Phage composite hydrogel as well as preparation method and application thereof in promoting alveolar bone repair

Abstract

The invention discloses bacteriophage composite hydrogel as well as a preparation method and application thereof in promoting alveolar bone repair, and belongs to the field of biomedical materials. The preparation method comprises the following steps: mixing methacrylated gelatin, a photoinitiator, a genetically engineered bacteriophage and a lytic bacteriophage, and carrying out self-assembly under an illumination condition, wherein the genetically engineered bacteriophage is a double-display bacteriophage for displaying stem cell adhesion peptide and SDF1 mimic peptide on the surface of the same bacteriophage. The double-display bacteriophage in the bacteriophage composite hydrogel can maintain the functions of natural peptide for a long time, and the lytic bacteriophage kills bacterial infection in the repairing process in a green and side-effect-free manner in the repairing and regeneration process of the alveolar bone induced by the double-display bacteriophage, so that the repairing efficiency of the alveolar bone is improved. The invention provides a novel multifunctional phage composite hydrogel material for clinical repair of alveolar bones.

Description

Technical Field

[0001] The invention relates to the field of biomedical materials, and in particular to a bacteriophage composite hydrogel and a preparation method thereof, and application of the hydrogel in promoting alveolar bone repair. Background Art

[0002] Periodontitis is one of the most common oral diseases and the most common chronic infectious disease in humans. It can cause uneven bone resorption in the gums and periodontium, making the alveolar bone defect complex and diverse in shape, ranging from smaller intra-bone defects to larger horizontal and vertical bone defects. At present, the progressive and irreversible destruction of periodontal supporting tissues such as clinical periodontal regeneration, alveolar bone, periodontal ligament and cementum, and the resulting progressive absorption and destruction of alveolar bone are the primary causes of tooth loss in adults. How to promote alveolar bone repair and regeneration has always been a hot topic among scholars.

[0003] However, the main surgical methods currently used include guided tissue regeneration (GTR) with bone grafting, growth factors, etc., used alone or in combination, and are mainly suitable for narrow and deep sub-bone pocket defects. In large and complex bone defect areas, due to the difficulty in shaping and maintaining space during surgery with commonly used implants, the difficulty in long-term stability of exogenous growth factors, and the lack of antibacterial properties of conventional bone transplant materials, insufficient osteogenesis in the defect area makes it difficult to achieve ideal results in alveolar bone regeneration.

[0004] At the same time, the complex periodontal microbial environment plays a very important regulatory role in bone tissue regeneration. In addition to having good bone induction ability, the key to improving the success rate is to have antibacterial ability. In particular, the oral cavity is a bacterial environment, and implants need to have antibacterial ability. Currently, common bone repair materials often only focus on the induction performance of bone repair, but ignore their antibacterial ability. The current solution is to take antibiotics, which will lead to the abuse of antibiotics and the continuous increase of super bacteria. Therefore, providing a method that promotes bone repair while killing bacterial infections in the repair process without side effects is very critical to solving the current technical problems in tooth bone repair. Summary of the invention

[0005] The purpose of the present invention is to provide a phage composite hydrogel and a preparation method thereof and an application in promoting alveolar bone repair to solve the problems existing in the above-mentioned prior art. The phage composite hydrogel improves the efficiency of alveolar bone repair by combining dual display of phage-induced alveolar bone repair and regeneration with the antibacterial function of lysed phage.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for preparing a phage composite hydrogel, comprising the steps of mixing methacrylylated gelatin, a photoinitiator, a genetically engineered phage and a lytic phage, and self-assembling the mixture under light conditions; wherein the genetically engineered phage is a double-display phage displaying a stem cell adhesion peptide and an SDF1 mimetic peptide on the surface of the same phage.

[0008] Preferably, the mixed system uses PBS as a solvent, and the mixed system contains 10% methacrylated gelatin, 0.25% photoinitiator, and a final concentration of 4×10 11 pfu / mL of genetically engineered phage and a final concentration of 1×10 9 pfu / mL of lytic phage.

[0009] Preferably, the method for preparing the methacryloyl gelatin comprises the following steps:

[0010] Gelatin was dissolved in PBS, and methacrylic anhydride was added to the gelatin solution in batches under vigorous stirring at 50°C for 3-5 hours, and then PBS was added to terminate the reaction. The obtained reaction product was dialyzed and freeze-dried to obtain the methacrylated gelatin.

[0011] Preferably, the mass volume ratio of the gelatin to the methacrylic anhydride is (1-3) g:500 μL.

[0012] Preferably, the lytic phage comprises a methicillin-resistant Staphylococcus phage.

[0013] Preferably, the method for constructing the genetically engineered phage comprises the following steps:

[0014] The coding genes of stem cell adhesion peptide and SDF1 mimetic peptide were respectively introduced into the coding gene of bacteriophage P8 fusion protein to obtain fragment I and fragment II, respectively;

[0015] The fragment I is connected to the pM8A vector to construct a recombinant plasmid I; the fragment II is connected to the pM8C vector to construct a recombinant plasmid II;

[0016] The recombinant plasmid I and the recombinant plasmid II are simultaneously transferred into competent Escherichia coli cells, cultured, and then screened with ampicillin and chloramphenicol dual-resistance culture medium to obtain dual-resistance positive clones;

[0017] The double-antibody positive clone is co-incubated with a helper phage to obtain a double-display phage displaying a stem cell adhesion peptide and an SDF1 mimetic peptide on the same phage surface, which is the genetically engineered phage.

[0018] Preferably, the nucleotide sequences of the genes encoding the stem cell adhesion peptide and the SDF1 mimetic peptide are shown in SEQ ID NOs: 3-4, respectively. SEQ ID NO: 3 is: 5'-TGCCGCGGCGATTGC-3', and SEQ ID NO: 4 is: 5'-AGCAAACCGGTTAGCCTGAGCTATCGT-3'.

[0019] CCATGG GATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAA AAGCTT

[0020] The nucleotide sequence of the pM8C vector is shown in SEQ ID NO: 2: AAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAA AAGCTT CCATGG GATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTAAG.

[0021] Preferably, the illumination condition is: irradiation with blue light of 405 nm wavelength for 30 s.

[0022] The invention also provides a bacteriophage composite hydrogel, which is prepared by the preparation method.

[0023] The present invention also provides the use of the phage composite hydrogel in preparing nanomaterials or drugs for promoting alveolar bone repair.

[0024] The present invention discloses the following technical effects:

[0025] The present invention mixes methacrylated gelatin, a photoinitiator, a genetically engineered phage and a lytic phage, and self-assembles under light conditions to construct a novel multifunctional phage composite hydrogel. Specifically, the present invention displays a stem cell adhesion peptide (CRGDC) and an SDF1 mimetic peptide (SKPVSLSYR) on the surface of the same phage to obtain a double-display phage, which can maintain the function of the polypeptide for a long time. The existence of phages that specifically lyse bacteria can replace traditional antibiotics, and can achieve green and side-effect-free killing of bacterial infections in the repair process to improve bone repair efficiency in view of the difficulty of bone regeneration and repair caused by the complex periodontal microbial environment. It can be seen that the present invention has successfully developed a genetically engineered phage and a lytic phage that induce alveolar bone regeneration, and constructed a multifunctional phage composite hydrogel based on the self-assembly and dynamic interaction of natural peptides, breaking through many limitations of current clinical implants and promoting the repair and regeneration of alveolar bone. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 Sequencing results for the RGD / SDF1 dual display phage plasmid construction;

[0028] Figure 2 TEM image of RGD / SDF1 dual-display phage;

[0029] Figure 3 Schematic diagram of the preparation process of GelMA@RGD / SDF1:MP;

[0030] Figure 4 Results of in vitro experiments to test the performance of GelMA@RGD / SDF1:MP; a: swelling property determination results, b: degradation effect;

[0031] Figure 5 The repair effect of GelMA@RGD / SDF1:MP on alveolar bone defect; a: CT scan observation of alveolar bone repair effect; b: antibacterial effect of hydrogel. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] The vectors involved in the present invention: pM8A vector carries the ampicillin resistance gene AmpR, has a length of 4212 bp, and its sequence is shown in SEQ ID NO: 1; pM8C vector carries the chloramphenicol resistance gene CmR, has a length of 4044 bp, and its nucleotide sequence is shown in SEQ ID NO: 2. The above vector sequences were synthesized and sequenced by the company.

[0038] The methicillin-resistant Staphylococcus aureus phage (MRSA Phage) screened by the research team has been published in the following paper: "Xu, Y.; Yang, T.; Miao, Y.; Zhang, Q.; Yang, M.; Mao, C.; Injectable phage-loaded microparticles effectively release phages to killmethicillin-resistant staphylococcus aureus, ACS Applied Materials &Interfaces, 2024, 16(14): 17232-17241.".

[0039] Example 1 Construction method of dual display phage pM8-RGD-BMP2

[0040] 1. Phage display

[0041] The upstream primer (5'-ATCCATGGCGTGCCGCGGCGATTGCGATCCCGCAAAAGCG-3', SEQ ID NO: 7) encoding stem cell adhesion peptide (RGD) (amino acid sequence: CRGDC, SEQ ID NO: 5) and the upstream primer (5'-ATCCATGGCGAGCAAACCGGTTAGCCTGAGCTATCGTGATCCCGCAAAAGCG-3', SEQ ID NO: 8) encoding SDF1 mimetic peptide (amino acid sequence: SKPVSLSYR, SEQ ID NO: 6) were used as primers, respectively, and the downstream primer (5'-GCAAGCTTTTATCAGCTTGCTTTCGAG-3', SEQ ID NO: 9) was used as primers to amplify the expression of wild-type M13 phage (New England Biolabs, 1994). The PCR reaction was carried out according to the procedure shown in Table 1 using the PCR kit (Congwei Century, Catalog No.: CW3314S) as a template, and the DNA encoding the RGD peptide and the DNA encoding the SDF1 peptide were inserted into the DNA of the bacteriophage P8 protein (gene accession number: NC_003287.2), respectively, and recorded as DNA RGD and DNASDF1 .

[0042] Table 1 PCR program description

[0043]

[0044] 2. Construction of recombinant plasmid

[0045] Use NcoI and HindIII to double-digest pM8A, pM8C vector plasmids, DNA RGD and DNA SDF1 fragment; and use T4 DNA ligase to ligate the pM8A and pM8C vector plasmids containing NcoI and HindIII sticky ends to DNA RGD With DNA SDF1 The fragments were connected overnight; this operation is to insert fragment 1 into the pM8A vector to obtain the pM8A-RGD and pM8C-SDF1 recombinant plasmids (see Figure 1 The results showed that the RGD peptide (CRGDC) and SDF1 mimetic peptide (SKPVSLSYR) were successfully inserted into the pM8A and pM8C vectors.

[0046] 3. Construction of dual display phage pM8-RGD-BMP2

[0047] Add pM8A-RGD and pM8C-SDF1 recombinant plasmids to 80 μL of TG1 competent cells at the same time, mix well, and place on ice for 20 minutes. Quickly place the mixture in a 42°C water bath for heat shock for 60 seconds, take it out and put it in ice for 2 minutes. Add 1 mL of LB medium and culture it at 150 rpm and 37°C for 1 hour. Centrifuge the culture at 4000 rpm for 5 minutes, resuspend the precipitate with 100 μL, apply it on the surface of 50 μg / mL ampicillin and 70 μg / mL chloramphenicol double-antibody LB solid culture medium, and culture it at 37°C overnight to obtain double-antibody positive clones. Pick the positive clones in 5 mL of double-antibody LB culture medium, culture at 180 rpm to the logarithmic phase, add 3 μL of helper phage (New England Biolabs, catalog number: N0315S) and incubate for 30 minutes. The incubated bacteria were added to 100 ml LB medium and cultured at 160 rpm and 37° C. for 16 h to prepare the dual display phage pM8-RGD-BMP2.

[0048] The culture was centrifuged at 4000 rpm for 30 min to remove bacteria, 1 / 6 volume of 16.6% PEG / 2.5M NaCl was added to the supernatant and mixed, and after standing at 4°C overnight, the culture was centrifuged at 12000 rpm for 30 min to purify the dual-display phage pM8-RGD-BMP2.

[0049] 4. Characterization of the dual display phage pM8-RGD-BMP2

[0050] The dual display phage pM8-RGD-BMP2 was observed using a transmission electron microscope (TEM). Figure 2 The results showed that a filamentous phage with a length of about 1.3 μm was successfully prepared.

[0051] Example 2 Preparation method of phage composite hydrogel GelMA@RGD / SDF1:MP

[0052] (1) Dissolve 2 g of gelatin in PBS. Heat in a 50°C water bath with vigorous stirring. Add 500 μL of methacrylic anhydride to the solution in 5 portions and react for 3 hours. Add 4 times the volume of PBS to terminate the reaction. Dialyze the product in deionized water at 40°C for 7 days and freeze-dry to obtain GelMA powder.

[0053] (2) Using 1×PBS as solvent, 10% GelMA powder, 0.25% photoinitiator LAP powder, and a final concentration of 4×10 11 pfu / mL of RGD / SDF1 bifunctional phage, with a final concentration of 1×10 9 pfu / mL of methicillin-resistant Staphylococcus aureus phage (MRSA Phage) was mixed and irradiated with blue light at a wavelength of 405nm for 30s to solidify into an injectable phage composite hydrogel GelMA@RGD / SDF1:MP. The preparation flow chart is shown in Figure 3 .

[0054] The reaction mechanism of the prepared phage composite hydrogel is as follows: the amino groups on the surface of the phage react with methacrylic anhydride to obtain methacrylic acid-modified SDF1-MA phage and RGD-MA phage, which are then co-crosslinked under blue light to obtain the finished product.

[0055] Example 3 In vitro experiments to measure the properties of phage composite hydrogel GelMA@RGD / SDF1:MP

[0056] 1. Swelling properties

[0057] (1) Preparation of cylindrical hydrogels (volume: 200 m; N = 3 for each group).

[0058] (2) Freeze-dried and weighed.

[0059] (3) The dried hydrogel was incubated in 2 mL 1×PBS for t hours, then taken out, excess water was removed (filtered through a 100 μm cell strainer (Nest cell strainer 258367)), and weighed.

[0060] (4) Repeat the above experimental procedure until the hydrogel reaches a constant weight. Use the following formula:

[0061] S t (%)=(m t -m) / m×100;

[0062] S eq (%)=(m eq -m) / m×100;

[0063] Determine the swelling ratio, where S t and m t represents the swelling ratio and the mass of wet hydrogel measured at time point t; m represents the mass of dry hydrogel, m eq represents the mass of the wet hydrogel at the swelling equilibrium point.

[0064] 2. Degradation performance

[0065] (1) Preparation of cylindrical hydrogels (diameter: 10 mm, volume: 150 μL; n = 3 per group)

[0066] (2) Freeze-dried and weighed.

[0067] (3) Then, the hydrogel was completely immersed in PBS with a pH value of 7.4.

[0068] (4) At a fixed time point, remove the hydrogel and rinse it three times with distilled water to completely remove the degraded part of the hydrogel.

[0069] (5) Then, the hydrogel was vacuum dried at 50 °C for 12 h and weighed.

[0070] The weight loss rate was determined by the following equation:

[0071] Weight loss rate (%) = (W1-W t ) / W1×100.

[0072] Wherein, W1 represents the weight of the hydrogel before degradation; W t represents the weight of the hydrogel at time point t.

[0073] like Figure 4 As shown, the swelling properties results indicate that the phage makes the hydrogel more stable (see Figure 4 The degradation experiment results show that the phage reduces the degradation rate of the hydrogel, which can make the hydrogel more long-lasting (see Figure 4 (b)

[0074] Example 4 Animal Experiment

[0075] Construction of rat alveolar bone defect model: A bone defect with a diameter of 3 mm and a height of 1 mm was prepared on the buccal side of the alveolar bone of the first mandibular molar of rats. GelMA@RGD / SDF1:MP injectable hydrogel was injected into the defect site and solidified by blue light excitation. 5 μL of 10 7 CFU multidrug-resistant Staphylococcus aureus phage infection, wound suture. Samples were taken one month later and analyzed for bone filling rate and bone density using Micro-CT scanning. The hydrogel was incubated with bacteria to test the antibacterial effect.

[0076] like Figure 5 As shown, CT results showed that the repair rate of GelMA@RGD / SDF1:MP injectable hydrogel group was significantly higher than that of the control group (see Figure 5 a); The antibacterial effect of the hydrogel. As the content of MRSA phage in the hydrogel increases, the antibacterial effect is also significantly improved (see Figure 5 (b)

[0077] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing a bacteriophage composite hydrogel, It is characterized in that The method comprises the steps of mixing methacrylylated gelatin, a photoinitiator, a genetically engineered phage and a lytic phage, and self-assembling the mixture under light conditions; wherein the genetically engineered phage is a double-display phage which displays a stem cell adhesion peptide and an SDF1 mimetic peptide on the surface of the same phage.

2. The preparation method according to claim 1, It is characterized in that The mixed system uses PBS as solvent, and the mixed system contains 10% methacrylated gelatin, 0.25% photoinitiator, and a final concentration of 4×10 11 pfu / mL of genetically engineered phage and a final concentration of 1×10 9 pfu / mL of lytic phage.

3. The preparation method according to claim 1, It is characterized in that The preparation method of the methacrylated gelatin comprises the following steps: Gelatin was dissolved in PBS, and methacrylic anhydride was added to the gelatin solution in batches under vigorous stirring at 50°C for 3-5 hours, and then PBS was added to terminate the reaction. The obtained reaction product was dialyzed and freeze-dried to obtain the methacrylated gelatin.

4. The preparation method according to claim 3, It is characterized in that The mass volume ratio of the gelatin to the methacrylic anhydride is (1-3) g:500 μL.

5. The preparation method according to claim 1, It is characterized in that The lytic phage includes a methicillin-resistant Staphylococcus phage.

6. The preparation method according to claim 1, It is characterized in that The method for constructing the genetically engineered phage comprises the following steps: The coding genes of stem cell adhesion peptide and SDF1 mimetic peptide were respectively introduced into the coding gene of bacteriophage P8 fusion protein to obtain fragment I and fragment II, respectively; The fragment I is connected to the pM8A vector to construct a recombinant plasmid I; the fragment II is connected to the pM8C vector to construct a recombinant plasmid II; The recombinant plasmid I and the recombinant plasmid II are simultaneously transferred into competent Escherichia coli cells, cultured, and then screened with ampicillin and chloramphenicol dual-resistance culture medium to obtain dual-resistance positive clones; The double-antibody positive clone is co-incubated with a helper phage to obtain a double-display phage displaying a stem cell adhesion peptide and an SDF1 mimetic peptide on the same phage surface, which is the genetically engineered phage.

7. The preparation method according to claim 6, It is characterized in that The nucleotide sequences of the genes encoding the stem cell adhesion peptide and the SDF1 mimetic peptide are shown in SEQ ID NOs: 3-4, respectively. The nucleotide sequence of the pM8A vector is shown in SEQ ID NO:

1. The nucleotide sequence of the pM8C vector is shown in SEQ ID NO:

2.

8. The preparation method according to claim 1, It is characterized in that The illumination condition is: irradiation with blue light of 405 nm wavelength for 30 s.

9. A bacteriophage composite hydrogel, It is characterized in that The invention is prepared by the preparation method according to any one of claims 1 to 8.

10. Use of the phage composite hydrogel according to claim 9 in preparing nanomaterials or drugs for promoting alveolar bone repair.

Images