RPA-Cas12a one-step detection system and application thereof

Abstract

The invention relates to the field of molecular diagnosis, in particular to an RPA-Cas12a one-step detection system and application thereof. The invention finds that heparin sodium has cleavage activity for inhibiting LbCas12a, and develops a one-step nucleic acid detection method compatible with RPA amplification and Cas12 detection based on the inhibition effect. The detection limit of the method reaches 0.6 (copy / microliter), and the method can be expanded to other two Cas12 subtype proteins, namely AsCas12a and AapCas12b. In the detection of monkey pox virus, influenza A virus and new coronavirus as examples, compared with quantitative PCR, the detection sensitivity and specificity of the method both reach 95% or above. The CRISPR one-step nucleic acid detection method has the advantages of high sensitivity and specificity, short detection time and the like, and the potential nucleic acid aerosol pollution risk of a traditional two-step nucleic acid detection method is removed.

Description

Technical Field

[0001] The present invention relates to the field of molecular diagnosis, and in particular to an RPA-Cas12a one-step detection system and applications thereof. Background Art

[0002] Rapid and highly sensitive nucleic acid detection is essential for public health, environmental monitoring, and food safety. However, traditional isothermal amplification methods, including recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), and rolling circle amplification (RCA), often lead to inaccurate results due to insufficient specificity and sensitivity. CRISPR technology, originally used for gene editing, has gradually been applied to molecular diagnosis after the discovery of the trans-cleavage activity of Cas12, Cas13, and Cas12a. Taking Cas12 as an example, it can specifically recognize and cleave the target nucleic acid (cis cleavage), and then indiscriminately cleave the surrounding single-stranded DNA (trans cleavage). By modifying the end of ssDNA with fluorescent / quenching or fluorescent / biotin groups, the target nucleic acid information can be converted into a fluorescent signal or detected using a colorimetric lateral flow test strip. The current mainstream CRISPR-Dx method uses this mechanism to amplify nucleic acids through RPA, LAMP, or RCA, and then introduces Cas proteins, crRNA, and fluorescent probes for detection. This method of combining the CRISPR system with isothermal amplification significantly improves the sensitivity and specificity of nucleic acid detection. CRISPR-Dx technology based on isothermal amplification has made significant progress, but its application in POCT still faces challenges. A major obstacle is the high limit of detection (LoD) caused by the extremely high cis-cleavage activity of Cas12, that is, in RPA-Cas12a combined nucleic acid detection, the excessive cis-cleavage activity of Cas12a may destroy trace nucleic acid templates, prevent RPA amplification, and thus fail to produce significant fluorescent signals.

[0003] Studies have shown that the classic RPA-Cas12a detection method mainly consists of a two-step process including initial amplification and subsequent addition of CRISPR components. However, this two-step reaction requires opening the reaction tube and performing pipetting operations, which complicates the detection process. In addition, the liquid transfer step is prone to aerosol contamination, leading to false positive results and affecting subsequent detection. Therefore, there is an urgent need to develop a universal one-step nucleic acid detection method that is compatible with RPA amplification and Cas12a detection. Summary of the invention

[0004] In view of this, the present invention provides an RPA-Cas12a one-step detection system and its application. The present invention provides the application of sodium heparin in inhibiting Cas12 cleavage activity, an RPA-Cas12a one-step detection system and its application. The present invention has experimentally found that the CRISPR one-step nucleic acid detection method of the present invention has the advantages of high sensitivity and specificity, fast detection time, etc., and eliminates the potential nucleic acid aerosol contamination risk of the traditional two-step nucleic acid detection method. .

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides the use of heparin sodium in inhibiting the cleavage activity of Cas12; the subtypes of Cas12 include one or more of LbCas12a, AsCas12a or AapCas12b.

[0007] In some specific embodiments of the present invention, the concentration of heparin sodium is 2-40 μg / mL.

[0008] The present invention also provides an RPA-Cas12a one-step detection system, comprising an RPA amplification primer, crRNA, Cas12, an FQ-ssDNA reporter molecule and heparin sodium; the crRNA has any one or more nucleotide sequences shown in SEQ ID NO.6 to 13.

[0009] In some specific embodiments of the present invention, the RPA amplification primer has any one or more nucleotide sequences as shown in SEQ ID NOs. 14-23.

[0010] In some specific embodiments of the present invention, the subtype of Cas12 includes one or more of LbCas12a, AsCas12a or AapCas12b.

[0011] In some specific embodiments of the present invention, the RPA-Cas12a one-step detection system also includes RPA particles.

[0012] In some specific embodiments of the present invention, the RPA-Cas12a one-step detection system further includes buffer A and buffer B, and the RPA particles, the buffer A, and the buffer B are purchased from Anpu Future Biotech Co., Ltd.

[0013] The present invention also provides the application of the RPA-Cas12a one-step detection system in any of the following items:

[0014] (I) rapid on-site detection of nucleic acid molecules; and / or

[0015] (II) Preparation of products for rapid on-site detection of infectious disease pathogens; and / or

[0016] (III), inhibiting Cas12 cleavage activity; and / or

[0017] (IV) Improving the sensitivity and / or specificity of RPA-Cas12a detection.

[0018] In some specific embodiments of the present invention, the product comprises a biosensor, a reagent, a test paper or a kit.

[0019] In some specific embodiments of the present invention, the nucleic acid molecule includes genes of monkeypox virus, influenza A virus or new coronavirus.

[0020] In some specific embodiments of the present invention, the amplification targets of the monkeypox virus are f3l (SEQ ID NO.2) and b6r (SEQ ID NO.3); the amplification target of the influenza A virus is the M2 protein encoding gene (SEQ ID NO.4); and the amplification target of the new coronavirus is the N protein encoding gene (SEQ ID NO.5).

[0021] In some specific embodiments of the present invention, when the subtype of Cas12 is LbCas12a, the crRNA of the f31 is detected to have a nucleotide sequence as described in SEQ ID NO.6; the crRNA of the b6r is detected to have a nucleotide sequence as described in SEQ ID NO.7; the crRNA of the M2 protein encoding gene is detected to have a nucleotide sequence as described in SEQ ID NO.8; the crRNA of the N protein encoding gene is detected to have a nucleotide sequence as described in SEQ ID NO.9;

[0022] When the subtype of the Cas12 is AsCas12a, the crRNA of the f31 is detected to have a nucleotide sequence as described in SEQ ID NO.10; the crRNA of the b6r is detected to have a nucleotide sequence as described in SEQ ID NO.11;

[0023] When the subtype of the Cas12 is AapCas12a, the crRNA of the f3l is detected to have a nucleotide sequence as described in SEQ ID NO.12; the crRNA of the b6r is detected to have a nucleotide sequence as described in SEQ ID NO.13.

[0024] In some specific embodiments of the present invention, the RPA amplification primers for amplifying the f3l have nucleotide sequences as shown in SEQ ID NOs.14 to 15; the RPA amplification primers for amplifying the b6r have nucleotide sequences as shown in SEQ ID NOs.16 to 17; the RPA amplification primers for amplifying the M2 protein encoding gene have nucleotide sequences as shown in SEQ ID NOs.18 to 20; and the RPA amplification primers for amplifying the N protein encoding gene have nucleotide sequences as shown in SEQ ID NOs.21 to 23.

[0025] The present invention also provides a product for rapid on-site detection of nucleic acid molecules, including the RPA-Cas12a one-step detection system.

[0026] The present invention also provides a method for rapid detection of nucleic acid molecules, comprising the following steps: taking a sample to be tested, incubating it with the RPA-Cas12a one-step detection system, determining the fluorescence signal value, and setting the threshold to be the fluorescence value of the negative control plus three times its standard deviation; samples exceeding this threshold are classified as positive, and samples below this threshold are considered negative.

[0027] In some specific embodiments of the present invention, the incubation temperature comprises 37°C.

[0028] The present invention provides the following beneficial effects:

[0029] The present invention finds that heparin sodium has the ability to inhibit the cleavage activity of LbCas12a, and based on this inhibitory effect, develops a one-step nucleic acid detection method that is compatible with RPA amplification and Cas12 detection. Its detection limit reaches 0.6 (copy / microliter), and the method can be extended to two other Cas12 subtype proteins: AsCas12a and AapCas12b. In the detection of monkeypox virus, influenza A virus and new coronavirus as examples, compared with quantitative PCR, the detection sensitivity and specificity of this method reached more than 95%. The CRISPR one-step nucleic acid detection method of the present invention has the advantages of high sensitivity and specificity, fast detection time, and eliminates the potential risk of nucleic acid aerosol contamination in the traditional two-step nucleic acid detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0031] Figure 1Figure 2 shows the characterization of the cis-cleavage activity of LbCas12a inhibited by heparin sodium; wherein, a shows the fluorescence characterization of the cis-cleavage activity of LbCas12a targeting f3l or b6r by crRNA in the presence of 2 μg / mL heparin sodium; b shows the fluorescence intensity of LbCas12a cis-cleavage of crRNA targeting f3l or b6r at 60 minutes in the presence of 2 μg / mL heparin sodium;

[0032] Figure 2 The figure shows the characterization of the constructed one-step nucleic acid detection method when targeting f3l and b6r genes; wherein, a shows a schematic diagram of the one-step detection method, in which RPA amplification and Cas12a-mediated fluorescence detection are performed simultaneously in a single tube; b to d show the detection limit characterization of the RPA-Cas12a one-step detection method targeting f3l gene at 0, 0.1, 1, 10, 100, 1000, and 10000 aM concentrations under the conditions of no heparin sodium (b) and with heparin sodium (c), as well as qPCR (d); the p value is the comparison of the fluorescence intensity at 20 minutes with and without the addition of 40 μg / mL heparin sodium; e to g show the detection limit characterization of the RPA-Cas12a one-step method targeting b6r without (e) and with (f) 40 μg / mL heparin sodium or qPCR (g);

[0033] Figure 3 The figure shows the characterization of a one-step nucleic acid detection method with AsCas12a and AapCas12b as the core when targeting f3l and b6r genes; wherein, a shows a schematic diagram of the one-step detection of various Cas12 proteins enhanced by sodium heparin; b shows the characterization of a one-step detection method targeting f3l or b6r when AsCas12a replaces LbCas12a; c shows the characterization of a one-step detection method targeting f3l or b6r when AapCas12b replaces LbCas12a;

[0034] Figure 4Figure 2 shows the characterization of the constructed one-step nucleic acid detection method when targeting the M2 protein encoding gene; a-c show the detection limit analysis of the RPA-Cas12a one-step detection method for the synthetic M2 protein encoding gene (DNA) under the conditions of (a) and (b) 40 μg / mL heparin sodium and (c), and the target concentration is 0, 0.1, 1, 10, 100, 1000, 10000aM; d-f show the RT-RPA-Cas12a one-step detection method Analysis of the detection limit of the transcribed mRNA target without (d) and with (e) 10 μg / mL heparin sodium and RT-qPCR (f), with target concentrations of 0, 0.1, 1, 10, 100, 1000, and 10000 aM; g is a schematic diagram of the detection of human saliva and sputum samples; h is a diagram of the analysis of 33 patient samples using RT-qPCR and the one-step detection method; i is a diagram of the specificity and sensitivity of sample detection using the one-step detection method;

[0035] Figure 5 Figure 2 shows the characterization of the constructed one-step nucleic acid detection method when targeting the N protein encoding gene; wherein, a to c show the detection limit analysis of the synthetic N protein encoding gene (DNA) by the RPA-Cas12a one-step detection method without (a) and with (b) 40 μg / mL heparin sodium and qPCR (c), and the target concentrations are 0, 0.1, 1, 10, 100, 1000, and 10000 aM; d to f show the detection limit analysis of the synthetic N protein encoding gene (DNA) by the RT-RPA-Cas12a one-step detection method. Analysis of the detection limit of the detection method for the transcribed mRNA target in the absence (d) and presence (e) of 10 μg / mL heparin sodium and RT-qPCR (f), with target concentrations of 0, 0.1, 1, 10, 100, 1000, and 10000 aM; g is a schematic diagram of SARS-CoV-2 detection in wastewater samples from 10 provinces and cities in China; h is a schematic diagram of the analysis of all 25 influent samples and 25 effluent samples using RT-qPCR and a one-step detection method. DETAILED DESCRIPTION

[0036] The present invention discloses RPA-Cas12a one-step detection system and its application, and those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described by preferred embodiments, and relevant personnel can obviously change or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0037] The purpose of the present invention is to demonstrate the inhibitory effect of sodium heparin on the cleavage activity of Cas12, and based on this inhibitory effect, develop a one-step nucleic acid detection method that is compatible with RPA amplification and Cas12 detection. The method includes the following key steps: (a) preparing a one-step nucleic acid detection system and adding a certain concentration of sodium heparin; (b) performing RPA amplification and Cas12 detection at 37°C simultaneously; (c) using an instrument to measure the generated fluorescence to achieve high sensitivity and specificity detection of the sample.

[0038] It is also an object of the present invention to demonstrate the effectiveness of applying this detection method to the detection of clinical pathogens and sewage pathogens.

[0039] The Cas12 used in the present invention includes three subtypes, LbCas12a, AsCas12a and AapCas12b, wherein the LbCas12a protein coding sequence is synthesized by Sangon Biotech Co., Ltd., and the pure protein is obtained by protein expression and purification. AsCas12a and AapCas12b proteins were purchased from Tolo Biotechnology Co., Ltd.

[0040] The LbCas12a encoding gene of the present invention is from Lachnospiraceae bacterium ND2006, the AsCas12a encoding gene is from Acidaminococcus sp.BV3L6, and the AapCas12 encoding gene is from Alicyclobacillus acidiphilus.

[0041] The pathogens described in the present invention are monkeypox virus, influenza A virus and new coronavirus.

[0042] The f31 and b6r genes described in the present invention are conservative genes for detecting monkeypox virus.

[0043] The M2 protein encoding gene of the present invention is a conservative gene of influenza A virus.

[0044] The N (nucleocapsid) protein encoding gene described in the present invention is a conserved gene of the new coronavirus.

[0045] The LbCas12a protein encoding gene sequence of the present invention is shown in Table 1.

[0046] Table 1Cas12 encoding genes

[0047]

[0048]

[0049] The f31 and b6r genes, the M2 protein encoding gene and the N protein encoding gene of the present invention are shown in Table 2.

[0050] Table 2 Target gene sequences

[0051]

[0052]

[0053] The sequence of the detection crRNA used in the present invention is shown in Table 3.

[0054] Table 3 crRNA sequences

[0055]

[0056]

[0057] Note: Due to the reasons for sequence table preparation, when preparing a sequence table that meets the requirements of WIPOST.26 standard, the "U" in the same position is replaced by "T". The specific sequence information is subject to that shown in Table 3.

[0058] The RPA amplification primers used in the present invention and the primers used in (RT)-qPCR are shown in Table 4.

[0059] Table 4 Primer sequences

[0060] Primers Number DNA sequence f3l-RPA-1F SEQ ID NO.14 CCCGCGAAAAATCAATGAGAGAGGATCATAAGTC f3l-RPA-1R SEQ ID NO.15 TTCAATACGAAAAGACCAATCTCTCCTAGT b6r-RPA-1F SEQ ID NO.16 GGAATGATACTGTCACGTGTCCTAATGCGG b6r-RPA-1R SEQ ID NO.17 CCGTACAACTTATATACGAAACACCAATAACC M2-RPA-1F SEQ ID NO.18 CCCGTCAGGCCCCCTCAAAGCCGAGATCGC M2-RPA-1R SEQ ID NO.19 CCTAAAATCCCCTTAGTCAGAGGTGACAGGAT Reverse-M2-RPA-transcription SEQ ID NO.20 CAAAGCGTCTACGCTGCAGT covid-19-RPA-1F SEQ ID NO.21 CCTTAAATTCCCTCGAGGACAAGGCGTTCC covid-19-RPA-1R SEQ ID NO.22 CCAGTTCCTAGGTAGTAGAAATACCATCTTGG reverse-covid-19-transcription SEQ ID NO.23 GGAAGTCCAGCTTCTGGC f3l-qPCR-1F SEQ ID NO.24 TTACAGCTCCAACGATACTC f3l-qPCR-1R SEQ ID NO.25 TCTCTCATTGATTTTTCGCG b6r-qPCR-1F SEQ ID NO.26 AACATGTGTACGATCTAACG b6r-qPCR-1R SEQ ID NO.27 AGTTGCTTCTAACGATTCTA M2-qPCR-1F SEQ ID NO.28 CAAGACCAATCCTGTCACCTCTGAC M2-qPCR-1R SEQ ID NO.29 GCATTTTGGACAAAGCGTCTACG covid-19-qPCR-1F SEQ ID NO.30 GGGGAACTTCTCCTGCTAGAAT covid-19-qPCR-1R SEQ ID NO.31 CAGACATTTTGCTCTCAAGCTG

[0061] All fluorescent probes used in the present invention are shown in Table 5.

[0062] Table 5 Probe sequences

[0063]

[0064]

[0065] The regions where the wastewater samples collected by the present invention are located are shown in Table 6.

[0066] Table 6 Sampling locations

[0067] Sampling wastewater treatment plant City Province 1-3 Chengdu Sichuan 4-5 Xi'an Shaanxi 6-8 Qingdao Shandong 9-10 Jinzhou Liaoning 11-12 Luoyang Henan 13-15 Guangzhou Guangdong 16-18 Beijing Beijing 19-21 Sanhe Hebei 22-24 Kunming Yunnan 25 Wuxi Jiangsu

[0068] The beneficial effects of the present invention are as follows: The present invention develops a one-step nucleic acid detection method that is compatible with RPA amplification and Cas12 detection by utilizing the inhibitory effect of sodium heparin on the cleavage activity of LbCas12a. Its detection limit reaches 0.6 (copy / μl), and the method can be extended to two other Cas12 subtype proteins: AsCas12a and AapCas12b. In the detection of monkeypox virus, influenza A virus and new coronavirus as examples, compared with quantitative PCR, the detection sensitivity and specificity of this method reached more than 95%. The CRISPR one-step nucleic acid detection method of the present invention has the advantages of high sensitivity and specificity, fast detection time, and eliminates the potential risk of nucleic acid aerosol contamination of traditional two-step nucleic acid detection methods.

[0069] Unless otherwise specified, the RPA-Cas12a one-step detection system provided by the present invention and the raw materials and reagents used in its application can be purchased from the market.

[0070] The present invention will be further described below in conjunction with embodiments:

[0071] Example 1 Evaluation of the inhibitory effect of heparin sodium

[0072] (I) Material preparation

[0073] 1. Protein Purification

[0074] The expression plasmid pET28a-LbCas12a was transformed into Escherichia coli BL21 Rosetta (DE3). After overnight culture in 5mL Luria-Bertani (LB) medium, the bacteria were transferred to 3L fresh LB medium for further culture. The culture medium was incubated at 37°C and 220rpm until OD600 reached 0.8. 0.2mM isopropyl-β-D-1-thiogalactoside was subsequently added as an inducer and incubated at 16°C for 16 hours. After the cells were collected by centrifugation, they were resuspended in a buffer containing 50mMTris-HCl (pH 8.0) and 1.5MNaCl for ultrasonic treatment. The supernatant was purified by Ni-NTA agarose chromatography. The LbCas12a protein concentration was determined using a modified Bradford protein quantification kit (Sangon Biotech Co., Ltd.) with bovine serum albumin as the standard and stored at -80°C for standby use.

[0075] AsCas12a and AapCas12b were purchased from Tolo Biotechnology Co., Ltd. The protein coding gene sequence of LbCas12a is shown in Table 1.

[0076] LB medium formula: peptone, 10 g / L; yeast extract, 5 g / L; NaCl, 10 g / L.

[0077] 2.crRNA transcription

[0078] To prepare the transcription template for crRNA, two oligonucleotides were heated at 95°C for 4 minutes and then cooled to 4°C at a rate of 0.1°C per second. One of the oligonucleotides contained a T7 promoter sequence and the other contained a handle and a spacer sequence. These templates were incubated with T7 RNA polymerase at 37°C for 2 hours to synthesize the target crRNA. The transcripts were purified by digesting the DNA template with DNase I at 37°C and removing impurities using an RNA purification kit (Jianshi Biotechnology Co., Ltd.). The sequence of crRNA is shown in Table 3.

[0079] 3. Probe Polymerization

[0080] The single-stranded DNA carrying FAM (fluorescent group) at the 3' end and BHQ1 (quencher group) at the 5' end (as shown in Table 5) was heated to 95°C for 4 minutes and then cooled to 4°C at a rate of 0.1°C per second.

[0081] (II) Fluorescence characterization of inhibition of cis-cleavage activity of LbCas12a

[0082] 1. In the activity characterization experiment, 2.0 μg / mL sodium heparin (Sangon Biotechnology Co., Ltd., A603251-0001) was added to the Buffer-1 solution containing 50nM LbCas12a and 200nM crRNA. For the fluorescence characterization of cis-cleavage, 500nM pre-annealed DNA targets labeled with FAM and BHQ1 were added to the reaction system, and the fluorescence generated after cleavage was measured using the SpectraMax i3x multi-mode microplate reader. The results of the inhibition of LbCas12a cis-cleavage activity by sodium heparin using fluorescence characterization are shown in Figure 2. Figure 1 As shown, a shows the fluorescence characterization of the cis-cleavage activity of LbCas12a targeting f3l or b6r with crRNA in the presence of 2 μg / mL sodium heparin. b shows the fluorescence intensity of LbCas12a cis-cleavage of crRNA targeting f3l or b6r for 60 minutes in the presence of 2 μg / mL sodium heparin. When sodium heparin is contained in the system, the cis-cleavage activity of LbCas12a is significantly inhibited.

[0083] Buffer-1 formulation: 40 mM HEPES, 100 mM NaCl and 20 mM MgCl2 (pH 7.4).

[0084] Example 2 One-step detection limit characterization

[0085] 1. CRISPR One-step Detection Method

[0086] The f3l and b6r genes of monkeypox virus_USA_2022_MA001 were cloned into the pUC57 vector. After plasmid extraction, the plasmid concentration was determined and then gradient diluted to 0.1aM. All gradient dilution targets were detected at 37°C using the CRISPR one-step detection method. The experimental group was added with 40 μg / mL of sodium heparin (Sangon Biotechnology Co., Ltd., A603251-0001), and the control group was not added with sodium heparin. The detection limit results are shown in Figure 2 , as shown in Tables 7 to 10, wherein a is a schematic diagram of a one-step detection method, in which RPA amplification and Cas12a-mediated fluorescence detection are performed simultaneously in a single tube. b~d illustrate the detection limit characterization of the RPA-Cas12a one-step detection method targeting the f3l gene at concentrations of 0, 0.1, 1, 10, 100, 1000, and 10000aM under the conditions of sodium heparin (b) and sodium heparin (c), as well as qPCR (d). The p value is a comparison of the fluorescence intensity at 20 minutes with and without the addition of 40μg / mL sodium heparin. e~g illustrate the detection limit characterization of the one-step method of RPA-Cas12a targeting b6r without (e) and with (f) 40μg / mL sodium heparin or qPCR (g). It can be seen that the detection limit of the one-step detection method can be as low as 1aM (≈0.6 copies / microliter) only when sodium heparin is present. It was demonstrated that a rapid and sensitive one-step detection could be achieved based on the inhibitory effect of sodium heparin.

[0087] Table 7 Characterization of the detection limit of the RPA-Cas12a one-step detection method targeting the f3l gene at 0, 0.1, 1, 10, 100, 1000, and 10000 aM concentrations under the condition of sodium heparin

[0088] FLintensity(au) SD 0aM 8625.71 702.23 0.1aM 10329.64 108.56 1aM 19055.35 3519.03 10aM 100001.70 9498.10 100aM 130382.03 23641.81 1fM 202594.98 2447.21 10fM 208388.72 2574.91

[0089] Table 8 Characterization of detection limits of the targeted f3l gene at 0, 0.1, 1, 10, 100, 1000, and 10000 aM concentrations under qPCR conditions of the RPA-Cas12a one-step detection method

[0090] Ctvalue SD 10fM 21.28 0.51 1fM 25.05 0.70 100aM 29.51 0.14 10aM 32.72 0.36 1aM 35.96 0.37 0.1aM 0.00 0.00 0aM 0.00 0.00

[0091] Table 9 Detection limit characterization of RPA-Cas12a one-step targeting b6r in the presence of 40 μg / mL heparin sodium

[0092] FLintensity(au) SD 0aM 11928.59 2512.89 0.1aM 12537.38 415.87 1aM 20513.73 1679.59 10aM 87763.97 8727.27 100aM 147881.88 3542.93 1fM 159751.66 3278.17 10fM 182046.98 4968.33

[0093] Table 10 Detection limit characterization of RPA-Cas12a one-step targeting b6r under qPCR conditions

[0094] Ctvalue SD 10fM 21.40 0.50 1fM 24.08 0.74 100aM 27.95 0.86 10aM 31.87 0.70 1aM 35.95 0.98 0.1aM 0.00 0.00 0aM 0.00 0.00

[0095] CRISPR one-step detection method process: Lyophilized RPA particles (Anpu Future Biotechnology Co., Ltd.) were reconstituted in a reaction mixture containing 29.4 μL buffer A (Anpu Future Biotechnology Co., Ltd.), 2 μL 20 μM RPA forward and reverse primers (Table 4), 400 nM FQ-ssDNA reporter molecules (Table 5), 100 nM LbCas12a, 200 nM crRNA and nuclease-free water, and a certain concentration of heparin sodium was added. After adding 2-3 μL buffer B (Anpu Future Biotechnology Co., Ltd.), 24 μL of the mixture was incubated at 37 ° C for 20 minutes. Fluorescence was measured using a SpectraMax i3x multi-mode microplate reader at an excitation wavelength of 485 nm and an emission wavelength of 520 nm.

[0096] 2. Comparison with qPCR detection limit

[0097] The qPCR test of the standard sample containing monkeypox plasmid was performed in a 20 μL reaction system, which included 10 μL 2× AceQ qPCR probe mixture (Novozyme Biotech Co., Ltd.), 1 μL of each primer pair (10 μM), and 0.2 μL 10 μM TaqMan probe (Sangon Biotech Co., Ltd.). The test results are shown in Figure 2 As shown in Table 4, the detection limit of qPCR is comparable to that of the CRISPR one-step detection method. Detailed information on primers and TaqMan probes is shown in Tables 4 and 5.

[0098] Example 3 One-step detection and characterization of different Cas12 proteins

[0099] The CRISPR one-step detection method was used to detect 1fM carrying the f3l or b6r gene at 37°C. The one-step detection method process is the same as Example 2, except that 100nM LbCas12a was replaced with AsCas12a and AapCas12b. For AsCas12a, 40μg / mL heparin sodium was added. For AapCas12b, 20μg / mL heparin sodium was added. The characterization results of one-step detection using AsCas12a or AapCas12b are shown in Figure 2. Figure 3 As shown, wherein a is a schematic diagram of sodium heparin enhancing the one-step detection of various Cas12 proteins. b is a diagram of the characterization of a one-step detection method targeting f3l or b6r when AsCas12a replaces LbCas12a. c is a diagram of the characterization of a one-step detection method targeting f3l or b6r when AapCas12b replaces LbCas12a. For AsCas12a, f3l or b6r genes can only be detected in the presence of sodium heparin. For AapCas12b, sodium heparin can significantly enhance its detection effect.

[0100] Example 4: One-step CRISPR method for influenza A virus clinical sample detection

[0101] 1. One-step CRISPR detection method for influenza A virus

[0102] Compared with monkeypox virus, the genetic material of influenza A virus is RNA. Therefore, the detection system also includes 8 μL of 20 μM reverse transcription primer and 0.8 μL of reverse transcriptase (Novozyme Biotechnology Co., Ltd.). The detection results of influenza A virus using the CRISPR one-step method in Example 2 are as follows: Figure 4 , as shown in Tables 11 to 16, wherein a to c illustrate the detection limit analysis of the synthetic M2 protein encoding gene (DNA) by the RPA-Cas12a one-step detection method without (a) and with (b) 40 μg / mL heparin sodium and qPCR (c), and the target concentration is 0, 0.1, 1, 10, 100, 1000, 10000aM. d to f illustrate the detection limit analysis of the transcribed mRNA target by the RT-RPA-Cas12a one-step detection method without (d) and with (e) 10 μg / mL heparin sodium and RT-qPCR (f), and the target concentration is 0, 0.1, 1, 10, 100, 1000, 10000aM. It can be seen that whether the detection object is the synthetic M2 protein encoding gene (DNA) or the transcribed mRNA, its detection limit can be comparable to that of qPCR and RT-qPCR.

[0103] Table 11 Detection limit analysis of the synthetic M2 protein encoding gene (DNA) by the RPA-Cas12a one-step detection method under the condition of no sodium heparin

[0104]

[0105] Table 12 Detection limit analysis of the synthetic M2 protein encoding gene (DNA) by the RPA-Cas12a one-step detection method under the conditions of 40 μg / mL heparin sodium and qPCR

[0106]

[0107] Table 13 Detection limit analysis of the synthetic M2 protein encoding gene (DNA) by the RPA-Cas12a one-step detection method under qPCR conditions

[0108] Ctvalue SD 10fM 22.22655 0.24084 1fM 25.65976 0.33138 100aM 29.65901 0.02759 10aM 32.59956 0.38447 1aM 36.93976 0.15921 0.1aM 0 0 0aM 0 0

[0109] Table 14 Detection limit analysis of transcribed mRNA targets by RT-RPA-Cas12a one-step detection method under heparin-free conditions

[0110]

[0111] Table 15 Detection limit analysis of transcribed mRNA targets under the condition of 10 μg / mL heparin sodium by RT-RPA-Cas12a one-step detection method

[0112]

[0113] Table 16 Detection limit analysis of transcribed mRNA targets by RT-RPA-Cas12a one-step detection method under RT-qPCR conditions

[0114] Ctvalue SD 10fM 24.80485 0.27283 1fM 28.75092 0.03734 100aM 31.76427 0.65315 10aM 34.98404 0.88802 1aM 36.99001 0.01144 0.1aM 0 0 0aM 0 0

[0115] 2. Clinical sample validation of CRISPR one-step detection method

[0116] The CRISPR one-step detection method was used to test 33 clinical samples, such as Figure 4 As shown, g shows a schematic diagram of the detection of human saliva and sputum samples. h shows the analysis of 33 patient samples using RT-qPCR and the one-step detection method. RT-qPCR was performed for 40 cycles. For the one-step detection method, the threshold was set as the fluorescence value of the negative control plus three times its standard deviation; samples exceeding this threshold were classified as positive, and samples below this threshold were considered negative. i shows the specificity and sensitivity analysis of sample detection using the one-step detection method, with RT-qPCR as the gold standard for determining negative and positive results. It can be seen that compared with RT-qPCR, it can identify 21 true positives and 11 true negatives, and the detection sensitivity and specificity are both above 95%. The samples in this study were from the Union Hospital Affiliated to Fujian Medical University, and this study has been approved by the Ethics Committee of the Union Hospital Affiliated to Fujian Medical University (2024KY093).

[0117] Example 5: One-step CRISPR method for detecting novel coronavirus in wastewater samples

[0118] 1. One-step detection method for novel coronavirus CRISPR

[0119] Like influenza A virus, the genetic material of the new coronavirus (SARS-CoV-2) is RNA. Therefore, the detection system also includes 8 μL of 20 μM reverse transcription primer and 0.8 μL of reverse transcriptase (Novozyme Biotechnology Co., Ltd.). The detection results of SARS-CoV-2 using the one-step detection method in Example 2 are as follows: Figure 5, as shown in Tables 17 to 22, wherein a to c illustrate the detection limit analysis of the synthetic N protein encoding gene (DNA) by the RPA-Cas12a one-step detection method without (a) and with (b) 40 μg / mL heparin sodium and qPCR (c), and the target concentration is 0, 0.1, 1, 10, 100, 1000, 10000aM. D to f illustrate the detection limit analysis of the transcribed mRNA target by the RT-RPA-Cas12a one-step detection method without (d) and with (e) 10 μg / mL heparin sodium and RT-qPCR (f), and the target concentration is 0, 0.1, 1, 10, 100, 1000, 10000aM. Regardless of whether the detection object is the synthetic N protein encoding gene (DNA) or the transcribed mRNA, its detection limit can be comparable to that of qPCR and RT-qPCR.

[0120] Table 17 Detection limit analysis of the synthetic N protein encoding gene (DNA) by the RPA-Cas12a one-step detection method under the condition of no sodium heparin

[0121]

[0122] Table 18 Detection limit analysis of the synthetic N protein encoding gene (DNA) by the RPA-Cas12a one-step detection method in the presence of 40 μg / mL heparin sodium

[0123]

[0124] Table 19 Detection limit analysis of synthetic N protein encoding gene (DNA) by RPA-Cas12a one-step detection method under qPCR conditions

[0125]

[0126]

[0127] Table 20 RT-RPA-Cas12a one-step detection method for transcribed mRNA targets under heparin-free conditions

[0128]

[0129] Table 21 Detection limit analysis of transcribed mRNA targets by RT-RPA-Cas12a one-step detection method in the presence of 10 μg / mL heparin sodium

[0130]

[0131] Table 22 Detection limit analysis of transcribed mRNA targets by RT-RPA-Cas12a one-step detection method under RT-qPCR conditions

[0132] Ctvalue SD 10fM 21.50915 0.43532 1fM 25.11135 0.11251 100aM 28.31882 0.13959 10aM 32.09079 0.444 1aM 35.66223 0.81615 0.1aM 0 0 0aM 0 0

[0133] 2. Validation of CRISPR One-step Detection Method in Wastewater Samples

[0134] Influent and effluent from 25 wastewater treatment plants in 10 provinces and cities across the country were collected and tested using a CRISPR one-step detection method and RT-qPCR. Figure 5 As shown in the figure, g shows a schematic diagram of SARS-CoV-2 detection in wastewater samples from 10 provinces and cities in China. h shows the analysis of all 25 influent samples and 25 effluent samples using RT-qPCR and the one-step detection method. RT-qPCR was performed for 40 cycles. For the one-step detection method, the threshold was set as the fluorescence value of the negative control plus three times its standard deviation; samples exceeding this threshold were classified as positive, and samples below this threshold were considered negative. The sensitivity and specificity of the one-step detection method both reached more than 95%.

[0135] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of sodium heparin in inhibiting Cas12 cleavage activity; the subtypes of Cas12 include one or more of LbCas12a, AsCas12a or AapCas12b. 2.RPA-Cas12a one-step detection system, characterized in that, It includes RPA amplification primers, crRNA, Cas12, FQ-ssDNA reporter molecules and heparin sodium; the crRNA has any one or more nucleotide sequences shown in SEQ ID NO.6 to 13.

3. The RPA-Cas12a one-step detection system as claimed in claim 2, characterized in that, The RPA amplification primer has any one or more nucleotide sequences shown in SEQ ID NOs. 14-23.

4. The RPA-Cas12a one-step detection system as claimed in claim 2 or 3, characterized in that The subtypes of Cas12 include one or more of LbCas12a, AsCas12a or AapCas12b.

5. The RPA-Cas12a one-step detection system according to any one of claims 2 to 4, characterized in that, Also includes RPA particles.

6. The use of the RPA-Cas12a one-step detection system as described in any one of claims 2 to 5 in any of the following items: (I) rapid on-site detection of nucleic acid molecules; and / or (II) Preparation of products for rapid on-site detection of infectious disease pathogens; and / or (III), inhibiting Cas12 cleavage activity; and / or (IV) Improving the sensitivity and / or specificity of RPA-Cas12a detection.

7. The use according to claim 6, characterized in that The products include biosensors, reagents, test strips or test kits.

8. The use according to claim 6 or 7, characterized in that The infectious disease pathogens include monkeypox virus, influenza A virus or new coronavirus.

9. A product for rapid on-site detection of nucleic acid molecules, characterized in that: Comprising the RPA-Cas12a one-step detection system as described in any one of claims 2 to 5.

10. A method for rapid on-site detection of nucleic acid molecules, characterized in that: The method comprises the following steps: taking a sample to be tested, incubating it with the RPA-Cas12a one-step detection system as described in any one of claims 2 to 5, determining the fluorescence signal value, and setting the threshold to be the fluorescence value of the negative control plus three times its standard deviation; samples exceeding this threshold are classified as positive, and samples below this threshold are considered to be negative.

Images