Gene for reducing tomato pedicel shedding rate and application thereof

Abstract

The invention discloses a gene for reducing pedicel shedding in tomato and application of the gene, and belongs to the field of plant genetic engineering and molecular breeding. The SlGCN5 (Solyc10g045390) is derived from a tomato Micro-Tom strain, the CDS (Coding Sequence) of the SlGCN5 (Solyc10g045390 is equal to '1', and the amino acid sequence of the SlGCN5 (Solyc10g045390) translated and coded by the SlGCN5 (Solyc10g045390) is equal to '2'. The CR-SlGCN5 gene knockout material is obtained through a CRISPR / Cas9 technology in tomatoes, and the phenotype that the pedicel shedding rate is remarkably increased is shown compared with that of a wild type. Overexpression of the SlGCN5 shows a phenotype that the pedicel shedding rate is reduced. Therefore, the SlGCN5 is a gene for regulating and controlling pedicel shedding in the tomato, so that the SlGCN5 has great application prospects and economic values in the important aspects of ensuring tomato fruit setting, improving fruit yield and the like.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and molecular breeding, and discloses the application of a tomato acetyltransferase encoding gene SlGCN5 in regulating tomato peduncle abscission. Background Art

[0002] Tomato (Solanum lycopersicum L.) is native to South America and is an annual herbaceous plant of the Solanaceae family. It is deeply loved by consumers due to its diverse varieties, rich nutrition and unique flavor. It is one of the most commonly cultivated fruits and vegetables in the world, and one of the most important facility vegetable crops in my country, with a very broad market and huge economic value. However, in recent years, with the development of my country's agricultural industry and the continuous expansion of facility cultivation areas, in the process of tomato plant cultivation, the instability of a series of environmental factors such as low temperature, weak light, and uneven water will cause tomato flowers and fruits to fall, thereby affecting the yield and quality of tomato crops, and ultimately directly damaging the economic benefits of planting.

[0003] Abscission is an important part of the growth and development of plants in the plant kingdom. It is also a physiological phenomenon and a necessary stage of growth that is common in the plant kingdom. It mainly includes the separation of flowers, fruits or leaves from the mother plant. It is a complex physiological process coordinated and controlled by multiple factors. Abscission generally occurs in a specific cell-specific abscission zone tissue called the abscission zone (AZ). This zone is pre-formed before abscission occurs. It is located in the area where organs or tissues are abscissing and its adjacent parts. It usually has a band-like appearance and is the area where abscission signals are sensed and cell separation occurs. Based on environmental factors, it is generally believed that abscission may be closely related to plant hormones and functional transcription factors. For example, hormones such as jasmonic acid, ethylene and abscisic acid can serve as abscission acceleration signals, while other hormones such as gibberellins, brassinolide, and auxin can serve as abscission delay signals. At the same time, WUSCHEL (WUS), a key gene for regulating stem cell maintenance in plants, has been reported to be specifically expressed in the AZ zone in tomatoes and inhibit the occurrence of pedicel abscission.

[0004] GCN5 is the most studied histone acetyltransferase in eukaryotes. It is the key catalytic component of the transcriptional coactivator complex SAGA (Spt-Ada-Gcn5-Acetyl transferase). It can modify the acetylation level on chromatin by interacting with transcription factors, thereby weakening the interaction between DNA and histones, making the DNA segments fully exposed, and then generating active histone marks at the epigenetic modification level to activate the expression of downstream genes. In the model plant Arabidopsis, AtGCN5 maintains a high expression level in different tissues and developmental stages, indicating that it plays an important role in the development of various tissues of plants. Both gcn5 and ada2b mutant plants show phenotypes of developmental defects such as dwarfism, rosette leaf curling, loss of apical dominance and abnormal flower development. Subsequent experiments have shown that AtGCN5 can regulate multiple biological processes, such as seed germination, vegetative reproductive stage transition, photomorphogenesis, root tip development, epidermal hair development, wax layer development, floral organ and stem apex development. In tomato, SlGCN5 can participate in the development of shoot apical meristem and floral meristem by positively regulating SlWUS. Summary of the invention

[0005] The present invention discovers a gene SlGCN5 regulating tomato peduncle abscission and an application thereof to increasing fruit yield.

[0006] A gene SlGNC5 that regulates pedicel abscission in tomato, its CDS nucleotide sequence is shown in the sequence listing as sequenceIDNumber="1".

[0007] A protein encoded by the above gene has an amino acid sequence as shown in the sequence listing sequenceIDNumber="2".

[0008] A gene knockout transgenic plant was constructed using CRISPR / Cas9 technology, and the target site was selected as follows:

[0009] The sequence of the first gRNA target site was: 5′-TGACGGCGCCGGGCCGATCC-3′;

[0010] The sequence of the second gRNA target site was: 5′-GAGAGTATCAGCGCCCGCGG-3′;

[0011] The sequence of the third gRNA target site is: 5'-CGAGGCAGTGAAATTGCGAA-3'.

[0012] An overexpression vector is constructed by adding one or more CaMV35S strong promoters in front of the above gene, and the SlGCN5 overexpression plant is obtained by transformation.

[0013] The application of the gene knockout and overexpression plants constructed by the above-mentioned SlGCN5 gene in tomato peduncle abscission and fruit yield.

[0014] The beneficial effects are as follows:

[0015] 1. The present invention proves for the first time that the SlGCN5 gene affects fruit yield by regulating tomato pedicel abscission.

[0016] 2. The present invention provides for the first time the use of CRISPR / Cas9 technology to construct a SlGCN5 gene knockout target, and the transgenic tomato transformed therefrom has an increased peduncle shedding rate; the SlGCN5 overexpressed transgenic tomato constructed by adding one or more CaMV35S strong promoters before the CDS segment of the SlGCN5 gene has a reduced peduncle shedding rate, increased fruit setting rate and fruit yield. Therefore, the SlGCN5 overexpression technology can be applied to genetic engineering breeding of tomatoes to obtain transgenic tomatoes with high and stable fruit yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The vector map used for the sequence alignment and construction of multiple versions of the tomato SlGCN5 gene. Figure A shows the alignment of the SlGCN5 gene coding region sequences of various versions in multiple existing databases; Figure B shows the SlGCN5 overexpression vector map (pCHF1-35S: SlGCN5-eGFP); Figure C shows the map of the SlGCN5 gene knockout vector constructed by CRISPR / Cas9 (pYLCRISPR / Cas9-DH-SlGCN5).

[0018] Figure 2 Schematic diagram of the CR-SlGCN5 gene knockout site and its peduncle abscission phenotype. Figure A shows the distribution of gDNA introns and exons of SlGCN5, where the highlighted black boxes are exons, the straight lines without highlights represent the intron region, and the first selected efficient target is the red region on its first exon. Figure B shows the gene deletion of one of the SlGCN5 gene knockout lines, 10 bases were deleted at the target position and caused a frameshift, and finally a stop codon was formed at the 61st amino acid position. Figure C shows the phenotype of adult tomato plants and the phenotype of their peduncle abscission, with a scale of 3 cm. Figure D shows the statistical graph of the peduncle abscission rate of the wild type, gene knockout lines and overexpression lines. The independent sample T test was used to statistically analyze the significant difference between the two groups. * indicates a significant difference (*p<0.05, **p<0.01). Figure E is a statistical graph of the fruit number of the wild type, gene knockout line and overexpression line. The independent sample T test was also used to statistically analyze the significant difference between the two groups. * indicates a significant difference (*p<0.05, **p<0.01). DETAILED DESCRIPTION

[0019] The following examples are convenient for better understanding of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The primers involved in the examples of the present invention were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0020] Example 1: Construction of SlGCN5 overexpression vector and knockout vector

[0021] 1.1 Construction of SlGCN5 overexpression vector

[0022] (1) Wild-type tomato leaves were taken and total RNA was extracted using the TRIzol method (Vazyme). The RNA concentration was measured using NanoDrop and the RNA integrity was verified by agarose gel electrophoresis.

[0023] (2) Reverse transcription of RNA into first-strand cDNA was performed using a reverse transcription kit (Vazyme).

[0024] (3) Using the cDNA of the above step product as a template, PCR amplification was performed using primer pairs (pCHF1-35S: SlGCN5-F: GGGGATCCTCTAGAGTCGACATGGACGCTTCGCACTTG and pCHF1-35S: SlGCN5-R: ATCAGCTCCGGCGCCGGGCCCCTGAATCTTGATGCTAGACTGTAGACC), and a band of approximately 1626 bp was recovered (Omega) in agarose gel electrophoresis. The pCHF1-eGFP empty vector was double-digested with SalI and ApaI and recovered by agarose gel electrophoresis. One-step cloning was performed using a homologous recombination kit (Vazyme) according to the default program. Finally, Escherichia coli DH5a was transformed using the heat shock method, spread on an antibiotic LB plate containing gentamicin, and inverted at 37°. After PCR identification of the bacterial solution, it was sent to Biotech sequencing and sequenced for comparison with the vector map.

[0025] 1.2 Construction of SlGCN5 gene knockout vector

[0026] The present invention uses CRISPR / Cas9 technology to construct a pYLCRISPR / Cas9-DH-SlGCN5 recombinant vector to knock out SlGCN5. Based on the above system, the online website designs and selects three SlGCN5 target sites close to the start codon, and the sequences are as described in the content of the invention. At the same time, the corresponding primers are synthesized by the company. After annealing and renaturation, the sequence pairing of the target linker is completed, and the BsaI / T4 (NEB) cutting and connecting and two rounds of nested PCR amplification methods are used to construct three gRNA expression cassettes, AtU3b-T1-gRNA, AtU6-1-T2-gRNA, and AtU6-29-T3-gRNA (universal primers use UF: 5-CTCCGTTTTACCTGTGGAATCG-3 and gRNA-R: 5-CGGAGGAAAATTCCATCCAC-3). In the second round, PCR amplification was performed using primers (Uctcg-B1': TTCAGAGgtctcTctcgCACTGGAATCGGCAGCAAAGG-3 and gRctga-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3; Uctga-B2': TTCAGAGGTctcTctgaCACTGGAATCGGCAGCAAAGG-3 and gRaaga-B3: AGCGTGggtctcGtcttGGTCCATCCACTCCAAGCTC-3; Uaaga-B3': TTCAGAGGGTctcTaagaCACTGGAATCGGCAGCAAAGG-3 and gRcggt-BL: AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3) according to the order of the target linkers, and the corresponding linkers were added to the three gRNA expression cassettes. Finally, the three gRNA expression cassettes were recombined into the pYLCRISPR / Cas9-DH final vector using the BsaI / T4 cutting and ligation method to complete the construction of pYLCRISPR / Cas9-DH-SlGCN5. This recombinant vector was transferred into Escherichia coli DH5a by the same heat shock method, and positive clones were screened on kanamycin-resistant LB plates. After bacterial inspection and sequencing, the glycerol bacteria were stored in a -80°C ultra-low temperature refrigerator and finally transferred into Agrobacterium GV3101 for use.

[0027] Example 2: Genetic transformation and identification of tomato using recombinant vectors

[0028] 2.1 Genetic transformation of recombinant vectors

[0029] The present invention adopts the leaf disc method to carry out tissue culture and impregnation of tomato cotyledons. First, the CRISPR / Cas9 gene knockout and overexpression recombinant plasmids are transferred into Agrobacterium GV3101 for standby use. Wild-type tomato seeds are disinfected with 50% sodium hypochlorite and placed on a 1 / 2MS culture medium to germinate and grow two cotyledons. Two cotyledons are cut off with sterile scissors or a blade in a clean bench, placed in an MS0 culture medium in the dark for 48 hours, and then placed in an Agrobacterium containing a corresponding recombinant plasmid to impregnate the cotyledons so that the recombinant plasmid is transformed into plant cells. The impregnated cotyledons are placed in an MS1 ​​culture medium to dedifferentiate under light culture to form callus tissue. After about 3-4 weeks, the callus tissue is placed in an MS2 culture medium for bud culture, and the corresponding callus tissue is cut off after a complete bud tip grows out, and transferred to an MS3 culture medium for root culture. Finally, the tomato seedlings with buds and roots are transplanted into the soil, covered with a lid, and hardened and adaptive culture are carried out to finally obtain transgenic tomatoes.

[0030] 2.2 Identification of SlGCN5 knockout tomatoes

[0031] The above transgenic tomato leaves were taken and the total plant DNA was extracted using the CTAB method. The primers at both ends of the SlGCN5 target site were used for amplification. The PCR products were sent to the company for sequencing. The homozygous or heterozygous editing of the transgenic material was determined based on the sequencing results and sequencing peaks. Finally, the SlGCN5 gene knockout tomato line with homozygous knockout was screened for subsequent experimental observations.

[0032] 2.3 Identification of SlGCN5-overexpressing tomatoes

[0033] First, the overexpressed transgenic tomatoes were positively identified at the DNA level, and the total DNA of the overexpressed transgenic tomatoes was extracted using the above method. The forward primer on the SlGCN5 gene and the reverse primer of the downstream eGFP sequence segment were selected for PCR amplification, and compared with the wild type as a negative control to determine the positive transgenic plants at the DNA level. The positive plants were selected for subsequent RNA level identification.

[0034] Take the above transgenic overexpression tomato and wild-type leaves and extract plant total RNA according to the method in 1.1 and reverse transcribe it into cDNA. Add ChamQ Universal SYBR qPCR Master Mix (Vazyme) to configure the system according to the operating instructions, use Step One Plus real-time PCR system to perform quantitative PCR detection, and analyze the expression difference according to the Ct value, and use independent sample T test for significant difference analysis. Compared with the wild type, the strain with higher SlGCN5 expression was selected for subsequent experiments.

[0035] Example 3: Phenotypic statistics of tomato pedicel shedding rate

[0036] 3.1 Tomato planting and phenotypic observation

[0037] After sterilizing the seeds, wild-type, SlGCN5 knockout and overexpression tomato seeds were germinated simultaneously on 1 / 2MS medium. When the tomato seedlings grew more than two true leaves in the culture bottle, they were moved to the soil for further growth. The growth photoperiod conditions were long daylight (16 hours of light / 8 hours of darkness), the temperature was about 23-25°C, and the light intensity was about 10,000 lux. When the plants grew to a round of flowering, about 6 weeks, it was observed that all genotypes of tomatoes showed obvious flower organ shedding, with the yellowing and loosening of the pedicel area as the boundary, and the pedicel shedding caused by gentle disturbance with tweezers as the statistical standard. At this time, the number of pedicels and the total number of pedicels of each genotype tomato plants were counted, and the pedicel shedding rate of each genotype was calculated. Finally, the SPSS software was used to calculate the significant difference between the two groups. It is expected that when the plants grow to 16 weeks, the first round of fruits will be fully mature. The number of fruits on their branches will be independently counted, and the significant difference in the number of fruits between the genotypes will be calculated.

Claims

1. A gene SlGNC5 that regulates pedicel abscission in tomatoes, characterized by: The CDS nucleotide sequence is shown in the sequence listing as sequenceIDNumber="1".

2. The protein encoded by the gene SlGCN5 according to claim 1, whose amino acid sequence is shown in the sequence listing sequenceIDNumber="2".

3. The SlGCN5 gene according to claim 1 is used to construct a gene knockout transgenic plant using CRISPR / Cas9 technology, and the target site selection is: The sequence of the first gRNA target site was: 5′-TGACGGCGCCGGGCCGATCC-3′; The sequence of the second gRNA target site was: 5′-GAGAGTATCAGCGCCCGCGG-3′; The sequence of the third gRNA target site is: 5'-CGAGGCAGTGAAATTGCGAA-3'.

4. The SlGCN5 gene according to claim 1 is preceded by one or more CaMV35S strong promoters to construct an overexpression vector, and the SlGCN5 overexpressing tomato is transformed.

5. Use of the gene S1GCN5 according to claim 1 in regulating tomato peduncle abscission in fruit yield.

Images