Bacteroides fragilis capable of converting ginsenoside Rb1 and ginsenoside Rd to obtain rare saponin aescin XVII and ginsenoside F2 and application of bacteroides fragilis

Abstract

The invention discloses bacteroides fragilis capable of converting ginsenoside Rb1 and ginsenoside Rd to obtain rare saponin aescilloside XVII and ginsenoside F2 and application of the bacteroides fragilis CMLF03. The bacteroides fragilis CMLF03 is preserved in China General Microbiological Culture Collection Center, the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC NO. The preservation date is January 25, 2024, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) NO.41094. The invention solves the problem of low conversion rate of the existing method for converting ginsenoside into rare ginsenoside. The bacteroides fragilis CMLF03 disclosed by the invention can be used for converting ginsenoside Rb1 and ginsenoside Rd to obtain rare saponin aescin XVII and ginsenoside F2.

Description

Technical Field

[0001] The present invention relates to the application field of microbial technology, and specifically to a Bacteroides fragilis for converting ginsenoside Rb1 and ginsenoside Rd to obtain rare saponins aescin XVII and ginsenoside F2, and applications thereof. Background Art

[0002] Ginsenoside is a steroid compound widely found in ginseng, Panax notoginseng and other ginseng herbs. It has antioxidant, anti-tumor, antibacterial, anti-fatigue and anti-aging pharmacological effects. It is widely used in clinical practice and is used in preventing diseases, promoting body recovery, improving intelligence and brain function, and enhancing physical strength. There are many types of ginsenosides, and the structural effects of each type of saponin are also different. In general, ginsenosides can be divided into large ginsenosides and rare ginsenosides according to the differences in the types and quantities of sugar groups connected to the dammarane-type mother core structure at the C-3, C-6 and C-20 positions on the saponins. In comparison, rare ginsenosides have more advantages in bioavailability and biological activity than large ginsenosides. Researchers have been looking for a way to convert a large amount of ginsenosides into rare ginsenosides with low consumption and high efficiency. The main methods for obtaining rare ginsenosides are physical method, chemical method and biological transformation method. Compared with the former, the biological transformation method has a simple process flow and low price, which is more important for obtaining ginsenosides with strong pharmacological activity and high applicability. However, the conversion rate of existing transformation methods is not high.

[0003] Ginsenoside Rb1 and ginsenoside Rd are both large-scale ginsenosides, which can be extracted from multiple parts of ginseng plants and generally have high content. However, their bioavailability in the stomach and intestine is low after direct ingestion by the human body. Ginsenoside F2 and esculoside XVII are rare saponins that are beneficial to intestinal absorption. Ginsenoside F2 belongs to the protopanaxadiol type triterpenoid saponin, which has good antibacterial, anti-inflammatory and antioxidant stress effects, and can inhibit cell apoptosis through a series of signaling pathways. Ginsenoside F2 also has an inhibitory effect on gastric cancer and lung cancer cells. Esculoside XVII belongs to the esculoside compound, which is a new type of phytoestrogen with a structure similar to estradiol. Studies have shown that it may have the ability to antagonize ultraviolet radiation and delay skin photoaging. It can also inhibit oxidative stress and inhibit nerve damage caused by cerebral ischemia, thereby inhibiting oxidized low-density lipoprotein-induced human umbilical vein endothelial cell apoptosis. Summary of the invention

[0004] The purpose of the present invention is to provide a Bacteroides fragilis for converting ginsenoside Rb1 and ginsenoside Rd to obtain rare saponins escintiside XVII and ginsenoside F2 and its application, which solves the problem of low conversion rate of converting ginsenosides into rare ginsenosides in the existing method, and can completely convert ginsenoside Rb1 and ginsenoside Rd to obtain rare saponins escintiside XVII and ginsenoside F2.

[0005] In order to achieve the above-mentioned purpose, the present invention provides a Bacteroides fragilis that converts ginsenoside Rb1 and ginsenoside Rd to obtain rare saponins aescin XVII and ginsenoside F2. The Bacteroides fragilis (Bacteroides sp.) CMLF03 is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with the deposit address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit date being January 25, 2024, and the deposit number being CGMCC NO.41094.

[0006] The present invention provides an application of the Bacteroides fragilis in fermenting and transforming ginsenoside Rb1 and ginsenoside Rd.

[0007] Preferably, the product comprises saponin esculinside XVII and ginsenoside F2.

[0008] Preferably, the biotransformation route of ginsenoside Rb1 comprises: as described in the Bacteroides fragilis, the terminal glucose group at the C-3 position of ginsenoside Rb1 is hydrolyzed to generate escinoids XVII, and the terminal glucose group at the C-20 position of escinoids XVII is further hydrolyzed to generate ginsenoside F2.

[0009] Preferably, the biotransformation route of ginsenoside Rb1 comprises: as described in the Bacteroides fragilis, the terminal glucose group at the C-20 position of ginsenoside Rb1 is hydrolyzed to generate ginsenoside Rd, and then the terminal glucose group at the C-3 position of ginsenoside Rd is further hydrolyzed to generate ginsenoside F2.

[0010] Preferably, the method for fermenting and converting ginsenoside Rb1 and ginsenoside Rd is as follows:

[0011] The Bacteroides fragilis liquid is inoculated into a brain heart infusion liquid culture medium containing saponins, and is cultured statically in an anaerobic gas environment at 37°C, and the cultured bacterial liquid is taken for saponin component conversion detection. The saponins in the brain heart infusion liquid culture medium containing saponins are 1.5‰ total saponins of Panax notoginseng, 1.5‰ ginsenoside Rb1 or 0.4‰ ginsenoside Rd.

[0012] If other experimental conditions remain unchanged, the added substrate concentration is changed, and 1.5‰ ginsenoside Rb1 is added to 30mL BHI medium. At 72h, the conversion rate of ginsenoside Rb1, Panax notoginseng total saponins and ginsenoside Rd in the medium is close to 100%. If the substrate addition amount is changed to 0.5-1.5‰, as the amount of substrate addition is reduced, the same conversion effect may be achieved within 12h-72h. If the substrate addition amount is changed to 1.5-3.0‰, as the amount of substrate addition is increased, the same conversion effect may be achieved after 72h or longer culture time.

[0013] If other experimental conditions remain unchanged and the culture temperature is changed, the culture temperature of Bacteroides fragilis is 37°C, and at 72h, the conversion rate of ginsenoside Rb1 in the culture medium is close to 100%. If the culture temperature range is changed to 25-37°C, as the temperature decreases, it may take 72h or longer culture time to achieve the same conversion effect.

[0014] Preferably, the brain heart infusion liquid culture medium is prepared by mixing peptone, dehydrated calf brain infusion powder, dehydrated buffalo heart infusion powder, sodium chloride, glucose, disodium hydrogen phosphate and L-cysteine ​​hydrochloride, adjusting the pH to 7.2-7.6, sterilizing at 101 kPa and 121° C., cooling the culture medium after sterilization, and then adding hemin and vitamins.

[0015] Preferably, in each liter of brain heart infusion liquid culture medium, the mass ratio of the peptone, dehydrated calf brain extract powder, dehydrated buffalo heart extract powder, sodium chloride, glucose and disodium hydrogen phosphate is 10.0:12.5:5.0g:5.0:2.0:2.5; the mass of the L-cysteine ​​hydrochloride is 1.0‰ of the mass of the brain heart infusion liquid culture medium, the mass of the hemin chloride is 0.01‰ of the mass of the brain heart infusion liquid culture medium, and the mass of the vitamin K1 is 0.01‰ of the mass of the brain heart infusion liquid culture medium.

[0016] Preferably, the composition of the anaerobic gas environment is 5% CO2, 5% H2 and 90% N2; during the inoculation, the volume ratio of the Bacteroides fragilis liquid to the BHI medium containing 1.5‰ Panax notoginseng total saponins, 1.5‰ ginsenoside Rb1 or 0.4‰ ginsenoside Rd is (1.0-5.0):10.0. If other experimental conditions remain unchanged, the amount of inoculated bacteria is changed, the volume ratio of the Bacteroides fragilis liquid to the BHI medium is 1.0:10.0, and at 72h, the conversion rate of ginsenoside Rb1, Panax notoginseng total saponins and ginsenoside Rd in the culture medium is close to 100%. If the volume ratio of the bacterial liquid to the BHI medium is changed to (1.0-5.0):10.0, the same conversion effect may be achieved within 12-72h as the proportion of the bacterial liquid increases.

[0017] More preferably, the Bacteroides fragilis solution is diluted with sterile phosphate buffered saline (PBS, pH 7.4) at a volume ratio of 1:1.5, and then the OD 600 The absorbance measured at OD was about 0.7. If other experimental conditions remain unchanged, the bacterial concentration in the inoculated bacterial solution is changed, and the Bacteroides fragilis bacterial solution is diluted with sterile phosphate buffer (PBS, pH 7.4) at a volume ratio of 1:1.5. 600 The absorbance measured under the condition of 40 °C was about 0.7. At 72 h, the conversion rates of ginsenoside Rb1, total saponins of Panax notoginseng and ginsenoside Rd in the culture medium were close to 100%. If the bacterial concentration in the culture medium is changed by 0.2 to 0.7 at the same dilution volume, the same conversion effect may be achieved after 72 h or longer culture time as the bacterial concentration decreases. If the bacterial concentration is still 0.7 after increasing the dilution volume, such as the volume ratio of Bacteroides fragilis culture medium to sterile phosphate buffer (PBS, pH 7.4) is 1: (1.5 to 2.5), the same conversion effect may be achieved within 12 h to 72 h as the dilution volume increases.

[0018] Preferably, the detection is performed using a high performance liquid phase on the saponin components in the culture medium.

[0019] The Bacteroides fragilis for converting ginsenoside Rb1 and ginsenoside Rd to obtain rare saponins aescin XVII and ginsenoside F2 and the application thereof solve the problem of low conversion rate of converting ginsenosides into rare ginsenosides by the existing method, and has the following advantages:

[0020] 1. The Bacteroides fragilis CMLF03 of the present invention is an obligate anaerobic Gram-negative bacterium belonging to the Bacteroidetes phylum, Bacteroidetes family, and Bacteroides genus. The Bacteroidetes phylum can be stably colonized in the human intestine for a long time and occupy an ecological niche advantage. Its powerful carbohydrate degradation system can help the host improve nutrient utilization, accelerate the formation of blood vessels in the intestinal mucosa and the development of the immune system, and has a positive effect on promoting human health.

[0021] 2. The Bacteroides fragilis CMLF03 of the present invention can transform ginsenoside Rb1 and ginsenoside Rd to obtain rare saponins esculoside XVII and ginsenoside F2. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a plate colony morphology diagram of Bacteroides fragilis CMLF03 of the present invention.

[0023] Figure 2 This is a high performance liquid chromatogram of the fermentation of Panax notoginseng total saponins by Bacteroides fragilis CMLF03 of the present invention for 48 hours.

[0024] Figure 3This is a high performance liquid chromatogram of ginsenoside Rb1 fermented by Bacteroides fragilis CMLF03 of the present invention for 48 hours.

[0025] Figure 4 This is a high performance liquid chromatogram of ginsenoside Rb1 fermented by Bacteroides fragilis CMLF03 of the present invention for 72 hours.

[0026] Figure 5 This is a high performance liquid chromatogram of ginsenoside Rd fermented by Bacteroides fragilis CMLF03 of the present invention for 36 hours. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Example 1 Isolation and Identification of Bacteroides fragilis

[0029] The specific steps are as follows:

[0030] 1. Preparation of 10% (w / v) human feces suspension:

[0031] Take fresh feces from healthy people who have been taking Panax notoginseng powder for a long time, weigh about 3g of fresh feces sample, and quickly place it in 30mL of sterile phosphate buffered saline (PBS, pH 7.2) containing 20% ​​glycerol at a volume ratio of 1:10, vortex mix, and take the supernatant after centrifugation to prepare human fecal bacterial suspension.

[0032] Sterile phosphate buffered saline (PBS, pH 7.2) containing 20% ​​glycerol was prepared as follows:

[0033] Glycerol was sterilized at 101 kPa and 121° C. for 30 min. 6 mL of sterilized glycerol was added to 24 mL of sterile phosphate buffer (PBS, pH 7.2) and mixed to prepare 30 mL of sterile phosphate buffer (PBS, pH 7.2) containing 20% ​​glycerol.

[0034] 2. Configuration of Brucella blood agar solid medium (LKV):

[0035] The amount of each component added to the LKV medium is 10.0g / L of peptone, 2.0g / L of yeast extract powder, 10.0g / L of trypticase peptone, 5.0g / L of sodium chloride, 1.0g / L of glucose, 0.1g / L of sodium bisulfite, 15.0g / L of agar, 1.0‰ of L-cysteine ​​hydrochloride, pH is adjusted to 6.8-7.2, and sterilized at 101kPa and 121℃ for 15min. After sterilization, add 0.01‰ hemin (0.01‰ hemin means that the mass of hemin is 0.01‰ of LKV medium, the same below), 0.01‰ vitamin K1, 0.1‰ kanamycin, 0.0075‰ vancomycin and 5% sterile defibrinated sheep whole blood. After the LKV plate solidifies, move it to an anaerobic gas environment and place it for 48h for use.

[0036] 3. Isolation of Bacteroides fragilis:

[0037] The human fecal bacterial suspension was diluted with sterile phosphate buffer solution (PBS, pH 7.2) containing cysteine ​​hydrochloride (gradient dilution 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 ), take 100 μL of bacterial solution from each gradient dilution and evenly spread it on LKV solid culture medium, and culture it at 37°C in an anaerobic gas environment (5% CO2, 5% H2 and about 90% N2) for 48 h.

[0038] The preparation method of sterile phosphate buffer solution (PBS, pH 7.2) containing cysteine ​​hydrochloride is as follows:

[0039] First, prepare 0.2 M disodium hydrogen phosphate solution and 0.1 M citric acid solution, mix to obtain pH 7.2 phosphate buffer (PBS), and then filter and sterilize through a sterile syringe with a 0.45 um filter to obtain sterile phosphate buffer (PBS, pH 7.2).

[0040] 4. Purification of Bacteroides fragilis:

[0041] Single colonies of different colors, shapes, sizes, etc. were picked from the LKV plate and streaked onto new LKV plates until purified Bacteroides fragilis CMLF03 was obtained.

[0042] 5. Colony morphology identification of Bacteroides fragilis:

[0043] Observe the colony morphology on the plate after 48 h of culture.

[0044] like Figure 1 As shown, the plate colony morphology of Bacteroides fragilis CMLF03 of the present invention. Figure 1 It can be seen that the colony as a whole is a relatively regular circle with complete edges and ridges. The diameter of the colony is about 1 to 2 mm. The surface is milky white, moist, smooth, and translucent, and no hemolysis occurs.

[0045] 6. 16S rDNA analysis of Bacteroides fragilis:

[0046] The genome of Bacteroides fragilis CMLF03 was extracted, and 16S rDNA was amplified using primers 27F and 1492r (the nucleotide sequence of the universal primer 27F is agagtttgatcctggctcag, and the nucleotide sequence of the universal primer 1492R is ggttaccttgttacgactt). The amplified product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After homologous comparison of the results returned by the company on NCBI, it was found that the 16S rDNA of Bacteroides fragilis had the highest similarity with Bacteroides fragilis, with a consistency of 99.93%.

[0047] 7. Genome sequencing and taxonomic identification of Bacteroides fragilis:

[0048] The Bacteroides fragilis was sent to Beijing Biomarker Biotechnology Co., Ltd. for genome sequencing. The CMLF03 genome was compared with the public database genome using the online genome hybridization analysis software GGDC (Genome-to-Genome Distance Calculator, https: / / ggdc.dsmz.de / ggdc.php#) and the whole genome average nucleotide similarity (average nucleotide identity, ANI, https: / / www.ezbiocloud.net / tools / ani) analysis tool. The results showed that the DDH value between the CMLF03 genome and the genome of the model strain Bacteroides fragilis NCTC 9343 was 91.60%, and the ANI value was 99.00%.

[0049] Based on the 16S rDNA sequencing identification of Bacteroides fragilis (the nucleotide sequence of the Bacteroides fragilis is shown in SEQ ID NO.1) and the DDH and ANI genome classification identification results, the Bacteroides fragilis belongs to Bacteroides sp., and is named Bacteroides fragilis CMLF03, recorded as CMLF03, and deposited in the General Microbiology Center of China Microorganism Culture Collection on January 25, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is and the deposit number is CGMCC NO.41094.

[0050] The nucleotide sequence of the Bacteroides fragilis CMLF03 is as follows:

[0051]

[0052] Example 2 Effect of transformation of notoginseng total saponins, ginsenoside Rb1 and ginsenoside Rd

[0053] The Bacteroides fragilis CMLF03 and Panax notoginseng total saponins were mixed and fermented to facilitate the analysis of saponin components by high performance liquid chromatography. The specific steps are as follows:

[0054] 1. Preparation of brain heart infusion liquid medium (BHI medium):

[0055] The addition amount of each component of the culture medium is 10.0 g / L of peptone, 12.5 g / L of dehydrated calf brain extract powder, 5.0 g / L of dehydrated ox heart extract powder, 5.0 g / L of sodium chloride, 2.0 g / L of glucose, 2.5 g / L of disodium hydrogen phosphate, 1‰ of L-cysteine ​​hydrochloride (1‰ of L-cysteine ​​hydrochloride means that the mass of L-cysteine ​​hydrochloride is 1‰ of the culture medium, the same below), the pH is adjusted to 7.2-7.6, sterilized at 101 kPa and 121°C for 30 min, and after the sterilization is completed, it is cooled, and then 0.01‰ of hemin and 10.01‰ of vitamin K are added;

[0056] 2. Fermentation culture:

[0057] A single colony (purified Bacteroides fragilis CMLF03) was picked from the LKV solid plate in Example 1 and inoculated into BHI medium. The culture was cultured at 37°C for 48 h in an anaerobic environment for enrichment. 3 mL of bacterial solution (the bacterial solution was diluted with sterile phosphate buffered saline (PBS, pH 7.4) at a volume ratio of 1:1.5) was taken and the OD 600 The absorbance measured at 400 °C was about 0.7. About 10 mL of bacterial liquid was prepared in advance, of which 3 mL was used to inoculate BHI culture medium, and a small amount of the remaining bacterial liquid was diluted with sterile phosphate buffer (PBS, pH 7.4) to determine the OD value), and inoculated into BHI culture medium (30 mL) containing 1.5‰ total saponins of Panax notoginseng, 1.5‰ ginsenoside Rb1 or 0.4‰ ginsenoside Rd. The culture was kept static at 37°C in an anaerobic gas environment, and the bacterial liquid after culture was tested every 12 hours to detect the conversion of saponin components. BHI culture medium without saponin added was used as a control.

[0058] 3. High performance liquid chromatography (HPLC) analysis of saponins:

[0059] Take the cultured bacterial solution, add an equal volume of saturated n-butanol, sonicate for 15 minutes, let stand to separate, collect the supernatant, and repeat this step 3 times. The collected supernatant is rotary evaporated, and then dissolved with 2 mL of chromatographic grade methanol in multiple times, filtered with a 0.45 μm filter and a sterile syringe, and directly injected into the liner tube of the injection bottle after filtration for HPLC.

[0060] The detailed conditions of HPLC are as follows: YMC-PackODS-AM (250 mm×4.6 mm, 5 μm) chromatographic column, mobile phase A component is ultrapure water-mobile phase B component is acetonitrile, detection wavelength is 203 nm; column temperature is 40°C, total flow rate is 1.0 L / min, sample volume is 10 μL; gradient elution, elution program is 0~25 min, B20%-A80%; 25~30 min, B20%~25%-A80%~75%; 30~41 min , B25%~41%-A75%~59%; 41~55min, B41%~45%-A59%~55%; 55~80min, B45%~74%-A55%~26%; 80~82min, B 74%~100%-A26%~0%; 82~92min, B100%-A0%; 92~95min, B100%~20%-A0%~80%; 95~100min, B20%-A80%;

[0061] like Figure 2 As shown in the figure, the HPLC chromatogram of the fermentation of Panax notoginseng total saponins by Bacteroides fragilis CMLF03 of the present invention for 48 hours, wherein A is the control result of Panax notoginseng total saponins; B is the result of the conversion of Panax notoginseng total saponins at 48 hours. Figure 2 It can be seen that the results of the conversion of Panax notoginseng total saponins are as follows: at the 48th hour, compared with the control group, the ultraviolet absorption peaks of ginsenoside Rb1 and ginsenoside Rd in the experimental group basically disappeared, and two new ultraviolet absorption peaks appeared. After comparing the peak graphs with those of standard samples of escin XVII (Gyp-XVII) and ginsenoside F2, it was determined that the conversion products were Gyp-XVII and ginsenoside F2.

[0062] like Figure 3 As shown in the figure, the HPLC chromatogram of ginsenoside Rb1 fermented by Bacteroides fragilis CMLF03 for 48 hours, wherein A is the control result of Rb1; B is the result of Rb1 conversion at 48 hours. Figure 3 It can be seen that the conversion results of ginsenoside Rb1 are as follows: at 48h, compared with the control group, the ultraviolet absorption peak of ginsenoside Rb1 in the experimental group was greatly reduced, and 3 new ultraviolet absorption peaks appeared. After comparing with the peak graphs of ginsenoside Rd, Gyp-XVII and ginsenoside F2 standards, the conversion products were determined to be ginsenoside Rd, Gyp-XVII and ginsenoside F2.

[0063] like Figure 4 As shown in the figure, the HPLC chromatogram of ginsenoside Rb1 fermented by Bacteroides fragilis CMLF03 for 72 hours, wherein A is the control result of Rb1; B is the result of Rb1 conversion at 72 hours. Figure 4It can be seen that at the 72nd hour, compared with the control group, the ultraviolet absorption peaks of ginsenoside Rb1, ginsenoside Rd, and Gyp-XVII in the experimental group were greatly reduced or disappeared. At this time, the conversion rate of ginsenoside Rb1 was close to 100%, and most of the product was ginsenoside F2.

[0064] like Figure 5 As shown in the figure, the HPLC chromatogram of ginsenoside Rd fermented by Bacteroides fragilis CMLF03 for 36 hours, wherein A is the control result of Rd; B is the result of Rd conversion at 36 hours. Figure 5 It can be seen that the conversion results of ginsenoside Rd are as follows: at the 36th hour, compared with the control group, the ultraviolet absorption peak of ginsenoside Rd in the experimental group basically disappeared, and a new ultraviolet absorption peak appeared. After comparing the peak graph with that of the ginsenoside F2 standard, it was determined that the conversion product was ginsenoside F2.

[0065] In summary, Bacteroides fragilis CMLF03 has a transformation effect on high-content saponins Rb1 and Rd in the genus Panax, and the transformation products are rare saponins aesculoside XVII and ginsenoside F2. The route of transformation of ginsenosides by this Bacteroides fragilis can be summarized as follows: CMLF03 hydrolyzes the terminal glucose group at the C-20 position of ginsenoside Rb1 to generate ginsenoside Rd, and then the terminal glucose group at the C-3 position of ginsenoside Rd is further hydrolyzed to generate ginsenoside F2; in addition, CMLF03 hydrolyzes the terminal glucose group at the C-3 position of ginsenoside Rb1 to generate aesculoside XVII, and the terminal glucose group at the C-20 position of aesculoside XVII is further hydrolyzed to generate ginsenoside F2.

[0066] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A method of treating ginsenoside Rb 1 and ginsenoside Rd to obtain rare saponins esculin XVII and ginsenoside F 2 of Bacteroides fragilis, It is characterized in that The Bacteroides sp. CMLF03 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with the deposit address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is January 25, 2024, and the deposit number is CGMCC NO.41094.

2. A method for fermenting and converting ginsenoside Rb by Bacteroides fragilis as claimed in claim 1 1 And application of ginsenoside Rd.

3. The use according to claim 2, It is characterized in that The products include saponin esculin XVII and ginsenoside F 2 .

4. The use according to claim 3, It is characterized in that Ginsenoside Rb 1 The bioconversion route comprises: as claimed in claim 1, Bacteroides fragilis converts ginsenoside Rb 1 The terminal glucose group at the C-3 position of esculin XVII is hydrolyzed to generate ginsenoside XVII, and the terminal glucose group at the C-20 position of esculin XVII is further hydrolyzed to generate ginsenoside F 2 .

5. The use according to claim 3, It is characterized in that Ginsenoside Rb 1 The bioconversion route comprises: as claimed in claim 1, Bacteroides fragilis converts ginsenoside Rb 1 The terminal glucose group at the C-20 position of ginsenoside Rd is hydrolyzed to form ginsenoside Rd, and then the terminal glucose group at the C-3 position of ginsenoside Rd is further hydrolyzed to form ginsenoside F. 2 .

6. The use according to claim 2, It is characterized in that The fermentation conversion of ginsenoside Rb 1 The method of preparing ginsenoside Rd is as follows: Inoculating the Bacteroides fragilis liquid as claimed in claim 1 into a brain heart infusion liquid culture medium containing saponins, culturing it statically in an anaerobic gas environment at 37° C., and taking the cultured bacterial liquid for a saponin component conversion test; The saponins in the brain heart infusion liquid culture medium containing saponins are 1.5‰ total saponins of Panax notoginseng, 1.5‰ ginsenoside Rb 1 or 0.4‰ ginsenoside Rd.

7. The use according to claim 6, It is characterized in that The preparation method of the brain heart infusion liquid culture medium is as follows: peptone, dehydrated calf brain infusion powder, dehydrated ox heart infusion powder, sodium chloride, glucose, disodium hydrogen phosphate and L-cysteine ​​hydrochloride are mixed, the pH is adjusted to 7.2-7.6, sterilized at 101 kPa and 121° C., cooled after sterilization, and then hemin and vitamins are added.

8. The use according to claim 7, It is characterized in that In each liter of brain heart infusion liquid culture medium, the mass ratio of the peptone, dehydrated calf brain extract powder, dehydrated beef heart extract powder, sodium chloride, glucose and disodium hydrogen phosphate is 10.0:12.5:5.0g:5.0:2.0:2.5; the mass of the L-cysteine ​​hydrochloride is 1.0‰ of the mass of the brain heart infusion liquid culture medium, the mass of the hemin chloride is 0.01‰ of the mass of the brain heart infusion liquid culture medium, and the mass of the vitamin K 1 The mass of the medium is 0.01‰ of the mass of brain heart infusion liquid culture medium.

9. The use according to claim 6, It is characterized in that The composition of the anaerobic gas environment is 5% CO 2 , 5% H 2 and 90% N 2 During the inoculation, the Bacteroides fragilis solution with an absorbance of about 0.7 was mixed with 1.5‰ total saponins of Panax notoginseng and 1.5‰ ginsenoside Rb 1 Or the volume ratio of BHI culture medium to 0.4‰ ginsenoside Rd is (1.0~5.0).

10. The use according to claim 6, It is characterized in that The detection is to use high performance liquid phase to analyze the components of saponin in the bacterial liquid after cultivation.

Images