Preparation method and application of anti-EGFR monoclonal antibody based on electrofusion

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a preparation method and application of an anti-EGFR monoclonal antibody based on electrofusion, and the preparation method comprises the following steps: aiming at an EGFR specific effective fragment, designing an artificial antigen, and utilizing a series of processes of protein expression, mouse immunization and antibody preparation to obtain a high-specificity anti-EGFR antibody. According to the invention, cell fusion is carried out through an improved electrofusion mode, the contact rate of heterologous cells is enhanced, and the fusion rate of the cells and the number of later positive cell strains are greatly improved, so that the anti-EGFR monoclonal antibody with specificity and sensitivity both meeting the follow-up production and scientific research work is obtained; a new thought is provided for preparing medicines for preventing and diagnosing human diseases and positioning tumors and antibodies in vivo.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a preparation method and application of an anti-EGFR monoclonal antibody based on electrofusion. Background Art

[0002] Epidermal growth factor receptor (EGFR) is the most widely studied growth factor receptor to date. In addition, the EGFR family also includes HER1, HER2 / neu, HER3 and HER4. These transmembrane proteins contain both extracellular domains that bind to specific ligands and intracellular domains with tyrosine kinase activity. They can trigger a series of biological signal responses by binding to different ligands. EGFR is often overexpressed in epithelial malignancies such as head and neck cancer, colon cancer, lung cancer, breast cancer and other malignant diseases that pose a great threat to human life and health safety, providing a target for monoclonal antibody (mAb) immunotherapy based on tumor antigen (TA). Studies have shown that EGFR monoclonal antibodies can effectively inhibit tumor proliferation in mouse tumor models. Monoclonal antibody technology provides an ideal method for preventing and diagnosing human diseases, locating tumors in vivo and developing antibody drugs.

[0003] At present, the application of anti-EGFR includes two parts. One is the diagnostic EGFR monoclonal antibody, which is an immunodiagnostic technology as one of the in vitro diagnostic (IVD) detection technologies. The EGFR monoclonal antibody labeled with enzyme immunoassay or fluorescent dye specifically binds to the target antigen and triggers a substrate-related reaction, so that the target antigen and its distribution in the tissue section can be clearly observed under a microscope, and suspected cancer cases can be confirmed. The other is the therapeutic EGFR monoclonal antibody, which is the most commonly used immunotherapy drug for various diseases such as cancer and infection. The monoclonal antibody can specifically bind to specific proteins or cells, thereby enhancing the immune system's ability to clear diseased cells.

[0004] At present, the existing anti-EGFR monoclonal antibodies are mainly obtained by traditional PEG fusion, but the fusion process is cumbersome and PEG may be toxic to cells, resulting in a low positive clone rate of hybridomas secreting anti-EGFR antibodies, and it is not easy to obtain high-affinity monoclonal antibodies. Cell electrofusion is an emerging cell engineering technology, which has the advantages of high fusion efficiency, low cytotoxicity, and strong controllability; the SA-Biotin system has the characteristics of high affinity, strong specificity, and good stability. Therefore, the present invention uses the SA-Biotin system labeled efficient improved electrofusion method for cell fusion, which greatly improves the cell fusion rate and the number of positive holes, and has broad application prospects. Summary of the invention

[0005] In view of the problem of poor specificity of anti-EGFR monoclonal antibodies prepared by traditional methods, the present invention provides a method for preparing anti-EGFR monoclonal antibodies based on electrofusion and its application, which improves the positive rate of screening items by artificially preparing EGFR antigens and labeling cells with the SA-Biotin system for electrofusion, and obtains anti-EGFR monoclonal antibodies with strong specificity and high sensitivity to the greatest extent, providing new ideas for the preparation of drugs for preventing and diagnosing human diseases, locating tumors in vivo and antibody-related drugs.

[0006] In order to achieve the above-mentioned purpose, the present invention provides a method for preparing EGFR antigen, the EGFR sequence is analyzed and corresponding primers are designed to obtain the target fragment, the target fragment is cloned into the pET28a expression vector by PCR amplification, the constructed expression vector is transformed into BL21 (DE3) cells, and the expression of EGFR protein is induced after successful sequencing verification, and the EGFR protein with high purity is obtained through purification and concentration, and glycerol is added for storage.

[0007] Specifically, the full base sequence of EGFR is as shown in SEQ ID NO.2; the nucleotide sequence of the target fragment is as shown in SEQ ID NO.1, the primer nucleotide sequences are as shown in SEQ ID NO.3 and SEQ ID NO.4; the induction conditions are: 16°C, 0.1mmol / L IPTG induction for 16 h.

[0008] AAAAAGATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATAAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTGTGTGCAGATCGCAAAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTGCCTATCAAGTGGATGGCATTGGAATCAATTTTACACAGAATCTATACCCACCAGAGTGATGTCTGGAGCTACGGGGTGACTGTTTGGGAGTTGATGACCTTTGGATCCAAGCCATATGACGGAATCCCTGCCAGCGAGATCTCCTCCATCCTGGAGAAAGGAGAACGCCTCCCTCAGCCACCCATATGTACCATCGATGTCTACATGATCATGGTCAAGTGCTGGATGATAGACGCAGATAGTCGCCCAAAGTTCCGTGAGTTGATCATCGAATTCTCCAAAATGGCCCGAGACCCCCAGCGCTACCTTGTCATTCAGGGGGAT (SEQ ID NO.1); Forward primer F: TCGGGTTTAAACGGATCCATGAAAAAGATCAAAGTGCTGGGCT (SEQ ID NO.3); Reverse primer R: GGGCCCTCTAGACTCGAGATCCCCCTGAATGACAAGGTAG (SEQ ID NO.4) The present invention also provides a method for preparing an anti-EGFR monoclonal antibody based on an electrofusion method, comprising the following steps: (1) Obtaining EGFR protein according to the above preparation method; (2) Using the EGFR protein in step (1) as an immunogen to immunize mice, and collecting blood for titer measurement after four immunizations; (3) removing the mouse spleen cells that have reached the titer standard in step (2) and performing improved electrofusion; (4) Using the indirect ELISA method to perform subclone screening on the cells fused in step (3); (5) Select the positive monoclonal hybridoma cell line screened by subclone screening in step (4) to prepare ascites, and then perform antibody purification, desalting and storage in sequence.

[0009] Furthermore, in step (2) of the above technical solution, the specific method for immunizing mice is: alternately immunizing subcutaneously on the back and immunizing intraperitoneally, with an interval of 14 days between each immunization, and collecting blood for titer measurement after four immunizations, and the titer is measured when the expected titer is reached.

[0010] Furthermore, in step (3) of the above technical solution, the improved electrofusion is labeled with the SA-Biotin system, and the specific method is: first use Biotin to separately label the resuscitated SP2 / 0 myeloma cells and mouse spleen cells, then further SA-label the Biotin-labeled spleen cells, and then gently mix the two labeled cells at a quantitative ratio of 1:2 to 1:5, place them at room temperature for 20 minutes for affinity binding, and then use a fusion instrument to fuse them.

[0011] Furthermore, in the above technical solution, the fusion includes three AC electric fields and one DC pulse voltage, and the fusion parameters are: the first and second AC electric field voltages are 60V for 20s, the third DC pulse voltage is 600V for 50μs and one pulse, and the fourth AC electric field voltage is 60V for 7s; the cell fusion density is 0.5-1×10 7 Pieces / mL.

[0012] Furthermore, in the above technical solution, the SP2 / 0 cells labeled with Biotin and the spleen cells labeled with SA-Biotin are combined at a quantitative ratio of 1:2.

[0013] Furthermore, in step (4) of the above technical solution, the number of subcloning is ≥ 3 times, and the antigen coating concentration is 0.1 μg / mL.

[0014] The present invention also provides an anti-EGFR monoclonal antibody prepared by the improved preparation method.

[0015] The present invention also provides an application of the anti-EGFR monoclonal antibody prepared by the above preparation method in the preparation of drugs for metastatic colorectal cancer and head and neck cancer.

[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention proposes a method for artificially preparing antigens, using the BL21 (DE3) strain to express EGFR protein, which increases the protein expression yield and is more conducive to the purification of EGFR protein.

[0017] (2) The present invention proposes a method of alternating subcutaneous immunization and intraperitoneal immunization, which greatly improves the immunization effect.

[0018] (3) The electrofusion procedure of the present invention is used to label cells with the SA-Biotin system, which can form a pearl chain of fully arranged SP2 / 0 myeloma cells and spleen cells under the action of the electric field, thereby enhancing the contact area between heterologous cells and improving the fusion rate of heterologous cells.

[0019] (4) The anti-EGFR monoclonal antibody obtained by the present invention has high purity, strong specificity and high sensitivity, and can provide new ideas for the preparation of drugs for preventing and diagnosing human diseases, locating tumors in vivo and antibody-related drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 is the gel electrophoresis diagram of the EGFR fragment amplification in Example 1 of the present invention; Figure 2 This is a gel image of EGFR protein purification in Example 2 of the present invention; Figure 3 This is a diagram of the cell array during the electrofusion process labeled by the SA-Biotin system in Example 3 of the present invention; Figure 4 It is the growth status of the transfer cells after successful electrofusion in Example 3 of the present invention; wherein A, B, and C are the growth status of cells 1 day, 3 days, and 5 days after cell fusion, respectively; Figure 5 This is a gel image of the purification of the anti-EGFR monoclonal antibody in Example 5 of the present invention. DETAILED DESCRIPTION

[0022] The experimental methods in the following examples are conventional methods unless otherwise specified. The raw materials involved in the following examples are common commercial products and can be purchased from the market unless otherwise specified.

[0023] The above-mentioned technical features of the present invention and the technical features specifically described below (such as implementation cases) can be combined with each other to form a new or preferred technical solution.

[0024] The raw materials involved in the embodiments of the present invention are either existing commercially available products or can be prepared according to existing methods.

[0025] The following is further described with reference to specific embodiments.

[0026] Example 1: Preparation of EGFR Antigen A method for preparing EGFR antigen comprises the following steps: (1) The complete EGFR sequence was obtained by consulting relevant literature, as shown in SEQ ID NO. 2, and the corresponding primers were designed and synthesized using Snapgene software. The primer sequences are shown in Table 1; (2) The primers designed in step (1) were used to amplify the desired target fragment. The amplification system and procedure are shown in Table 2-3. The target fragment obtained was 816 bp in total. The sequence obtained by sequencing was shown in SEQ ID NO.1. The gel electrophoresis was as shown in Figure 1 As shown; (3) Connecting the target sequence in step (2) with the pET28a vector after restriction digestion to construct a recombinant vector; (4) The recombinant vector in step (3) was transformed into the BL21 (DE3) strain, and the transformants verified by sequencing were selected to induce protein expression. The induction conditions were 16°C, 0.1 mmol / L IPTG for 16 h.

[0027] (5) Collect the cells induced in step (4) and purify the expressed protein using a Ni column ( Figure 2 ) and save.

[0028] Table 1

[0029] Table 2 PCR amplification system

[0030] Table 3 PCR amplification program

[0031] Example 2: Preparation of immune preparations The EGFR protein obtained in Example 1 was used as an antigen, mixed with complete Freund's adjuvant / incomplete Freund's adjuvant (purchased from SIGMA) in equal volumes and emulsified to prepare an immune preparation. The specific method is as follows: The immunization experimental animals were healthy female BALB / c mice aged 6-8 weeks. The first subcutaneous multi-point immunization was performed with Freund's complete adjuvant, and the second intraperitoneal immunization was performed with Freund's incomplete adjuvant. The two immunization methods were performed alternately, and Freund's incomplete adjuvant was used after the second immunization. Among them, in the above method, the dose of the first immunogen was 100 μg, and the other immunization doses were all 50 μg; the immunization cycle was 14 days, and 100 μL of blood was collected from the orbits after four immunizations. The serum titer was measured by ELISA method, and mice with a large dilution multiple and a higher serum titer were selected for fusion.

[0032] Example 3: Highly efficient improved electrofusion labeled by SA-Biotin system A highly efficient improved electrofusion method labeled with a SA-Biotin system comprises the following steps: (1) The mouse spleen cells with higher titer in Example 2 were taken out to prepare a cell suspension, and the cell suspension was labeled with Biotin separately from the SP2 / 0 myeloma cells collected and counted in advance; (2) further labeling the spleen cells labeled with Biotin in step (1) with SA; (3) Gently mix the SP2 / 0 myeloma cells in step (1) and the spleen cells in step (2) at a ratio of 1:2 for specific binding; (4) Prepare the fusion chamber of the electrofusion instrument by washing it with electrofusion buffer in advance, and set the fusion parameters in advance, including three AC electric fields and one DC pulse voltage. The purpose of the first and second AC electric fields (60V) is to make the cells evenly arranged into a pearl chain, and the duration of action is 20 seconds; the third DC pulse is the key to cell fusion, and the specific parameters are: DC pulse voltage 600 V, action time 50μs, pulse number 1; the last AC electric field (60V) allows the cells to recover, and the duration of action is 7 seconds; (5) Add the cell suspension from step (3) into the fusion chamber of the electrofusion instrument that has been pre-rinsed with buffer. Be careful not to generate bubbles when adding the cell suspension. Fusion should be performed within 30 s after addition. The cell fusion density should be controlled at 0.5-1×10 7 / mL, cells appeared to line up during the fusion process, such as Figure 3 As shown; (6) performing cell fusion according to the electrofusion procedure of step (4) to form a fusion product containing hybridoma cells; (7) After the fusion is completed, let the cells stand in the fusion pool for 2 minutes, then transfer them to the HAT complete culture medium prepared in advance and incubate them in a 37°C incubator for 60 minutes to allow the cells to adapt and recover; (8) The fused cell suspension was added to a 96-well plate containing feeder cells and cultured for 7 days, followed by screening of positive wells.

[0033] Example 4: Screening and cloning of anti-EGFR positive monoclonal cell lines A method for screening and cloning anti-EGFR positive monoclonal cell lines comprises the following steps: The cells fused in Example 3 were screened by conventional limiting dilution method, and the cell supernatant was aspirated after 7-8 days. The positive wells secreting antibodies were screened by conventional indirect ELISA method, and the cell wells with strong positive reaction were selected (positive well determination principle: experimental well value / negative well value ≥ 2.1), and subcloned by limiting dilution method. After three subclone screenings, the obtained monoclonal cell strains can be used for ascites preparation and liquid nitrogen storage. Among them, the comparison results of the positive wells screened by the anti-EGFR monoclonal antibody obtained by the improved electrofusion method of the present invention and the positive wells screened by the anti-EGFR monoclonal antibody obtained by the traditional PEG fusion method are shown in Table 4. From the results in Table 4, it can be seen that the positive monoclonal strains screened by the present invention are more.

[0034] Table 4 Comparison of positive wells

[0035] Example 5: Preparation and purification of anti-EGFR monoclonal antibody ascites A method for preparing and purifying ascites of an anti-EGFR monoclonal antibody comprises the following steps: The monoclonal cell strain screened in Example 4 was inoculated into the abdominal cavity of pre-treated BALB / c mice. The hybridoma cells proliferated in the abdominal cavity and produced ascites. The ascites was extracted with a syringe to obtain a large amount of monoclonal antibodies. The collected ascites was pre-treated, centrifuged at 5000 rpm for 20 min, and the supernatant was collected and purified using a protein A / G column. The results are shown in FIG. Figure 5 As shown, the purified antibody has no obvious impurities, indicating that the purified purity is high. The purified antibody is dialyzed and then added with 20% glycerol and stored in a 20C° refrigerator.

[0036] In summary, the present invention artificially prepares EGFR antigens, labels cells with the SA-Biotin system and performs electrofusion, which is not only simple to operate and can screen more positive monoclonal strains, but also has high purity, strong protein-specific binding ability and high sensitivity. It provides new ideas for the preparation of drugs for preventing and diagnosing human diseases, locating tumors in vivo and antibody-related drugs, and has broad application prospects in scientific research and actual production.

[0037] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing EGFR antigen, characterized in that: The EGFR sequence was analyzed and corresponding primers were designed to obtain the target fragment, which was amplified by PCR and cloned into the pET28a expression vector. The constructed expression vector was transformed into BL21 cells, and the expression of EGFR protein was induced after successful sequencing verification. The EGFR protein obtained was purified and concentrated, and glycerol was added for storage.

2. The method for preparing an EGFR antigen according to claim 1, characterized in that: The nucleotide sequence of the target fragment is shown in SEQ ID NO.1; the induction conditions are: 16°C, 0.1 mmol / L IPTG induction for 16 h.

3. A method for preparing anti-EGFR monoclonal antibodies based on electrofusion, characterized in that: The following steps are involved: (1) Obtaining EGFR protein according to the preparation method of claim 1 or 2; (2) Using the EGFR protein in step (1) as an immunogen to immunize mice, and collecting blood for titer measurement after four immunizations; (3) removing the mouse spleen cells that have reached the titer standard in step (2) and performing improved electrofusion; (4) Using the indirect ELISA method to perform subclone screening on the cells fused in step (3); (5) Select the positive monoclonal hybridoma cell line screened by subclone screening in step (4) to prepare ascites, and then perform antibody purification, desalting and storage in sequence.

4. The preparation method according to claim 3, characterized in that: In step (2), the specific method for immunizing mice is: alternately immunizing subcutaneously on the back and immunizing intraperitoneally, with an interval of 14 days between each immunization, and collecting blood for titer measurement after four immunizations, and the titer is measured when the expected titer is reached.

5. The preparation method according to claim 3, characterized in that: In step (3), the improved electrofusion is labeled with the SA-Biotin system, and the specific method is: first use Biotin to separately label the resuscitated SP2 / 0 myeloma cells and mouse spleen cells, then further SA-label the Biotin-labeled spleen cells, and then gently mix the two labeled cells at a ratio of 1:2 to 1:5, place them at room temperature for 20 minutes for affinity binding, and then use a fusion instrument to fuse them.

6. The preparation method according to claim 5, characterized in that: The fusion includes three AC electric fields and one DC pulse voltage. The fusion parameters are: the first and second AC electric field voltages are 60V for 20 seconds, the third DC pulse voltage is 600V for 50μs and one pulse, and the fourth AC electric field voltage is 60V for 7 seconds. The cell fusion density is 0.5-1×10 7 Pieces / mL.

7. The preparation method according to claim 5, characterized in that: Biotin-labeled SP2 / 0 myeloma cells and SA-Biotin-labeled spleen cells were combined at a quantitative ratio of 1:

2.

8. The preparation method according to claim 3, characterized in that: In step (4), the number of subcloning is ≥ 3 times, and the antigen coating concentration is 0.1 μg / mL.

9. An anti-EGFR monoclonal antibody prepared by the preparation method according to any one of claims 3 to 7.

10. Use of the anti-EGFR monoclonal antibody prepared by the preparation method according to any one of claims 3 to 7 or the anti-EGFR monoclonal antibody according to claim 9 in the preparation of drugs for metastatic colorectal cancer and head and neck cancer.

Images