Primer probe combination and kit for HIV-1 (human immunodeficiency virus-1) nucleic acid detection

Abstract

The invention relates to the field of biological detection, in particular to a primer probe combination and a kit for HIV-1 (human immunodeficiency virus-1) nucleic acid detection. The primer combination provided by the invention comprises a primer group I and / or a primer group II, the primer group I has a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 4; the primer group II has a nucleotide sequence as shown in any of SEQ ID NO: 5 to SEQ ID NO: 8. The kit provided by the invention can be stored for 1 year at 2-8 DEG C, and has good stability. Meanwhile, the detection method and the kit provided by the invention have the advantages of strong specificity, high sensitivity, simplicity and convenience in operation, clear result, high reliability and wide coverage. The invention has potential application prospects in detection and identification of HIV-1 and auxiliary diagnosis of HIV infected persons, and has great influence on prevention and treatment of AIDS and public health.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a primer-probe combination and a kit for HIV-1 nucleic acid detection. Background Art

[0002] Human Immunodeficiency Virus (HIV) is a slow virus that can infect human immune system cells. After being infected with HIV, the immune system is damaged and gradually becomes the target of many opportunistic diseases, leading to a variety of clinical symptoms, namely Acquired Immune Deficiency Syndrome (AIDS), also known as AIDS. Based on serological reactions and viral nucleic acid sequence determination, the HIV viruses discovered in the world can be divided into HIV-1 and HIV-2.

[0003] There is 45% homology in the nucleotide sequence between HIV-1 and HIV-2, and there is an immune cross-reaction. Within HIV-1, according to the homology of the env gene encoding the envelope protein and the gag gene encoding the capsid protein, it is further divided into three groups: M, N and O, P. Group M virus is the main strain of HIV prevalence worldwide, which can be further divided into 9 subtypes, A, B, C, D, F, G, H, J and K, and a variety of recombinant epidemic recombination patterns (CRFs). The prior art usually only covers individual common epidemic recombinant types.

[0004] Current medical technology still does not have a complete cure for AIDS, so preventing and controlling the spread of AIDS is an important measure at present.

[0005] After HIV infection, the viral markers that appear in the blood are HIV-1 RNA, HIV-1 p24 antigen, and HIV-1 antibodies, respectively. The gold standard for diagnosis is serological antibody testing. Since there is a window period from HIV infection to the production of antibodies in the body, the window period for detecting HIV antibodies, antigens, and nucleic acids with existing diagnostic technology is about 3 weeks, 2 weeks, and 1 week after infection, respectively. In order to effectively detect HIV infection during the "window period", people have established nucleic acid detection technology to achieve early diagnosis of HIV infection by taking advantage of the early nucleic acid response in the blood, high viral load, and stable presence of viral RNA in the body in the early stages of infection. This can significantly shorten the window period of HIV infection and provide real-time quantitative monitoring of viral load during the course of the disease.

[0006] TaqMan probe technology is a highly specific fluorescent quantitative PCR technology. The target segment length for nucleic acid detection using Taqman probe technology is generally within 150bp, so it is often detected by finding a relatively conservative region from a gene through multiple sequence alignment. Different genes have different mutation rates, among which env has the highest mutation rate, which can reach 30%. Compared with the env region, LTR, pol, and gag are relatively conservative, with mutation rates of 3%, 5%, and 6%, respectively. HIV-1 generally selects the LTR region, pol gene, and gag gene.

[0007] Due to the large number of HIV-1 virus subtypes and complex gene sequence variations, it is difficult to amplify all HIV subtypes with one pair of primers. Therefore, low primer coverage will result in missed detection or inaccurate quantification between various subtypes, especially when the gene sequences of other subtypes such as A, CRF01_AE, CRF07_BC, CRF08_BC, and D are quite different, this technical defect will be more obvious. Currently, there are some real-time fluorescence quantitative PCR based on TaqMan probe technology on the market for HIV-1 detection kits, which can cover HIV-1 M, N, O group subtypes and a few popular recombinant types. The kits cannot cover all HIV-1 subtypes and often miss detection.

[0008] According to the HIV Datebase database, there are currently 143 prevalent recombinant types (CRFs). HIV-1 has many types, high mutation rates, and rapid recombination. The prevalent strains in different countries are different. However, whether HIV subtype detection covers a comprehensive range is of great significance for early diagnosis and treatment, and can minimize the missed detection rate of HIV infection. Summary of the invention

[0009] In view of this, the present invention provides a primer-probe combination and a kit for HIV nucleic acid detection. The kit provided by the present invention can be stored at 2-8°C for 1 year and has good stability. At the same time, the detection method and the kit of the present invention have strong specificity, high sensitivity, simple operation, clear results and high reliability. The present invention has potential application prospects for the detection and identification of HIV-1 and the auxiliary diagnosis of HIV-infected people, and has a significant impact on AIDS prevention and treatment and public health.

[0010] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0011] The present invention provides a primer combination, including primer group I and / or primer group II;

[0012] The primer set I has: a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 4;

[0013] The primer set II has: a nucleotide sequence as shown in any of SEQ ID NO:5 to SEQ ID NO:8.

[0014] In some embodiments of the present invention, in the above primer combination, the primer group I includes: primer group I-I and primer group I-II;

[0015] The primer set Ⅰ-Ⅰ has: the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0016] The primer sets I-II have: nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4;

[0017] The primer set II includes: primer set II-I and primer set II-II;

[0018] The primer set II-I has: the nucleotide sequences shown in SEQ ID NO:5 and SEQ ID NO:6;

[0019] The primer set II-II has the nucleotide sequences shown in SEQ ID NO:7 and SEQ ID NO:8.

[0020] In some embodiments of the present invention, in the above primer combination, the nucleotide sequence is modified with a methoxy group.

[0021] In some embodiments of the present invention, in the above primer combination, the methoxy group is located at the 1st to 3rd positions close to the 3' end of the nucleotide sequence.

[0022] In some embodiments of the present invention, in the above primer combination, the primer group I amplifies the LTR conservative region of the HIV gene sequence; and the primer group II amplifies the pol conservative region of the HIV gene sequence.

[0023] The present invention also provides a probe combination, comprising: probe I and / or probe II;

[0024] The probe I has: a nucleotide sequence as shown in SEQ ID NO:9 and / or SEQ ID NO:10;

[0025] The probe II has: a nucleotide sequence as shown in SEQ ID NO:11 and / or SEQ ID NO:12.

[0026] In some embodiments of the present invention, in the above-mentioned probe combination, the nucleotide sequence is modified with a locked nucleic acid.

[0027] In some embodiments of the present invention, in the above-mentioned probe combination, the number of the locked nucleic acids is 1 to 3.

[0028] In some embodiments of the present invention, in the above probe combination, the locked nucleic acid is located at positions 10 to 12 near the 5' end of the nucleotide sequence.

[0029] The present invention also provides a primer-probe set, comprising: the above primer combination and the above probe combination.

[0030] The present invention also provides a detection reagent, comprising: the above primer combination, the above probe combination and / or the above primer probe set and an acceptable auxiliary agent.

[0031] In some embodiments of the present invention, the above-mentioned detection reagent further includes: one or more of: PCR reaction solution, proteinase K, internal standard, calibrator and quality control product.

[0032] In some embodiments of the present invention, in the above-mentioned detection reagent, the PCR reaction solution includes: one or more of a buffer, potassium ions, glycerol, DMSO, Tween 20, DNA polymerase, manganese ions and NaN3.

[0033] In some embodiments of the present invention, in the above detection reagent, the PCR reaction solution comprises:

[0034]

[0035] In some embodiments of the present invention, in the above detection reagent, the buffer comprises a Tricine buffer with a pH value of 7.4 to 8.8; the Tricine buffer (3 to 6 mM) is mainly composed of Tricine and deionized water, to which potassium hydroxide solution is added to adjust the pH to the desired value.

[0036] In some embodiments of the present invention, in the above detection reagent, the potassium ions are added in the form of KOAc.

[0037] In some embodiments of the present invention, in the above detection reagent, the concentration of manganese acetate is 10-1000 mM / L.

[0038] In some embodiments of the present invention, in the above detection reagent, the internal standard includes: an internal standard primer and / or an internal standard probe;

[0039] The internal standard primer has: a nucleotide sequence as shown in any of SEQ ID NO: 13 to SEQ ID NO: 16;

[0040] The internal standard probe has a nucleotide sequence as shown in SEQ ID NO: 17 or SEQ ID NO: 18.

[0041] In some embodiments of the present invention, in the above detection reagent, the internal standard also includes an internal standard sequence, and the internal standard sequence has: a nucleotide sequence as shown in SEQ ID NO:19.

[0042] The present invention also provides the use of the above primer combination, the above probe combination, the above primer probe set and / or the above detection reagent in any of the following items;

[0043] (I) Preparation of products for detecting human immunodeficiency virus; and / or

[0044] (II) detection of human immunodeficiency virus; and / or

[0045] (III) Screening of antiviral drugs for acquired immunodeficiency syndrome; and / or

[0046] (IV) Preparation of products for screening antiviral drugs for acquired immunodeficiency syndrome; and / or

[0047] (V) Monitoring the therapeutic effects of antiviral drugs for acquired immunodeficiency syndrome.

[0048] In some embodiments of the present invention, in the above application, the detection includes: mixing and amplifying the sample to be tested with the detection reagent to obtain a detection result.

[0049] In some embodiments of the present invention, in the above application, the reaction conditions for the amplification include: the reaction conditions for the amplification include: thermal activation at 90-95°C for 30-90s, two-stage reverse transcription at 58-60°C for 5-15min, and 61-65°C for 5-15min.

[0050] The present invention also provides a detection kit, comprising: the above primer combination, the above probe combination, the above primer probe set and / or the above detection reagent and an acceptable device and / or carrier.

[0051] The present invention also provides a method for screening antiviral drugs for acquired immunodeficiency syndrome for non-diagnostic purposes, wherein the sample to be tested is mixed with the above-mentioned detection reagent and / or the above-mentioned detection kit, and amplified to obtain the detection result.

[0052] In some embodiments of the present invention, in the above method, the reaction conditions of the amplification include: reaction at 50-52°C for 1-2 min, reaction at 90-95°C for 30-90 s, reaction at 58-60°C for 5-15 min, reaction at 61-65°C for 5-15 min, 90-95°C for 1-3 min, 90-95°C for 10 s→55-60°C for 22 s, cycle 45 times, and collect signals of fluorescence channels at 55-60°C.

[0053] Currently, the types of manufacturers on the market cover subtypes including HIV-1 M, N, and O groups, of which the M group includes 11 subtypes, including A, B, C, D, E, F, G, H, I, J, and K. The types covered by some manufacturers are summarized as follows:

[0054]

[0055] So far, there are 143 kinds of epidemic recombinant types (CRFs) in the world. The HIV prevalent in China is mainly M group HIV-1, and its genotypes are mainly B / B', CRF 07_BC recombinant type, CRF 08_BC recombinant type, CRF 01_AE recombinant type. CRF 01_AE recombinant type, CRF 02_AG recombinant type, CRF 14_BG recombinant type, 04_cpx recombinant type, 06_cpx recombinant type, etc. account for a certain proportion in the world, and many countries have a trend that the proportion of epidemic recombinant types is higher than that of a single subtype.

[0056] At the same time, in terms of sensitivity, the current domestic HIV-1 nucleic acid testing products have sensitivities of 25IU / mL, 30IU / mL, 50IU / mL, 100IU / mL, etc., and the sensitivity expectations for acute infection testing are higher.

[0057] The beneficial effects of the present invention include:

[0058] 1. The detection kit provided by the present invention can be stored at 2-8°C for 1 year, while other reagents are usually stored frozen at below -20°C.

[0059] 2. The detection kit provided by the present invention has high sensitivity: the principle of the method of the present invention is based on the principle of TaqMan hydrolysis probe fluorescent PCR, with viral HIV-1 RNA as a template, using viral genome specific primer probes, assisted by DNA polymerase and UNG enzyme, and through a one-step fluorescent RT-PCR experiment, the human immunodeficiency virus type 1 (HIV-1) RNA template can be quickly and accurately analyzed; from reverse transcription to fluorescent PCR, it can be completed in one step, which can effectively prevent multiple operation contamination. Therefore, the detection method and kit of the present invention have strong specificity, high sensitivity, simple operation, clear results, and high reliability, and can be used for quantitative detection of human immunodeficiency virus type 1 (HIV-1) RNA in serum. Experiments have shown that the detection of HIV-1 using the complete set of reagents provided by the present invention has good specificity and high sensitivity (sensitivity reaches 20IU / mL).

[0060] 3. The detection kit provided by the present invention covers a full range of types (CRF 01_AE recombinant type, CRF 02_AG recombinant type, CRF 07_BC recombinant type and CRF 08_BC recombinant type, etc.) and has high specificity: the present invention is based on the molecular biological detection method PCR technology, which can cover a set of primer pairs for HIV nucleic acid detection of various subtypes of strains. And by using plasma specimens of the main HIV epidemic strains in my country and specimens of other viruses (HBV, HCV), the set of primer pairs was specifically identified, proving that the set of primer pairs of the present invention can effectively detect the main HIV-1 epidemic strains, is suitable for nucleic acid detection of various subtypes of strains, and has no cross-reaction with HBV and HCV, and can be used for the design and development of HIV-1 nucleic acid diagnostic reagents. The present invention has potential application prospects for the detection and identification of HIV-1 and the auxiliary diagnosis of HIV-infected people, and has a significant impact on AIDS prevention and treatment and public health. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0062] Figure 1 Shows the results of sensitivity experiments;

[0063] Figure 2 The sample linearity test results are shown;

[0064] Figure 3 Show specific experimental results;

[0065] Figure 4 Shows the results of the WHO typing disk test;

[0066] Figure 5 The validation results of different popular recombinant types and strains of the reagent of the present invention are shown;

[0067] Figure 6 The figure shows the verification results of different popular recombinant types and strains in the existing technology; among them: green is the internal standard, blue is the target;

[0068] Figure 7 The results of parallel comparison of the reagent of the present invention and the same sample in the prior art by gradient dilution are shown; wherein: the target of the reagent of the present invention is shown on the top; the internal standard of the reagent of the present invention is shown in the middle; the target and internal standard of comparison group 1 are shown on the bottom;

[0069] Figure 8 Shown is the spatial structure of the POL target segment at 25°C;

[0070] Fig. 9 Shown is the spatial structure of the POL target segment at 35°C;

[0071] Fig.10Shown is the spatial structure of the POL target segment at 45°C;

[0072] Fig.11 Shown is the spatial structure of the POL target segment at 55°C;

[0073] Fig.12 Shown is the spatial structure of the POL target segment at 60°C;

[0074] Fig.13 The spatial structure of the POL target segment at 65°C is shown;

[0075] Fig.14 Shown is the spatial structure of the LTR target segment at 60°C;

[0076] Fig.15 Shown is the spatial structure of the LTR target segment at 65°C;

[0077] Fig.16 Showing the prior art LTR primer probe set 1 sequence crossover analysis;

[0078] Fig.17 Showing the prior art LTR primer probe set 2 sequence crossover analysis;

[0079] Fig.18 Showing the prior art GAG primer probe set 1 sequence crossover analysis;

[0080] Fig.19 The theoretical Tm value of the reagent probe LTR-P2 of the present invention when the nucleic acid is not modified is shown. DETAILED DESCRIPTION

[0081] The invention discloses a primer-probe combination and a kit for HIV-1 nucleic acid detection.

[0082] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0083] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0084] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0085] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0086] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0087] The present invention provides a human immunodeficiency virus (HIV) nucleic acid detection kit, which includes at least two sets of primer probes, and the at least two sets of primer probes are respectively from different conserved regions. Each set of primer probes refers to an upstream primer sequence, a downstream primer sequence and a probe sequence.

[0088] The present invention designs and combines two sets of primers and probes in two different regions to prepare a reaction system for joint detection of HIV-1 RNA to identify the presence of a positive reaction, effectively reducing the probability of missed detection, and can more comprehensively cover all subtypes (including all subtypes of HIV-1 M, N, and O groups) and a variety of popular recombinant types, and further improve detection sensitivity and more accurately quantify.

[0089] Preferably, the conserved region includes the relatively conserved region POL gene and LTR region of HIV gene. In a specific embodiment, the primer probe sequence in the LTR is LTR1 or LTR2, and the primer probe sequence in the POL is POL1 or POL2. Most preferably, the primer probe sequences used in the kit are LTR1 and POL1. The kit of the present invention has good specificity due to the use of the above-mentioned primers and / or probe sequences for detecting target polynucleotides.

[0090] Furthermore, the kit of the present invention also includes an internal standard, and the internal standard sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTAT TCGTAGCCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3' (as shown in SEQ ID NO: 19). The internal standard has no intersection with the HIV sequence, and the internal standard primer probe design has no non-specific amplification, which plays a synergistic role in the target amplification effect. Among them, it is further preferred that the kit also includes an internal standard probe sequence present in the PCR reaction solution, and the probe sequence is: 5'-TTTTGCTGACTCACGTATTCGTAGCCAA-3' (as shown in SEQ ID NO: 20).

[0091] Since PCR amplification is easily affected by various factors, such as inhibitors in the sample, experimental operation or instrument problems, which may lead to amplification failure, the kit user may draw the wrong conclusion that the sample is negative. In order to avoid the occurrence of such false negatives, the present invention uses a positive internal control (internal standard), that is, the internal standard is added when the nucleic acid is extracted from the sample, and goes through the steps of lysis, magnetic bead adsorption, washing, amplification, detection, etc. together with the sample.

[0092] It is further preferred that the kit further comprises an RT-PCR enhancer, namely manganese acetate with a concentration of 10 to 1000 mM / L.

[0093] The present invention further provides a human immunodeficiency virus nucleic acid detection kit, which comprises a set of primer probe sequences, and the primer probe sequences are selected from any one of LTR1, LTR2, POL1 and POL2.

[0094] The kit of the invention can be used for auxiliary diagnosis of human immunodeficiency virus type 1 infection and observation of the therapeutic effect of antiviral drug treatment of acquired immunodeficiency syndrome.

[0095] The kit provided by the present invention comprises: reagents (including PCR reaction solution 1, PCR reaction solution 2, proteinase K, internal standard), calibrators, and quality control products.

[0096] The present invention designs multiple sets of primer probes for LTR and pol dual targets for HIV-1 conservative regions for joint detection to identify the presence of positive reactions, effectively reducing the probability of missed detection, and can more comprehensively cover various subtypes of HIV-1 and various popular recombinant types, and further improve detection sensitivity and more accurately quantify. The kit includes at least two sets of primer probes from LTR and pol.

[0097] The conserved region includes the relatively conserved region LTR region and POL gene of HIV gene.

[0098] Design the primer probe sequences as follows:

[0099] LTR1:

[0100] Upstream primer LTR-F1: 5'-GGTCTCTCTRGTTAGACCAG-3' (as shown in SEQ ID NO: 1), downstream primer LTR-R1: 5'-ATTGAGGCTTAAGCAGTGGG-3' (as shown in SEQ ID NO: 2), probe LTR-P1: 5'-GAGCCTGGGAGCTCTCTGGCT-3' (as shown in SEQ ID NO: 9);

[0101] LTR2:

[0102] Upstream primer LTR-F2: 5'-TCTCTCTRGTTAGACCAGAT-3' (as shown in SEQ ID NO: 3), downstream primer LTR-R2: 5'-TGAGGCTTAAGCAGTGGGTT-3' (as shown in SEQ ID NO: 4), probe LTR-P2: 5'-CCTGGGAGCTCTCTGGCTAAC-3' (as shown in SEQ ID NO: 10);

[0103] POL 1:

[0104] Upstream primer POL-F1: 5'-CATGGACAAGTAGACTGTAGT-3' (as shown in SEQ ID NO: 5), downstream primer POL-R1: 5'-TAGGGAATTCCAAATTCCTG-3' (as shown in SEQ ID NO: 6), probe POL-P1: 5'-GCAGAAACAGGGCAGGAAACAGC-3' (as shown in SEQ ID NO: 11);

[0105] POL 2:

[0106] Upstream primer POL-F2: 5'-TGTAGTCCAGGAATATGGCA-3' (as shown in SEQ ID NO: 7), downstream primer POL-R2: 5'-CAAATTCCTGCTTKATTCCC-3' (as shown in SEQ ID NO: 8), probe POL-P2: 5'-TCCTGGTAGCAGTTCATGTAGCCAGTG-3' (as shown in SEQ ID NO: 12);

[0107] Design the internal standard sequence, and amplify the internal standard primer probe set 1 for detecting the internal standard:

[0108] Upstream primer internal standard-F1: 5'-GGTAGCTGCTCGCGGATCA-3' (as shown in SEQ ID NO: 13), downstream primer internal standard-R1: 5'-GACCACTCGTGTGCTTTCGT-3' (as shown in SEQ ID NO: 14), probe internal standard-P1: 5'-ACCTCGGGTTTCCTGCTTGCTCGT-3' (as shown in SEQ ID NO: 17);

[0109] The internal standard primer probe set 2 for amplifying and detecting the internal standard is:

[0110] Upstream primer internal standard-F2: 5′-CGGCTGCTCGCGGATAC-3′ (as shown in SEQ ID NO: 15), downstream primer internal standard-R2: 5′-CGCTGAAGAACTTGCGTTCTC-3′ (as shown in SEQ ID NO: 16), probe internal standard-P2: 5′-ACCTCGGGTTTCCGTCTTGCTCGT-3′ (as shown in SEQ ID NO: 18);

[0111] In the primer probe sequence, for the LTR target: 8 different combinations can be generated:

[0112] (1)LTR-F1+LTR-R1+LTR-P1;

[0113] (2) LTR-F2+LTR-R1+LTR-P1;

[0114] (3)LTR-F1+LTR-R1+LTR-P2;

[0115] (4) LTR-F2+LTR-R1+LTR-P2;

[0116] (5)LTR-F1+LTR-R2+LTR-P1;

[0117] (6)LTR-F1+LTR-R2+LTR-P2;

[0118] (7)LTR-F2+LTR-R2+LTR-P1;

[0119] (8)LTR-F2+LTR-R2+LTR-P2;

[0120] The above 8 combinations can all be amplified normally. Experimental verification has confirmed that LTR1 and LTR2 have better effects, and the same is true for pol and internal standard. In addition, through the combination of two sets of primers and probes in different regions, namely LTR1+POL1, LTR2+POL1, LTR1+POL2, LTR2+POL2, the above combinations can achieve equal efficiency amplification of each subtype of HIV-1 M, O, and N groups, avoiding missed detection between subtypes. A comprehensive comparison of the above 4 combinations shows that the combination LTR1+POL1 has the best effect in terms of detection sensitivity and fluorescence amplification height performance.

[0121] In the present invention, the raw materials and reagents used can be purchased from the market.

[0122] The present invention will be further described below in conjunction with embodiments:

[0123] Example 1

[0124] This kit includes: reagent strips (containing PCR reaction solution 1, PCR reaction solution 2, proteinase K, internal standard), calibrators, and quality control products.

[0125] 1. PCR reaction solution 1

[0126] Table 1 Preparation of PCR reaction solution 1

[0127] Component name concentration Concentration combination 1 Concentration combination 2 Concentration combination 3 Tricine(PH8.3) 3~6mM 3mM 4.5mM 6mM KK 0.05～0.2M 0.05M 0.125M 0.2M Glycerine 0.1％～0.5％ 0.10％ 0.30％ 0.50％ DMSO 1％～5％ 1％ 3％ 5％ Tween20 0.005％～0.02％ 0.005％ 0.0125％ 0.02％ NaN3 0.008％～0.03％ 0.008％ 0.019％ 0.03％ dNTP 20~50mM 20mM 35mM 50mM UDG 1～5U 1U 3U 5U TthDNA polymerase 5～30U 5U 17.5U 30U LTR-F 80~200μM 80μM 140μM 200μM LTR-R 80~200μM 80μM 140μM 200μM LTR-P 80~200μM 80μM 140μM 200μM POL-F 80~200μM 80μM 140μM 200μM POL-R 80~200μM 80μM 140μM 200μM POL-P 80~200μM 80μM 140μM 200μM Internal Standard-F 80~150μM 80μM 115μM 150μM Internal Standard-R 80~150μM 80μM 115μM 150μM Internal Standard-P 80~150μM 80μM 115μM 150μM

[0128] In the solution in Table 1, Tricine is used to prepare the buffer solution, with an effective buffer range of 7.4-8.8; Potassium acetate mainly provides potassium ions required for the reaction; Glycerol can enhance specificity in the PCR system, inhibit the formation of primer dimers, reduce the template dissolution temperature Tm, and increase the amount of amplified products, but excessive amounts have an inhibitory effect on enzyme activity; DMSO can also enhance specificity and inhibit the formation of primer dimers. Appropriate concentrations of DMSO can significantly improve the specificity and efficiency of PCR amplification; Tween 20 is a non-ionic detergent that can reduce DNA secondary structure and increase the amplification of template genes; Tth DNA polymerase has DNA polymerase activity and reverse transcriptase activity. It has higher heat resistance than Taq enzyme and has a better effect on PCR with high GC content templates.

[0129] For the preparation of PCR reaction solution 1, the concentration combinations 1 to 3 shown in Table 1 can achieve similar effects:

[0130] Table 2

[0131]

[0132]

[0133] From the results in Table 2, it can be seen that positive samples 1-6 and negative sample 7 were detected under different component concentration combinations. Positive samples of different concentrations were all detected, and the negative detection was No Ct. The results were similar and there was no significant difference, and all met the detection requirements.

[0134] Table 3

[0135]

[0136] The results in Table 3 show that excessive glycerol has an inhibitory effect on enzyme activity, which reduces the amplification efficiency and causes the sample Ct value to decline and low-value samples to be missed.

[0137] Table 4

[0138]

[0139]

[0140] The results in Table 4 show that not adding DMSO or adding a large amount of DMSO can lead to a decrease in amplification efficiency, a decline in sample Ct values, and missed detection of low-value samples.

[0141] The base sequences of the primers and probes in Table 1 are:

[0142] Upstream primer LTR-F1: 5'-GGTCTCTCTRGTTAGACCAG-3',

[0143] Downstream primer LTR-R1: 5'-ATTGAGGCTTAAGCAGTGGG-3',

[0144] Probe LTR-P1: 5′-GAGCCTGGGAGCTCTCTGGCT-3′;

[0145] Upstream primer POL-F1: 5'-CATGGACAAGTAGACTGTAGT-3',

[0146] Downstream primer POL-R1: 5'-TAGGGAATTCCAAATTCCTG-3',

[0147] Probe POL-P1: 5′-GCAGAAACAGGGCAGGAAACAGC-3′;

[0148] Design internal standard sequence, internal standard primer probe set 1:

[0149] Upstream primer internal standard-F1: 5'-GGTAGCTGCTCGCGGATCA-3',

[0150] Downstream primer internal standard-R1: 5'-GACCACTCGTGTGCTTTCGT-3',

[0151] Probe internal standard-P1: 5′-ACCTCGGGTTTCCTGCTTGCTCGT-3′;

[0152] The 5' end of the probe is labeled with a CY5 fluorescent reporter group. In fact, the target nucleotide probe does not necessarily have to be labeled with CY5, and other fluorescent reporter groups such as FAM can also be used. The internal standard probe is labeled with ROX fluorescence, and its detection signal can be distinguished from the CY5 fluorescent group for detecting HIV RNA. Other fluorescent reporter groups such as HEX can also be used.

[0153] 2. PCR reaction solution 2

[0154] Table 5 Preparation method of PCR reaction solution 2

[0155] Component name concentration <![CDATA[Mn 2+ ]]> 1~5mM NaN3 0.008%~0.02%(g / mL)

[0156] Mn in the above solution 2+ Provides the ions required for enzyme activity, and the concentration is critical to enzyme activity.

[0157] Table 6

[0158]

[0159]

[0160] The results in Table 6 show that Mn 2+ The results of concentrations from 1 to 5 mM were similar with no significant differences, and both met the detection requirements.

[0161] 3. Proteinase K solution, containing proteinase K, which is required for sample lysis to release nucleic acids.

[0162] 4. Internal standard: The internal standard sequence is artificially designed, synthesized, and purified internal standard DNA fragment is connected to T and then transformed and cloned. The plasmid is extracted to obtain a recombinant plasmid containing the internal standard fragment, and then armored RNA, i.e., RNA pseudovirus, is synthesized.

[0163] 5. The sequence of the internal standard is shown in SEQ ID NO:19.

[0164] The internal standard pseudovirus was diluted 500,000 times and then the concentration was calibrated. The finished product concentration was calculated according to the standard curve = dilution factor * calibration concentration, and diluted to 3.12E+05 copies / mL as the internal standard of the kit. When the HIV test is negative, if the internal standard test is positive, it means that the PCR amplification reaction in the reaction system is normal and the HIV test is true negative; if the HIV test is negative and the internal standard is also negative, it means that there may be inhibition in the sample, or there is an abnormality in the PCR amplification reaction, which is a false negative HIV test and needs to be retested. Therefore, the use of internal standards can effectively avoid false negative test results.

[0165] 6. Calibrator: Use negative serum to dilute the pseudovirus containing the HIV-1 target sequence. The human immunodeficiency virus quantitative reference includes a gradient reference consisting of four concentrations from S1 to S4, and the concentrations are S1: 1.00~6.00E+03IU / mL; S2: 1.00~6.00E+04IU / mL; S3: 1.00~6.00E+05IU / mL; S4: 1.00~6.00E+06IU / mL;

[0166] 7. Quality control products: including negative quality control products, weak positive quality control products, and strong positive quality control products. The negative control contains HIV-1 negative serum or plasma matrix. The positive control is a pseudovirus containing HIV-1 target gene sequence with a calibrated known concentration, which is diluted and released using the negative matrix. The concentration of the weak positive quality control product is 1.00E+02IU / mL~1.00E+03IU / mL; the concentration of the strong positive quality control product is 1.00E+05IU / mL~1.00E+06IU / mL, and the negative matrix is ​​inactivated serum or plasma that is negative for HBV DNA, HCV RNA, and HIV-1RNA nucleic acids.

[0167] 8. The armored pseudoviruses for quantitative reference and quality control products are artificially synthesized by Xiamen Zhishan Biotechnology Co., Ltd. from the HIV-1 target gene sequence, the pseudovirus expression vector is constructed, and the pseudovirus particles containing the target gene are prepared. The pseudovirus contains the HIV-1 LTR region and the POL gene conserved sequence.

[0168] Example 2 Method of using the kit of the present invention

[0169] Use the fully automatic nucleic acid purification and real-time fluorescence PCR analysis system of Antu Biotechnology Co., Ltd., check the consumables as required and complete the loading of the kit and samples. Negative controls, strong positive controls, and weak positive controls should be set up for each test. Use nucleic acid extraction or purification reagents of Antu Biotechnology Co., Ltd. to extract nucleic acids, and directly perform fluorescence quantitative RT-PCR detection on the extracted HIV-1 RNA. Quality control products are also involved in the extraction. The DNA polymerase in the reaction system can be reverse transcribed and PCR amplified in the same reaction system. With the real-time fluorescence quantitative PCR instrument, closed tube detection is performed. The real-time fluorescence detection mode of Taqman probe is used. The probe labeled with cy5 fluorescent group is designed and synthesized in the target gene amplified by PCR, and the probe labeled with ROX fluorescent group is designed and synthesized in the internal standard gene. It is added to the RT-PCR reaction solution for real-time fluorescence detection.

[0170] The present invention uses the nucleic acid extraction or purification reagent of Antu Bioengineering Co., Ltd. (Yu Zheng Xie Bei No. 20180037), uses a guanidine salt solution to release the nucleic acid in the sample, and then uses specific magnetic beads to adsorb the nucleic acid. At the same time, the residual protein and salt are removed by washing with a washing solution, and finally the nucleic acid adsorbed on the specific magnetic beads is eluted with an eluent under high temperature conditions, and the extracted or purified nucleic acid is detected.

[0171] Nucleic acid extraction efficiency includes nucleic acid purity, nucleic acid extraction yield and integrity.

[0172] Table 7

[0173] sample 1 2 3 4 5 6 7 8 A260 / 280 1.78 1.80 1.91 1.76 1.85 1.88 1.92 1.96

[0174] As shown in the results in Table 7, 8 different positive samples were extracted, and the A260 / 280 ratio of the nucleic acid extract was measured by a spectrophotometer, all of which were above 1.80 to meet the detection requirements (CNAS-GL039 (20190215) 6.3.1.3 Judgment standard: when the substance to be tested is RNA, the A260 / 280 ratio is 1.8-2.0).

[0175] The amplification system of the real-time fluorescence quantitative PCR kit for human immunodeficiency virus HIV-1 RNA in practical applications can be 30 to 120 μL. In this embodiment, the amplification detection system takes an 80 μL amplification system as an example: it includes 120 μL of PCR reaction solution, 220 μL of PCR reaction solution, and 40 μL of nucleic acid to be detected.

[0176] The sample nucleic acid extraction, system construction, and amplification processes were all performed using the fully automated nucleic acid purification and real-time fluorescence PCR analysis system of Antu Biotechnology Co., Ltd. The reaction procedure of this reagent is as follows:

[0177] The reaction was performed at 50°C for 1 min, at 95°C for 30 s, at 58°C for 10 min, at 61°C for 10 min, at 95°C for 2 min, at 95°C for 10 s → at 60°C for 22 s, for 45 cycles, and the signals of the ROX and CY5 fluorescence channels were collected at 60°C;

[0178] After the instrument PCR program is completed, the software automatically calculates the HIV-1 RNA content (IU / mL) of each sample extract in combination with the standard curve. The results are saved and the data is analyzed. At the same time, the Ct value of the internal reference gene detection in each sample reaction tube is determined to be within the range of <40 to avoid false negative test results.

[0179] The kit of the present invention adopts real-time fluorescence quantitative PCR technology, collects fluorescence signals at a specific temperature in each cycle, and uses the Ct value of the known concentration standard to make a standard curve, so as to calculate the concentration of other unknown samples in this experiment. This kit is provided with 4 quantitative reference products of different concentration levels. The unknown sample and the quantitative reference product are reacted in the same fluorescence PCR experiment, and the instrument will automatically construct a standard curve, through which the amount of the unknown sample can be inferred.

[0180] For samples that test negative, the internal standard Ct value should be ≤40 and have an obvious S-shaped amplification curve (ROX channel). If the internal standard Ct value of a negative sample is >40, retesting is required. For positive samples with an obvious S-shaped amplification curve in the target channel, the detection concentration can be obtained directly on the instrument.

[0181] Figure 1 HIV-1 RNA national standard (220021-20160101) was used to dilute to 20 IU / mL, and the test was repeated in 20 wells, with a detection rate of 100%.

[0182] Table 8

[0183]

[0184]

[0185] Table 8 Figure 2 For serial dilutions using high concentration pseudovirus, the linear correlation coefficient |r|>0.99.

[0186] Figure 3 The scheme of the present invention detected 10 HBV DNA-positive samples and 10 HCV RNA-positive samples, and the internal standard normal amplification targets were all No Ct, indicating high specificity.

[0187] Table 9

[0188] sample batch number Ct value HIV-1 NAT Subtype A 11 / 150 35.80 HIV-1 NAT Subtype B 11 / 152 35.38 HIV-1 NAT Subtype C 11 / 154 35.24 HIV-1NATSubtypeD 11 / 156 34.96 HIV-1 NAT Subtype A / E 11 / 158 35.62 HIV-1NATSubtypeF 11 / 160 35.23 HIV-1NATSubtypeG 11 / 162 35.41 HIV-1NATSubtypeAG-GH 11 / 164 35.60 HIV-1NATGroupN 11 / 166 36.08 HIV-1NATGroupO 11 / 168 35.73

[0189] Table 9 Figure 4 In order to dilute the WHO typing plate sample to the detection limit concentration, the scheme of the present invention can achieve the detection of all types.

[0190] Compared with the other amplified regions of LTR and POL (amplified regions of comparison group 1), the scheme of the present invention is superior to comparison group 1 in terms of coverage and detection limit.

[0191] Comparison group 1 is as follows:

[0192] Comparative group 1-LTR-F1: 5'-AGCTTGCCTTGAGTGCTTCA-3' (as shown in SEQ ID NO: 21),

[0193] Comparative group 1 -LTR-R1: 5'-AGTGGTCTGAGGGATCTCTAGTTAC-3' (as shown in SEQ ID NO: 22),

[0194] Comparative group 1 -LTR-P1: 5'-AGTCACACAACAGACGGGCACACACT-3' (as shown in SEQ ID NO: 23);

[0195] Comparative group 1-POL-F1: 5'-GACATAATAGCAACAGACATACAAACTA-3' (as shown in SEQ ID NO: 24),

[0196] Comparative group 1-POL-R1: 5'-ACTGCCCCTTCACCTTTCC-3' (as shown in SEQ ID NO: 25),

[0197] Comparative group 1-POL-P1: 5'-TCTCTGCTGTCCCTGTAATAAACCCG-3' (as shown in SEQ ID NO: 26).

[0198] Table 10 Figure 5-6 The present invention verifies the results of different popular recombinant types and strains. The present invention verifies the synthetic CRF 01_AE recombinant type, CRF 02_AG recombinant type, CRF 07_BC recombinant type, CRF 08_BC recombinant type, 55_01B type, A6 type, CRF 60_BC recombinant type, and 06_cpx recombinant type plasmids, and they can be detected normally at low concentrations, covering more types.

[0199] Table 10

[0200]

[0201] Table 11 Figure 7 This is a parallel comparison between the present invention and comparison group 1 under the same sample gradient dilution condition.

[0202] Table 11

[0203]

[0204] Figure 7 Table 11 shows that the reagent in this case can still be detected at the maximum dilution multiple, the Ct value is advanced, the amplification efficiency is high, and there is one well missed in the comparison group 1, and the amplification curves of different concentrations are not clearly distinguished. When the low concentration is diluted 10,000 to 40,000 times, the Ct value does not reflect the concentration gradient, indicating that the reagent in this case has higher sensitivity and better linearity.

[0205] Table 12

[0206]

[0207]

[0208] Table 12 shows that the reagent in this case can still be detected at 37 degrees for 7 and 14 days, and the Ct value has no significant change, indicating that the reagent in this case has good stability.

[0209] Verification Example 1

[0210] (1) React at 50-52℃ for 1-2 minutes. The UNG enzyme in the system is active because UDG can cleave the N-sugar bond between the uracil base and the sugar phosphate backbone, remove dU and prevent the extension of TaqDNA polymerase, thus losing the ability to be re-amplified. UNG has no effect on templates that do not contain dU. UNG can eliminate uracil from single- or double-stranded DNA, but has no effect on uracil and single uracil molecules in RNA, thus eliminating contamination caused by fragments of amplified products in the system.

[0211] (2) 90-95°C for 30-90 seconds, the heat activation step can inactivate UNG and open the complex secondary structure in the template, which helps to improve the efficiency of reverse transcription. As shown in Table 13, there were missed detections when the heat activation was 20 seconds, and the amplification height of the target was slightly lower. When the time was extended to 30-90 seconds, the amplification height was higher than 20 seconds, and there was no missed detection.

[0212] Table 13

[0213]

[0214]

[0215]

[0216] (3) Reaction at 58-60°C for 5-15 min and at 61-65°C for 5-15 min, which is the reverse transcription stage. The reverse transcription temperature requirement is related to the original sequence of the target. Usually, the RNA template obtained from the virus is not a single linear structure and may present different spatial folding states in different environments.

[0217] For the POL target segment, the spatial structure of the target sequence was analyzed by mfold_util 4.7. At 25°C, the energy dG = -91.04 kcal / mol. The higher the dG value, the more bases are bound together and the greater the hydrogen bond energy. The results are as follows: Figure 8 shown.

[0218] At 35°C, energy dG = -68.52 kcal / mol. Fig. 9 shown.

[0219] At 45°C, energy dG = -48.62 kcal / mol. Fig.10 shown.

[0220] At 55°C, part of the stem-loop structure opens, energy dG = -31.83 kcal / mol, the results are as follows Fig.11 shown.

[0221] At 60°C, energy dG = -24.12 kcal / mol. The result is Fig.12 shown.

[0222] At 65°C, the energy dG = -17.57 kcal / mol, the target segment and the primer-probe binding region are linear, and do not affect the primer-probe binding. The results are as follows Fig.13 shown.

[0223] Therefore, for the pol target, the higher the temperature, the more conducive it is to the opening of the spatial structure and the improvement of the primer-probe binding efficiency. Therefore, the reverse transcription temperature is designed to be 65°C.

[0224] For the LTR segment, at 60°C, the energy dG = -13.28 kcal / mol. Even though template base pairing may exist, the effect on primer-probe binding is relatively weak due to the relatively low free energy. The results are as follows: Fig.14 shown.

[0225] At 65°C, energy dG = -10.74 kcal / mol. The result is Fig.15 shown.

[0226] Therefore, for LTR targets, a temperature of 60-65°C has little effect on the spatial structure of the template. Considering the Tm value of the primer probe, the reverse transcription temperature is preset to 60 or 65°C.

[0227] Through experimental verification, the LTR target has a better amplification effect at 60 degrees reverse transcription, and the pol target has a better amplification effect at 65 degrees reverse transcription. If a single temperature of 60 degrees or 65 degrees is used for reverse transcription, the effect is not as good as the two-stage reverse transcription temperature. The data are shown in Table 14.

[0228] Table 14

[0229]

[0230]

[0231] The results in Table 14 show that when reverse transcription is performed at 65°C, the amplification height of the LTR target is reduced, and 3 wells are missed and the Ct value retreats, which is related to the Tm value of the primer probe. The amplification efficiency is reduced. When reverse transcription is performed at 60°C, more pol targets are missed, the Ct value retreats, the amplification height is reduced, and the amplification efficiency is reduced. Based on the above analysis, the two-stage reverse transcription is designed to take into account the needs of different targets so that they can all reach the optimal state.

[0232] (4) 90-95°C for 10 s → 55-60°C for 22 s, cycle 45-50 times. The annealing temperature and cycle number were also studied to ensure the best amplification efficiency under this procedure.

[0233] Table 15

[0234]

[0235] The results in Table 15 show that, when testing positive samples 1-6 and negative sample 7 at different annealing temperatures, the results at 55°C and 60°C are similar and have no significant difference. However, lowering the temperature to 53°C or raising the temperature to 62°C results in missed detection of samples 5 and 6. Based on the above analysis, an annealing temperature of 55-60°C can meet the detection requirements.

[0236] Table 16

[0237]

[0238] The results in Table 16 show that when the cycle number is 35, the internal standard does not produce a value, and the low-value sample target is missed; when the cycle number is 40, the low-value sample target is missed; when the cycle number is 45 and 50, all positive samples have values, and negative samples have no values. Select a program with sufficient amplification and a small Ct value, that is, 45 cycles are selected as the best.

[0239] Effect Example 1 Storage Conditions and Validity Period

[0240] The kit provided by the present invention can be stored at 2-8°C for 1 year, while other reagents are usually stored frozen at below -20°C.

[0241] According to the accelerated stability and real-time stability assessment sensitivity results in Table 13, the Ct value difference of the reagent of the present invention after accelerated experimental verification is less than 0.3, and it can be stored stably at 2-8°C for 1 year.

[0242] Furthermore, it is far from enough to achieve storage at 2-8°C by adjusting the concentration of chemical reagents in the system. It is mainly based on the stability and interaction of the primer probes involved. If there is cross-reaction between primer probes, the long-term storage of the system will be affected. Therefore, the abnormal cross-mismatching that may exist in the system is analyzed. The results show that the design of primer probes meets the requirements and there is no multi-base cross-mismatching, as shown in Tables 17 to 19 and Figure 16 to Figure 19 shown.

[0243] Table 17

[0244]

[0245] As shown in Table 17 and Fig.16 As shown, there are 4 consecutive bases at the 3' end of the probe LTR-P1 that can complementarily pair with the upstream primer LTR-F1 and the downstream primer LTR-R1, which will lead to primer dimers and non-specific amplification.

[0246] Table 18

[0247]

[0248] As shown in Table 18 and Fig.17 As shown, the upstream primer LTR-F2 has 4 consecutive bases that can complement each other with its own sequence, which will cause the primer to form a hairpin structure and reduce the amplification efficiency.

[0249] Table 19

[0250]

[0251] As shown in Table 19, the downstream primer GAG-R1 has 4 consecutive bases that can complementarily pair with the probe GAG-P1, which will lead to primer dimers and nonspecific amplification.

[0252] Comparative Example 1

[0253] According to the detection region "Gag-pol region" in the prior art, the inventors have previously studied this gag segment, and set a total of 16 primer probes, verified 16 different primer probe combination schemes, and the overall type coverage, detection rate, and amplification height were lower than those of the LTR and POL regions. Therefore, this region was excluded as the optimal target segment, and some screening and verification data were shown in Schemes 90-92, Scheme 95, Scheme 97-Scheme 98, Scheme 102-Scheme 105, Scheme 108-Scheme 109, and Scheme 112-Scheme 115 in Table 20, as follows:

[0254] 1. Preliminary design of primers to verify 16 schemes, use negative samples to verify specificity, use weak positive samples (sample concentration 1000IU / mL) to verify Ct value to determine amplification efficiency, weak positive samples to verify 3 replicates to determine repeatability, calculate the mean amplification height, and select the scheme:

[0255] Table 20

[0256]

[0257] Among the above 16 schemes, based on the target output value and amplification height, only 3 schemes were screened out with amplification heights above 1600, and the overall amplification efficiency was low.

[0258] 2. According to the primer-probe combination corresponding to the above screening scheme, the primer-probe sequence was adjusted and optimized, and the combination scheme was re-formulated for screening. The results are as follows:

[0259] Table 21

[0260]

[0261]

[0262] Among the above 12 schemes, weakly positive samples were used for verification, and the schemes with high target output values ​​and improved amplification height were screened. The results showed that the amplification height of the scheme was still low.

[0263] For a small number of schemes, system components were optimized, and the detection rate was about 40%, which is lower than the 100% detection rate of 20IU / ML of the scheme of the present invention. The amplification efficiency was lower than that of other segments, and the Ct value was lower. The amplification efficiency of LTR and pol was 5-8 times that of this segment. Therefore, compared with the gag region, ltr and pol are more suitable for the detection of low-concentration HIV-positive samples.

[0264] The primer-probe combinations and specific primer-probe sequences corresponding to Schemes 90-92, Scheme 95, Scheme 97-98, Scheme 102-105, Scheme 108-109, Scheme 112-115 are shown in Tables 22-23:

[0265] Table 22

[0266]

[0267]

[0268] Table 23

[0269] Primer Name Sequence (5'to3') P16 GTCCAAAATGCGAACCCAG (as shown in SEQ ID NO: 33) P17 GAGCAAGCTTCACAGGAGGT (as shown in SEQ ID NO: 34) P18 AAAATGCGAACCCAGATTGT (as shown in SEQ ID NO: 35) P19 ACTCTAAGAGCCGAGCAAGC (as shown in SEQ ID NO: 36) P20 TGCGAACCCAGATTGTAAGA (as shown in SEQ ID NO: 37) P21 AAGCATTGGGACCAGCGGCTACACT (as shown in SEQ ID NO: 38) P22 ATTTGTTACTTGGCTCATTGCTT (as shown in SEQ ID NO: 39) P23 GCTTCAGCCAAAACTCTTGC (as shown in SEQ ID NO:40) P24 CTGCAATTTCTGGCTGTGTG (as shown in SEQ ID NO: 41) P25 GGGTCCTCCTACTCCCTGAC (as shown in SEQ ID NO:42) P26 CTGCAATTTCTGGCTGTGTG (as shown in SEQ ID NO: 43) P27 GAGCCACCCCACAAGATTTA (as shown in SEQ ID NO:44)

[0270] The primer-probe combinations and specific primer-probe sequences corresponding to Schemes 389-390 and Schemes 393-402 are shown in Tables 24-25:

[0271] Table 24

[0272]

[0273] Table 25

[0274]

[0275]

[0276] Verification Example 2

[0277] Methoxy (OME) modification can make the primer bind to the specific template, improve the binding efficiency and improve the specificity of the amplification reaction. After amplification using the modified primers, there are fewer non-specific amplification products, especially primer dimers, and the yield of the unmodified expected amplification product is higher. Therefore, some primers in the present invention are modified with methoxy, and the detection limit and the following low concentration samples are used for verification. The specific modification position research results are as follows:

[0278] Table 26

[0279]

[0280]

[0281] According to the above results: the upstream primer LTR-F2 has a 100% detection rate for OME modification of the last base at the 3' end and the highest amplification height; the upstream primer POL-F1: the detection rates for OME modification of the second to last base at the 3' end and the last base at the 3′ end are both 100%, but the amplification height is highest when the second to last base is modified.

[0282] In the study of OME modification of primers, the selection of the modified base position is crucial. Since not all primers have a positive effect after OME modification, some primer modifications have no improvement effect or have a negative effect in the research related to the present invention. Therefore, the present invention believes that the selective modification of primers also has strong creativity.

[0283] Verification Example 3 Probe Locked Nucleic Acid Modification

[0284] Locked nucleic acid (LNA) is a special bicyclic nucleotide derivative, which contains one or more 2'-O, 4'-C-methylene-β-D-furanose ribonucleic acid monomers in its structure. The 2'-O position and 4'-C position of ribose form oxymethylene bridges, thiomethylene bridges or aminemethylene bridges through different shrinkage effects and connect into a ring. This ring bridge locks the N configuration of the furanose C3'-endo type, reduces the flexibility of the ribose structure, and increases the stability of the local structure of the phosphate backbone. Since LNA has the same phosphate backbone as DNA / RNA in structure, it has good recognition ability and strong affinity for DNA and RNA, which can increase the melting temperature (Tm value) of primers or probes and enhance the stability of the experiment.

[0285] The probe LTR-P2: 5'-CCTGGGAGCTCTCTGGCTAAC-3' was analyzed as follows. The theoretical Tm value was 60.39°C. In this study, the Tm value of the primer and the probe was kept at a specific difference to achieve a better amplification effect. Therefore, the probe was adjusted by locked nucleic acid modification, such as Fig.18 shown.

[0286] In 5'-CCTGGGAGCTCTCTGGCTAAC-3', an LNA modification is added to the 11th base C from the 5' end to increase the probe Tm value and improve the specificity of the amplification reaction.

[0287] Table 27

[0288]

[0289]

[0290] according to Fig.19 The results in Table 27 are as follows: the detection rate of the probe LTR-P2 is 100% for the 11th base C from the 5' end and the 11th and 12th bases CT from the 5' end, and the amplification height is improved. There is no missed detection when the sample is slightly below the detection limit; however, the amplification height of the 11th base C from the 5' end is the highest, and the modification of the 11th and 12th bases has no obvious improvement effect. In the study of the locked nucleic acid modification of the probe, the selection of the locked nucleic acid modification position and the number of modifications are crucial.

[0291] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer combination, characterized in that: include: Primer set I and / or primer set II; The primer set I has: (1) A nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 4; (2) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases to the nucleotide sequence shown in (1); (3) a sequence having at least 80% homology with the nucleotide sequence shown in (1); (4) A complementary sequence of the sequence shown in (1), (2) or (3); The primer set II has: (5) A nucleotide sequence as shown in any of SEQ ID NO: 5 to SEQ ID NO: 8; (6) a nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (5); (7) a sequence having at least 80% homology to the nucleotide sequence shown in (5); (8) A complementary sequence of the sequence shown in (5), (6) or (7).

2. The primer combination according to claim 1, characterized in that The primer group I includes: primer group I-I and primer group I-II; The primer set Ⅰ-Ⅰ has: (9) The nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; (10) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (9); (11) a sequence having at least 80% homology to the nucleotide sequence shown in (9); (12) A complementary sequence of the sequence shown in (9), (10) or (11); The primer sets Ⅰ-Ⅱ have: (13), the nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4; (14) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (13); (15) a sequence having at least 80% homology to the nucleotide sequence shown in (13); (16), a complementary sequence of the sequence shown in (13), (14) or (15); and / or The primer set II includes: primer set II-I and primer set II-II; The primer set II-I has: (17), the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6; (18) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (17); (19) A sequence having at least 80% homology to the nucleotide sequence shown in (17); (20), a complementary sequence of the sequence shown in (17), (18) or (19); The primer set II-II has: (21), the nucleotide sequences shown in SEQ ID NO:7 and SEQ ID NO:8; (22) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (21); (23) a sequence having at least 80% homology to the nucleotide sequence shown in (21); (24) A complementary sequence of the sequence shown in (21), (22) or (23).

3. The primer combination according to claim 1 or 2, characterized in that: The nucleotide sequence is modified with a methoxy group.

4. The primer combination according to claim 3, characterized in that The methoxy group is located at the 1st to 3rd positions close to the 3' end of the nucleotide sequence.

5. A probe combination, characterized in that include: Probe I and / or probe II; The probe I has: (25), the nucleotide sequence shown in SEQ ID NO:9 and / or SEQ ID NO:10; (26) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (25); (27) a sequence having at least 80% homology to the nucleotide sequence shown in (25); (28), a complementary sequence of the sequence shown in (25), (26) or (27); and / or The probe II has: (29), the nucleotide sequence shown in SEQ ID NO: 11 and / or SEQ ID NO: 12; (30) A nucleotide sequence obtained by modifying, replacing, deleting and / or adding one or more bases of the nucleotide sequence shown in (29); (31), a sequence having at least 80% homology to the nucleotide sequence shown in (29); (32) A complementary sequence of the sequence shown in (29), (30) or (31).

6. The probe combination according to claim 5, characterized in that The nucleotide sequence modifies the locked nucleic acid.

7. The probe combination according to claim 6, characterized in that: The locked nucleic acid is located at positions 10 to 12 near the 5' end of the nucleotide sequence.

8. A primer probe set, characterized in that: include: The primer combination according to any one of claims 1 to 4 and the probe combination according to any one of claims 5 to 7.

9. A detection reagent, characterized in that: include: The primer combination according to any one of claims 1 to 4, the probe combination according to any one of claims 5 to 7 and / or the primer-probe set according to claim 8, and an acceptable auxiliary agent.

10. The detection reagent according to claim 9, characterized in that Also includes: One or more of PCR reaction solution, proteinase K, internal standard, calibrator and quality control product.

11. The detection reagent according to claim 10, characterized in that The internal standard sequence is SEQ ID NO:

19.

12. Use of the primer combination according to any one of claims 1 to 4, the probe combination according to any one of claims 5 to 7, the primer-probe set according to claim 8 and / or the detection reagent according to any one of claims 9 to 11 in any of the following items; (I) Preparation of products for detecting human immunodeficiency virus; and / or (II) detection of human immunodeficiency virus; and / or (III) Screening of antiviral drugs for acquired immunodeficiency syndrome; and / or (IV) Preparation of products for screening antiviral drugs for acquired immunodeficiency syndrome; and / or (V) Monitoring the therapeutic effects of antiviral drugs for acquired immunodeficiency syndrome.

13. The use according to claim 12, characterized in that The detection includes: mixing the sample to be tested with the detection reagent, amplifying, and obtaining the detection result.

14. The use according to claim 13, characterized in that The reaction conditions of the amplification include: heat activation at 90-95° C. for 30-90 seconds, two-stage reverse transcription at 58-60° C. for 5-15 minutes, and 61-65° C. for 5-15 minutes.

15. A detection kit, characterized in that: include: The primer combination according to any one of claims 1 to 4, the probe combination according to any one of claims 5 to 7, the primer-probe set according to claim 8 and / or the detection reagent according to any one of claims 9 to 11 and an acceptable device and / or carrier.

Images