotechnology Co., Ltd.), 17.5 μL of ddH2O, 2.0 μL of each upstream and downstream primers (10 μmol / L), and 1.0 μL of cDNA template into the reaction unit tube in sequence.

[0045] Close the tube cap and mix using a constant temperature oscillating mixer.

[0046] The reaction system was placed in a metal bath at 37°C-42°C for 30 min.

[0047] 3. After completing step 2, mix 50 μL of the reaction product with an equal volume of a mixture of Tris-saturated phenol and chloroform (Tris-saturated phenol: chloroform = 1:1, volume ratio), centrifuge at 12000 rpm for 10 min, take 5 μL of the supernatant product after centrifugation and subject it to 2% agarose gel electrophoresis, and observe the results on a gel imaging system.

[0048] The results showed that the primer pair (F4 and R4) had the clearest and most specific bands and was the best primer combination for detecting porcine epidemic diarrhea virus ( Figure 1 ), the amplified band size was 208 bp, and the sequence of the amplified fragment was SEQ ID NO: 3.

[0049] 3. Design, screening and synthesis of PEDV cr RNA

[0050] 1. Based on the fragment amplified by RAA, a crRNA was designed in combination with the characteristics of LbCas12a recognizing the 5′-TTTN-3′PAM sequence.

[0051] 2. Synthesize two oligonucleotide chains T7-crRNA-F and PEDV-crRNA1-R (sequences as shown in Table 3) of crRNA1 transcription template, obtain dry powdered synthesis of the two oligonucleotide chains, dissolve them in 1x annealing buffer (Solarbio, Beijing, China) to a concentration of 10 μmol / L, mix equal volumes, denature at 95 ° C for 2 min, slowly cool to 25 ° C, and cool for no less than 45 min to anneal to form double-stranded DNA.

[0052] 3. Using the above double-stranded DNA as a template, in vitro transcription and purification were performed to obtain PEDV crRNA1 (sequence as shown in Table 4).

[0053] Table 3: Nucleotide sequence used to synthesize PEDV crRNA1 transcription template and its transcription product PEDV crRNA1 sequence information table

[0054]

[0055] 4. Determination of the optimal concentration of Cas12a protein / crRNA in the reaction system

[0056] 1. Set different final concentrations of Cas12a / crRNA, namely 50nM / 50nM, 50nM / 100nM, 50nM / 150nM, 50nM / 200nM, 50nM / 250nM, 100nM / 50nM, 100nM / 100nM, 100nM / 150nM, 100nM / 200nM, 100nM / 250nM, 150nM / 50nM, 150nM / 100nM, 1 50nM / 150nM, 250nM / 200nM, 150nM / 250nM, 200nM / 50nM, 200nM / 100nM, 200nM / 150nM, 200nM / 200nM, 200nM / 250nM, 250nM / 50nM, 250nM / 100nM, 250nM / 150nM, 250nM / 200nM, 250nM / 250nM other reaction components remained unchanged.

[0057] 2. Using pMD19T-PEDV-N plasmid standard as template, ssDNA labeled with FAM fluorescent group and BHQ-1 quenching group as probe, and specific PEDV-crRNA1 for CRISPR / Cas12a reaction.

[0058] Prepare 50 μL of CRISPR / Cas12a detection system, the components are as follows:

[0059] Different concentration ratios of LbaCas12a(Cpfl) (Z03502, GenCRISPR TM Cas12a (Cpf1) Nuclease, Nanjing GenScript Biotechnology Co., Ltd.) and PEDV-crRNA1, 5 μL 10×Cas12a Reaction Buffer, 2 μL of the above-mentioned pMD19T-PEDV-N plasmid standard as a template, and 0.25 μL of 100 μM ssDNA probe. After reacting at 37°C for 30 min, the detection results were directly observed under blue light / ultraviolet light (wavelength of 440-460 nm / 400 nm).

[0060] The results are as follows Figure 2 The results show that when the concentration of Cas12a / crRNA is 100nM / 200nM, obvious green fluorescence is produced, and the gray value analysis shows that its fluorescence value is the brightest. Therefore, in this reaction system, the optimal concentration of Cas12a / crRNA is determined to be 100nM / 200nM.

[0061] Example 2: Establishment of a method for detecting porcine epidemic diarrhea virus

[0062] 1. Using the cDNA of the sample to be tested as a template, use the primer pair consisting of primer RAA-F4 and primer RAA-R4 to perform RAA reaction to obtain the amplified product. Set ddH2O as a negative control for the template.

[0063] The configuration method of the RAA reaction system is as follows:

[0064] Add 2.5 μL of magnesium acetate to the lid of the reaction unit tube, and add 25.0 μL of basic RAA buffer (B00000A, Qitian Gene Biotechnology Co., Ltd.), 17.5 μL of ddH2O, 2.0 μL of each upstream and downstream primers (10 μmol / L), and 1.0 μL of cDNA template into the reaction unit tube in sequence.

[0065] Close the tube cap, use a constant temperature oscillating mixer to oscillate and mix, and place the reaction system in a metal bath at 37°C-42°C for 30 minutes.

[0066] 2. Use the CRISPR / Cas12a reaction system to detect the amplified product in step 1.

[0067] The optimized CRISPR / Cas12a detection system is 50 μL, and the components are as follows:

[0068] The final concentration was 100 nM LbaCas12a(Cpfl) (Z03502, GenCRISPR TMCas12a (Cpf1) Nuclease, Nanjing GenScript Biotechnology Co., Ltd.), PEDV-crRNA1 with a final concentration of 200nM, 5μL 10×Cas12a Reaction Buffer, 2μL amplification product from step 1, 0.25μL 100μM ssDNA probe. After reacting at 37℃ for 30 minutes, the detection results were directly observed under blue light / ultraviolet light (wavelength of 440-460nm / 400nm).

[0069] If the reaction product produces green fluorescence, the sample to be tested contains porcine epidemic diarrhea virus; if the reaction product does not produce green fluorescence, the sample to be tested does not contain porcine epidemic diarrhea virus.

[0070] 3. RAA-CRISPR / Cas12a-LFD method for detecting porcine epidemic diarrhea virus

[0071] 1) Using the cDNA of the sample to be tested as a template, a primer pair consisting of primer RAA-F4 and primer RAA-R4 was used to perform RAA reaction to obtain an amplification product; ddH2O was set as a negative control of the template.

[0072] The configuration method of the RAA reaction system is as follows:

[0073] Add 2.5 μL of magnesium acetate to the lid of the reaction unit tube, and add 25.0 μL of basic RAA buffer (B00000A, Qitian Gene Biotechnology Co., Ltd.), 17.5 μL of ddH2O, 2.0 μL of upstream and downstream primers (10 μmol / L), and 1.0 μL of cDNA template into the reaction unit tube in sequence; close the tube lid, use a constant temperature oscillating mixer to oscillate and mix, and place the reaction system in a metal bath at 37°C-42°C for 30 minutes.

[0074] 2) Use the CRISPR / Cas12a reaction system to detect the amplified product in step 1.

[0075] The optimized CRISPR / Cas12a detection system is 50 μL, and the components are as follows:

[0076] The final concentration was 100 nM LbaCas12a(Cpfl) (Z03502, GenCRISPR TMCas12a (Cpf1) Nuclease, Nanjing GenScript Biotechnology Co., Ltd.), PEDV-crRNA1 with a final concentration of 200nM, 5μL 10×Cas12aReaction Buffer, 2μL amplification product of step 1, 0.25μL 100μM concentration of ssDNA-LFD probe. After reacting at 37℃ for 30min, 10μL of the above reaction product was added to 40μL sterile water for dilution, and the LFD test strip (TS104, lateral flow test strip (CRISPR), Jiangsu Xinda Gene Technology Co., Ltd.) was inserted into the diluted reaction product with the binding pad end, and reacted at 25℃ for 30min.

[0077] If a detection line appears on the LFD test strip, the sample to be tested contains porcine epidemic diarrhea virus; if no detection line appears on the LFD test strip but a quality control line appears, the sample to be tested does not contain porcine epidemic diarrhea virus; if neither a detection line nor a quality control line appears on the LFD test strip, the test fails.

[0078] Example 3: Specificity evaluation of RAA-CRISPR / Cas12a method for detecting porcine epidemic diarrhea virus

[0079] 1. Extract nucleic acid from positive samples of porcine transmissible gastroenteritis (TGEV), porcine rotavirus (PoRV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), porcine circovirus type 4 (PCV4), classical swine fever virus (CSFV), and pseudorabies virus (PRV) and reverse transcribe them into cDNA as template. The copy number was 6.2×10 1 The pMD19T-PEDV-N plasmid standard with 100 copies / μL was used as the positive control, and sterile water was used as the negative control.

[0080] 2. Use the method for detecting porcine epidemic diarrhea virus established in Example 2 for detection.

[0081] 3. Test results such as Figure 3 As shown, the results showed that only the reaction product of the PEDV positive control showed obvious green fluorescence, and the samples infected with other control viruses and the negative control did not produce green fluorescence, thereby proving that the detection method designed by the present invention has a high specificity.

[0082] Example 4: Specificity evaluation of RAA-CRISPR / Cas12a-LFD method for detecting porcine epidemic diarrhea virus

[0083] 1. Extract nucleic acid from positive samples of porcine transmissible gastroenteritis (TGEV), porcine rotavirus (PoRV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), porcine circovirus type 4 (PCV4), classical swine fever virus (CSFV), and pseudorabies virus (PRV) and reverse transcribe them into cDNA as template. The copy number was 6.2×10 1 The pMD19T-PEDV-N plasmid standard with 100 copies / μL was used as the positive control, and sterile water was used as the negative control.

[0084] 2. Use the porcine epidemic diarrhea virus detection method to detect the test results. Figure 4 As shown, the results show that only the LFD test strip of the PEDV positive control has a detection line, while the samples infected with other control viruses and the negative control have no detection lines and appear, which proves that the detection method designed by the present invention has a high specificity.

[0085] Example 5. Sensitivity evaluation of RAA-CRISPR / Cas12a method for detecting porcine epidemic diarrhea virus

[0086] 1. With a copy number of 2.45×10 2 The pMD19T-PEDV-N plasmid standard with a concentration of copies / μL was used as the cDNA template.

[0087] 2. Use ddH2O to dilute the cDNA template in step 1 in a 2-fold gradient to 2.45×10 2 copies / μL, 1.24×10 2 copies / μL, 6.2×10 1 copies / μL、3.1×10 1 copies / μL, 1.5×10 1 There are 5 dilutions per μL.

[0088] 3. The pMD19T-PEDV-N plasmid standards of different dilutions obtained in step 2 were detected using the method for detecting porcine epidemic diarrhea virus in Example 1.

[0089] The results are as follows Figure 5 As shown, lanes 1-5 represent the copy number of 2.45×10 2 copies / μL, 1.24×10 2 copies / μL, 6.2×10 1 copies / μL、3.1×10 1 copies / μL, 1.5×10 1copies / μL of pMD19T-PEDV-N plasmid standard; 6 was a negative control; the results showed that the sensitivity of this method was 3.1×10 1 copies / μL.

[0090] Example 6: Evaluation of the sensitivity of the RAA-CRISPR / Cas12a-LFD method for detecting porcine epidemic diarrhea virus

[0091] 1. With a copy number of 2.45×10 2 The pMD19T-PEDV-N plasmid standard with a concentration of copies / μL was used as the cDNA template.

[0092] 2. Use ddH2O to dilute the cDNA template in step 1 in a 2-fold gradient to 2.45×10 2 copies / μL, 1.24×10 2 copies / μL, 6.2×10 1 copies / μL、3.1×10 1 copies / μL, 1.5×10 1 There are 5 dilutions per μL.

[0093] The pMD19T-PEDV-N plasmid standards of different dilutions obtained in step 2 were detected using the method for detecting porcine epidemic diarrhea virus.

[0094] The results are as follows Figure 6 As shown, 1-5 has a copy number of 2.45×10 2 copies / μL, 1.24×10 2 copies / μL, 6.2×10 1 copies / μL、3.1×10 1 copies / μL, 1.5×10 1 copies / μL of pMD19T-PEDV-N plasmid standard; 6 was a negative control. The results showed that the sensitivity of this method was 3.1×10 1 copies / μL.

[0095] In summary, the method of the present invention can detect porcine epidemic diarrhea virus with high sensitivity and specificity.

Claims

1. A RAA primer pair for detecting porcine epidemic diarrhea virus, characterized in that: The sequence of the upstream primer of the primer pair is SEQ ID NO: 1, and the sequence of the downstream primer is SEQ ID NO:

2.

2. A kit for detecting porcine epidemic diarrhea virus, characterized in that: The kit comprises the RAA primer pair, ssDNA probe, crRNA and Cas12a protein according to claim 1.

3. The kit according to claim 2, characterized in that The ssDNA probe has a nucleotide sequence of TTATT.

4. The kit according to claim 3, wherein The two ends of the ssDNA probe are respectively labeled with a fluorescent group and a quenching group.

5. The kit according to claim 2, characterized in that The crRNA is an RNA molecule, and its sequence is SEQ ID NO:

4.

6. The kit according to claim 2, characterized in that The kit also includes an LFD test strip, on which a FITC antibody corresponding to the fluorescent group of the ssDNA probe is carried.

7. A method for detecting porcine epidemic diarrhea virus for non-disease treatment purposes, characterized in that: The method is to use the kit described in claim 2 for detection.

8. The method according to claim 7, characterized in that The method comprises using the cDNA of the sample to be tested as a template, performing RAA reaction using an RAA primer pair to obtain an amplification product; performing CRISPR / Cas12a reaction on the amplification product using an ssDNA probe and crRNA to obtain a reaction product; and determining whether the sample to be tested contains porcine epidemic diarrhea virus according to the fluorescence of the reaction product; the method of determining whether the sample to be tested contains porcine epidemic diarrhea virus according to the fluorescence of the reaction product is to observe the reaction product under a blue light / ultraviolet light, if the reaction product produces green fluorescence, the sample to be tested contains porcine epidemic diarrhea virus, and if the reaction product does not produce color fluorescence, the sample to be tested does not contain porcine epidemic diarrhea virus.

9. The method according to claim 8, characterized in that The concentration of the ssDNA probe in the CRISPR / Cas12a reaction system is 100 nM, and the concentration of the crRNA is 200 nM; the concentration of the Cas12a protein in the CRISPR / Cas12a reaction system is 100 nM.

10. The method according to claim 8, characterized in that The conditions for the RAA reaction are 37-42° C. for 25 min-40 min, and the conditions for the CRISPR / Cas12a reaction are 37° C. for 15 min-30 min.

Images