Phytophthora plant pathogenic oomycete arginine methyltransferase protein as well as coding gene and application thereof

Abstract

The invention discloses arginine methyltransferase protein from phytophthora plant pathogenic oomycetes as well as a coding gene and application thereof. The arginine methyltransferase protein provided by the invention is as shown in sequences 6-8; the coding gene is shown in sequences 1-3. Experiments prove that the protein disclosed by the invention plays an important role in growth, development and pathopoiesis processes of typical phytophthora plant pathogen oomycete phytophthora capsici, and after the protein is deleted or the expression level is reduced, the growth rate of phytophthora capsici hyphae is reduced, the sporangium yield is reduced, the number of zoospore is reduced, the pathogenicity is reduced and the like. Corresponding arginine methyltransferase inhibitors have different degrees of activity on typical plant pathogenic oomycetes such as phytophthora capsici, phytophthora sojae and phytophthora infestans. The gene provided by the invention has great application potential in the aspect of preventing and controlling the crop epidemic diseases caused by phytophthora plant pathogenic oomycetes, and a novel bactericide developed based on the protein as an action target has important practical significance in controlling the occurrence and prevalence of the crop epidemic diseases caused by phytophthora.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an arginine methyltransferase protein from a plant pathogenic oomycete of the genus Phytophthora (Phytophthora spp.), a coding gene thereof and an application thereof. Background Art

[0002] Oomycetes are widely distributed, and their host range covers the plant and animal kingdoms. Although oomycetes are similar to fungi in morphology, they are closer to diatoms and brown algae in evolution. Among them, plant pathogenic oomycetes infect a wide variety of crops, causing serious agricultural economic losses worldwide. Plant pathogenic oomycetes account for about 60% of the total number of oomycetes, and can be divided into plant pathogenic oomycetes of the genus Phytophthora, Pythium, Peronospora, etc. Among them, the plant pathogenic oomycetes of the genus Phytophthora (Phytophthora spp.) are particularly harmful in agricultural production, including Phytophthora infestans, Phytophthora sojea and Phytophthora capsici. There are 6 species of plant pathogenic oomycetes of the genus Phytophthora, which have been listed as the world's top ten important plant pathogenic oomycetes. Pepper Phytophthora is a non-specific parasite with a wide range of hosts. It can infect more than 70 vegetable crops from 26 families, including Solanaceae, Leguminosae, and Cucurbitaceae. Pepper Phytophthora can cause diseases from the seedling stage to the fruiting stage of crops, and cause the rot of the roots, stems, and fruits of crops. In severe cases, the whole plant wilts or even dies down, which has a great impact on crop yield and quality, causing serious economic losses. At present, chemical control is mainly relied on for the pathogenic oomycetes of the genus Phytophthora that cause crop diseases. Due to certain differences in phylogeny between oomycetes and filamentous fungi, there are relatively few existing agents for the specific control of oomycetes. Commonly used agents in production, such as metalaxyl and oxazolidinone, were developed in the 1970s and 1990s. Under long-term large-scale use in production, they are facing increasingly serious drug resistance problems. Therefore, it is particularly important and urgent to develop oomycete fungicides based on new targets. The development and utilization of green pesticide molecular targets has become a major demand of the country.

[0003] In recent years, protein post-translational modification (PTM) has become the focus of molecular biology research due to its important role in expanding the functional diversity and complexity of the proteome. Among them, arginine methyltransferase (PRMT), as a key protein regulating upstream signaling pathways, is responsible for catalyzing the arginine methylation modification of other key target proteins such as histones and RNA-binding proteins, and plays an important role in intracellular transcriptional regulation, RNA shearing, DNA repair, signal transduction and other functions. Arginine methyltransferase 5 (PRMT5) is a type II PRMT that can catalyze the symmetric dimethylation modification (SDMA) of arginine side chains. Typical modified substrates include histones, ribosomal proteins, etc., and transcriptional regulation-related pathways and spliceosome functions are affected by PRMT5. In addition, PRMT5 also plays an extremely critical role in the cell differentiation and embryonic development of mammals. In studies on mice, it was found that the deletion of the coding gene of this protein would cause the death of mice. In humans, PRMT5 has been found to have a high level of expression in various cancer cells, and some PRMTs can affect the proliferation of cancer cells by methylating other proteins. Due to the high level of PRMT expression in cancer cells such as breast cancer, colon cancer, and prostate cancer, PRMT has become a popular target for the treatment of solid tumors and hematological tumors. So far, more than 10 small molecule compounds designed based on the structure of human PRMT5 protein, such as EPZ015938, PF-06939999, and JNJ-64619178, have entered the clinical trial stage. In the future, these compounds are expected to become a new type of oral drug for the treatment of cancer.

[0004] At present, the biological functions of arginine methylation modification and PRMT-related genes in plant pathogens, especially oomycetes, have not been analyzed. The present invention conducts functional research on arginine methyltransferase 5 (PRMT5) of plant pathogenic oomycetes of the genus Phytophthora, and explores its feasibility as a molecular target of a class of fungicides, which has important guiding significance for the prevention and control of crop diseases caused by plant pathogenic oomycetes of the genus Phytophthora and the creation of new fungicides. Summary of the invention

[0005] Based on the relevant research work on the function of PcPRMT5 protein in the typical Phytophthora plant pathogenic oomycete Phytophthora capsici, the inventors will have a deeper understanding of the role of arginine methylation modification of Phytophthora plant pathogenic oomycetes in regulating their growth and development and their interaction with the host, and provide reference and reference for the design of new control oomycete targets.

[0006] Based on Clastal W, the amino acid sequences of PRMT5 (PcPRMT5, PsPRMT5, PiPRMT5) of three typical Phytophthora plant pathogenic oomycetes, Phytophthora capsici, Phytophthora sojae, and Phytophthora infestans, were compared with those of human PRMT5. The results showed that the amino acid sequence similarity of PRMT5 (PcPRMT5, PsPRMT5, PiPRMT5) from three Phytophthora plant pathogenic oomycetes exceeded 90%, and the amino acid sequence similarity of PRMT5 from three Phytophthora plant pathogenic oomycetes was 63.17%, 63.32%, and 61.56%, respectively. At the same time, the PRMT5 proteins of three Phytophthora plant pathogenic oomycetes all have PRMT-specific protein motifs (MotifⅠ, PostⅠ, MotifⅡ, MotifⅢ, THW loop). Phylogenetic analysis of the co-construction tree of arginine methyltransferase protein sequences of three Phytophthora plant pathogenic oomycetes and multiple model research species based on MEGA11.0 revealed that the PRMT5 (PcPRMT5, PsPRMT5, PiPRMT5) of the three Phytophthora plant pathogenic oomycetes and human PRMT5 were clustered together, indicating that the Phytophthora plant pathogenic oomycete PRMT5 and human PRMT5 are orthologous proteins. By predicting the functional domains of the PRMT5 of the three Phytophthora plant pathogenic oomycetes, it was found that the PRMT5 of the three Phytophthora plant pathogenic oomycetes each contained a PRMT5 TIM barrel domain (PRMT5-TIM), a PRMT5 arginine-N-methyltransferase domain (PRMT5-N), and a PRMT5 Cterminal domain (PRMT5-C). The above results mean that PRMT5 is evolutionarily conserved across species and plays a similar role in different organisms.

[0007] For example, post-translational modifications of proteins such as phosphorylation and glycosylation have exceeded the scope of genome coding, greatly expanding the functional diversity of proteins and playing an important role in protein stability, subcellular localization and protein-protein interactions. Based on bioinformatics methods, we predicted multiple common post-translational modifications on three Phytophthora PRMT5 proteins, such as SUMOylation modification of lysine (97K) at position 97, N-glycosylation modification of aspartic acid (183N) at position 183, and phosphorylation modification of threonine (175T) at position 175. Clarifying the post-translational modifications at specific sites has certain reference significance for further functional studies of PRMT5 of plant pathogenic oomycetes of the genus Phytophthora.

[0008] Among the plant pathogenic oomycetes of the genus Phytophthora, pepper Phytophthora has established a mature gene editing technology based on the CRISPR / Cas9 system, and has many advantages such as simple genetic manipulation and abundant strain materials. The inventors used the standard strain LT1534 of pepper Phytophthora as a blueprint, and studied the gene function of PcPRMT5 through bioinformatics analysis technology and gene editing technology. By screening and comparing the phenotypic differences between mutants and wild-type and empty-load control strains, the effects of PPRMT5 of the plant pathogenic oomycetes of the genus Phytophthora on the growth and development and pathogenicity of pathogens were analyzed. Combined with the high sequence similarity and genetic conservation of PRMT5 in three common plant pathogenic oomycetes of the genus Phytophthora, such as pepper Phytophthora, soybean Phytophthora, and Phytophthora infestans, it is fully demonstrated from a biological level that this type of gene plays an important role in the plant pathogenic oomycetes of the genus Phytophthora.

[0009] Based on the research foundation of PRMT5 on plant pathogenic oomycetes of the genus Phytophthora represented by Capsicum frutescens, and the high conservation of PRMT5 among plant pathogenic oomycetes represented by the genus Phytophthora, it is shown that it has the potential to be developed as a new fungicide drug. At the same time, as a star target, PRMT5 has shown great potential in the treatment of cancer in humans and mammals. There are currently about thirty PRMT5 inhibitors under development, of which about half have entered the clinical stage. The fastest progress is GSK3326595, jointly developed by Epizyme and GlaxoSmithKline (GSK), which is a PRMT5 inhibitor that has entered Phase II clinical trials. In addition, domestic innovative pharmaceutical companies such as Shijiazhuang Pharmaceutical Group and Simcere Pharmaceuticals also have related products to follow up.

[0010] There are three main modes of PRMT5 inhibitors: 1. SAM competitive inhibitors: The binding pocket between PRMT5 and its methyl donor S-adenosylmethionine (SAM) is very conservative. SAM competitive inhibitors compete with SAM to bind to PRMT5, thereby preventing the methylation reaction. 2. Catalytic site inhibitors: By directly acting on the catalytic site of PRMT, it blocks its enzyme activity. 3. Substrate competitive inhibitors: This type of inhibitor competes with protein or peptide substrates to bind to PRMT5, thereby preventing PRMT5 from methylating its specific target substrate.

[0011] In order to test the potential of PRMT5 protein as a target for fungicides against plant pathogenic oomycetes of the genus Phytophthora, the protein structures of PRMT5 of three plant pathogenic oomycetes of the genus Phytophthora were predicted by AlphaFold2, and the virtual screening software Schrodinger Maestro 12.8 was used to conduct virtual screening of small molecule active compounds. The ligands of small molecule compounds were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). Nine compounds were selected based on the binding ability of PRMT5 protein with small molecule compounds and the structure of small molecule compounds. By measuring their inhibitory activity on the mycelial growth of three types of Phytophthora fungi, three small molecule inhibitor lead compounds were finally screened out. Molecular docking of these three small molecule inhibitor lead compounds with PRMT5 proteins of Phytophthora capsici, Phytophthora sojae, and Phytophthora infestans showed that they had good binding affinity with the PRMT5 proteins of these three types of Phytophthora. The above results fully demonstrate that PRMT5 protein has the potential to be a molecular agent target for plant pathogenic oomycetes of the genus Phytophthora, and has important application prospects.

[0012] Therefore, one of the objects of the present invention is to provide a class of arginine methyltransferase 5 (PRMT5) proteins in plant pathogenic oomycetes of the genus Phytophthora, and to name them based on the initials of the Latin names of different plant pathogenic oomycetes of the genus Phytophthora + PRMT5. For example: Phytophthora capsici Protein argininemethyltransferase 5 (PcPRMT5) is the following protein A1) or A2) A3) or A4):

[0013] A1) The amino acid sequence is a protein as shown in any one of 6 to 8 in the sequence listing;

[0014] A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a protein as shown in any one of SEQ ID NOs. 6-8;

[0015] A3) a protein derived from a protein as shown in any one of SEQ ID NOs. 6-8 having the same function as obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence as shown in any one of SEQ ID NOs. 6-8;

[0016] A4) An amino acid sequence that has a similarity of more than 75%, preferably more than 85%, and more preferably more than 95% to the amino acid sequence shown in any one of SEQ ID NOs. 6-8 and has the same function as the amino acid sequence shown in any one of SEQ ID NOs. 6-8.

[0017] In order to facilitate the purification of the protein in A1), a tag such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) can be connected to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in any one of sequences 6 to 8 in the sequence table.

[0018] The growth and development regulatory proteins in A1)-A4) above are generally derived from the plant pathogenic oomycetes of the genus Phytophthora in nature, that is, generally speaking, they are natural products, and can also be artificially expressed or synthesized, or their coding genes can be synthesized first and then biologically expressed. The coding genes of the proteins in A2)-A4) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequences shown in sequences 1-6 in the sequence table, and / or performing missense mutations of one or several nucleotide pairs, and / or connecting the coding sequences of the above tags at their 5' end and / or 3' end.

[0019] Among them, in A1), sequence 4 (PcPRMT5) in the sequence list consists of 629 amino acid residues, sequence 5 (PsPRMT5) consists of 630 amino acid residues, and sequence 6 (PiPRMT5) consists of 602 amino acid residues.

[0020] The second object of the present invention is to provide a nucleic acid molecule required for encoding the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA, hnRNA or tRNA.

[0021] Wherein, the coding gene of the above PRMT5 protein is as follows B1) or B2) or B3):

[0022] B1) a DNA molecule represented by the nucleotide sequence described in any one of sequences 1 to 3 in the sequence list;

[0023] B2) a cDNA molecule or a DNA molecule having 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1), and encoding the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora;

[0024] B3) A cDNA molecule or a DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the above-mentioned PRMT5 protein.

[0025] In the present invention, the DNA sequence (coding gene and cDNA) required for encoding the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora can be specifically shown in sequences 1-3 in the sequence table, wherein sequence 1 (PcPRMT5) in the sequence table consists of 2958 nucleotides; nucleotides 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 1 are coding sequences, encoding the protein PcPRMT5 shown in sequence 6 in the sequence table. Sequence 2 (PsPRMT5) in the sequence table consists of 2174 nucleotides; nucleotides 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 2 are coding sequences, encoding the protein PsPRMT5 shown in sequence 7 in the sequence table. Sequence 3 (PiPRMT5) in the sequence list consists of 2166 nucleotides; nucleotides 150-184, 258-822, 888-1563, 902-1577, and 1634-2166 from the 5' end of sequence 3 are coding sequences, encoding the protein PiPRMT5 shown in sequence 8 in the sequence list.

[0026] The third aspect of the present invention provides an original RNA sequence transcribed from any one of the above DNA sequences, or a codon-optimized RNA sequence, wherein the sequence of the RNA molecule is as follows C1) or C2):

[0027] C1) an RNA sequence transcribed from a DNA sequence as shown in any one of SEQ ID NOs. 1-3, which has a similarity of 75% or more, more preferably 85% or more, and more preferably 95% or more, and has the same function as the RNA sequence transcribed from the DNA sequence as shown in SEQ ID NOs. 1-3;

[0028] C2) An RNA sequence transcribed from a DNA sequence as shown in any one of SEQ ID NOs. 1-3.

[0029] The DNA sequence of the present invention can be molecularly hybridized with the DNA sequence shown in any one of the sequences 1-6 in the sequence list under stringent conditions and encodes a DNA sequence of a protein shown in any one of the sequences 6-8 in the sequence list. The above stringent conditions can be hybridization at 65°C with a solution of 6×SSC, 0.5% SDS, and then washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0030] The fourth object of the present invention is to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, a cosmid, a phage or a viral vector; the microorganism can be a yeast, a bacterium, an algae or a fungus, such as Agrobacterium; the transgenic plant cell line does not include a propagation material. Specifically, it can be any one of the following D1) to D10):

[0031] D1) an expression cassette containing the encoding gene;

[0032] D2) a recombinant vector containing the coding gene, or a recombinant vector containing the expression cassette described in D1);

[0033] D3) a recombinant microorganism containing the encoding gene, or a recombinant microorganism containing the expression cassette described in D1), or a recombinant microorganism containing the recombinant vector described in D2);

[0034] D4) a transgenic plant cell line containing the encoding gene, or a transgenic plant cell line containing the expression cassette described in D1);

[0035] D5) transgenic plant tissue containing the encoding gene, or transgenic plant tissue containing the expression cassette described in D2);

[0036] D6) a transgenic plant organ containing the encoding gene, or a transgenic plant organ containing the expression cassette described in D2);

[0037] D7) a nucleic acid molecule that inhibits the expression of the coding gene; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the coding gene, or a nucleic acid molecule that silences the coding gene, or may be a sgRNA fragment that encodes and expresses a target gene to be knocked out, such as the sgRNA sequence (coding sequence) CTTCTCCAGCGCCTGAGTGA targeting the PcPRMT5 coding gene;

[0038] D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7);

[0039] D9) a nucleic acid molecule that inhibits the translation of the above RNA molecule;

[0040] D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

[0041] The fifth object of the present invention is to provide the application of PRMT5 of plant pathogenic oomycetes of the genus Phytophthora, nucleic acid molecules encoding PRMT5 protein of plant pathogenic oomycetes of the genus Phytophthora, and biological materials containing nucleic acid molecules encoding PRMT5 protein of plant pathogenic oomycetes of the genus Phytophthora.

[0042] The application is any one or more of the following 1)-5):

[0043] 1) Application in regulating (increasing or decreasing) the number of sporangia, the developmental capacity of sporangia and / or the zoospore yield of plant pathogenic oomycetes of the genus Phytophthora;

[0044] 2) Application in regulating (increasing or decreasing) the growth rate of mycelium of plant pathogenic oomycetes of the genus Phytophthora;

[0045] 3) Application in regulating (increasing or decreasing) the ability of Phytophthora plant pathogenic oomycetes to infect hosts;

[0046] 4) Application in regulating (increasing or decreasing) the pathogenicity of Phytophthora plant pathogenic oomycetes to hosts;

[0047] 5) Application in inhibiting and / or killing plant pathogenic oomycetes of the genus Phytophthora.

[0048] Preferably, the application includes achieving the application described in 1)-5) by inhibiting the transcription of the coding gene described in sequences 1-3 or making it inactive, or inhibiting the translation of the RNA molecule, or inhibiting the activity of the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora described in sequences 6-8 or making it (completely) inactive.

[0049] In the application, by inhibiting the transcription of the above-mentioned coding gene, or inhibiting the translation of the above-mentioned RNA sequence, or inhibiting and / or inactivating the activity of the above-mentioned Phytophthora plant pathogenic oomycete PRMT5 protein, the growth rate of hyphae is interfered with, the zoospore production is affected, and the ability to infect the host is regulated, thereby inhibiting and / or killing the growth of Phytophthora pathogenic fungi.

[0050] The sixth object of the present invention is to provide the use of the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora shown in sequences 6-8 in the sequence list and the encoding gene shown in sequences 1-3 in the above sequence list as antibacterial or fungicide targets in screening antibacterial or fungicide agents for pepper Phytophthora pathogen.

[0051] The seventh object of the present invention is to provide a method for screening or assisting in screening pepper phytophthora antibacterial and / or fungicide, the method comprising applying a substance to be detected to the pepper phytophthora pathogen, when the substance to be detected can inhibit the transcription of the above DNA sequence, or inhibit the translation of the above RNA sequence, or inhibit the activity of the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora as shown above or make it lose its activity, then the substance to be detected is a candidate for the plant phytophthora antibacterial and / or fungicide.

[0052] The eighth object of the present invention is to provide a method for reducing the activity of a plant pathogenic oomycete of the genus Phytophthora (e.g., Phytophthora capsici), comprising the following steps: inhibiting the transcription of the above-mentioned coding gene or making it deleted, or inhibiting the translation of the RNA molecule, or inhibiting the activity of the above-mentioned plant pathogenic oomycete PRMT5 protein or making it inactive;

[0053] Among them, the reducing the activity of the plant pathogenic oomycetes of the genus Phytophthora is to reduce the infection ability of the Phytophthora fungus to the host and / or the pathogenicity to the host, and / or reduce the growth rate of the plant pathogenic oomycetes of the genus Phytophthora, and / or inhibit the zoospore production of the plant pathogenic oomycetes of the genus Phytophthora.

[0054] In the above method, the activity of the protein is inhibited or inactivated by inhibiting or reducing the expression of the gene encoding the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora. Specifically, this can be achieved by gene knockout or gene silencing.

[0055] The gene knockout refers to the phenomenon that a specific target gene loses its activity through homologous recombination. Gene knockout is the phenomenon that a specific target gene loses its activity through changes in its DNA sequence.

[0056] Gene silencing refers to the phenomenon of making a gene non-expressed or low-expressed without damaging the original DNA. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specific inhibition of the target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition.

[0057] Preferably, the activity of the protein shown in Sequence 6-8 in the sequence list is lost by knocking out the gene shown in Sequence 1-3 in the sequence list.

[0058] In one embodiment of the present invention, the method for knocking out the above-mentioned gene is a gene knockout method based on CRISPR / Cas9.

[0059] Specifically, the gene knockout method based on CRISPR / Cas9 is to transfect the Donor vector and sgRNA expression vector of the target gene and the Cas9 expression plasmid into pepper phytophthora to screen for recombinant bacteria in which the target knockout protein loses its activity.

[0060] The Donor vector (such as pBS-PcPRMT5-NPTII) is a recombinant vector containing a sequence of 800-1500bp upstream of the target gene to be knocked out, a Donor DNA sequence (which can be a gene sequence such as NPTII or GFP or RFP) and a sequence of 800-1500bp downstream of the target gene to be knocked out. The sgRNA and Cas9 protein co-expression plasmid is a vector encoding a sgRNA fragment targeting the target gene to be knocked out and a DNA sequence expressing the Cas9 protein (such as pYF515-PcPRMT5), wherein the target gene to be knocked out is sequence 1-3 in the sequence list, and the sgRNA sequence targeting the PcPRMT5 gene is sgPcPRMT5: CTCGGACGAGTGCATCCTAG. Preferably, the sgRNA expression plasmid is based on the pYF515 vector as the starting vector, and the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PcPRMT5 gene is inserted between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector to obtain the sgRNA expression plasmid.

[0061] In the above application, the substance that inhibits the expression and / or activity of PcPRMT5 protein is a substance that inhibits the expression of PcPRMT5 protein and / or inhibits the transcription of the gene encoding the PcPRMT5 protein and / or inhibits the translation of the RNA molecule obtained by transcription of the gene encoding the PcPRMT5 protein.

[0062] Experiments have shown that the PcPRMT5 protein provided by the present invention plays an important role in the growth and development of pepper phytophthora itself and in the pathogenic process. The PcPRMT5 gene knockdown mutant was obtained using CRISPR / Cas9 gene editing technology. Compared with the wild type and empty vector strains: the mycelial growth rate, sporangium production, and zoospore production of the PcPRMT5 gene knockdown heterozygous mutant were significantly reduced, and the ability to infect host plants tobacco and pepper was significantly weakened. The PcPRMT5 complementation strain had no significant difference in mycelial growth rate, sporangium production, and zoospore production compared with the wild type, but the pathogenicity to host plants tobacco and pepper could not be restored to a level comparable to that of the wild type.

[0063] Therefore, it is shown that the PcPRMT5 protein of Capsici can play an important role in multiple processes of Capsici Phytophthora, such as vegetative growth, asexual reproduction and host infection. The present invention provides technical support for the study of the pathogenic mechanism of Phytophthora, and provides a research basis for potential molecular targets for the prevention and control of plant diseases caused by oomycetes and the development of new fungicides.

[0064] Experiments have shown that the protein of the present invention plays an important role in the growth and development and pathogenicity of the typical Phytophthora plant pathogenic oomycete, Phytophthora capsici. The loss or reduced expression level of such protein causes the slow growth rate of Phytophthora capsici hyphae, reduced sporangium production, reduced number of zoospores, and reduced pathogenicity. The corresponding arginine methyltransferase inhibitors have different degrees of activity against typical plant pathogenic oomycetes such as Phytophthora capsici, Phytophthora sojae, and Phytophthora infestans. The gene provided by the present invention has great application potential in preventing and controlling crop diseases caused by Phytophthora plant pathogenic oomycetes. The new fungicide developed based on such protein as the target has important practical significance for controlling the occurrence and prevalence of crop diseases caused by Phytophthora. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 (a) Schematic diagram of the structural domain of PRMT5 in pepper, soybean, and human. (b) Model diagram of the protein structure of pepper, soybean, and human PRMT5. (c) Phytogenic analysis results of the co-construction tree of arginine methyltransferase protein sequences of PRMT5 proteins of plant pathogenic oomycetes of the genus Phytophthora and various model research species based on MEGA 11.0 (Note: The numbers on the branch lines represent the length of the evolutionary branch. The shorter the branch length, the smaller the difference and the closer the evolutionary distance).

[0066] Figure 2 This is a schematic diagram of the amino acid sequence alignment of PRMT5 of pepper phytophthora, soybean phytophthora, and Phytophthora infestans with PRMT5 of various model species (Note: Hs: Homo sapiens; At: Arabidopsis thaliana; Pc: Phytophthora capsici; Ps: Phytophthora sojae; Pi: Phytophthora infestans; Ce: Caenorhabditis elegans; Dm: Drosophila melanogaster).

[0067] Figure 3 The figure shows the mycelial morphology, mycelial growth rate, number of sporangia, number of zoospores, and arbuscular germination rate of the wild-type pepper Phytophthora strain LT1534 (WT), the control empty strain (CK), the PcPRMT5 gene knockdown mutant (Kd_PcPRMT5-1), and the PcPRMT5 gene knockdown complemented strain (PcPRMT5-C3).

[0068] Figure 4This is a statistical bar graph of the pathogenicity of wild-type pepper Phytophthora strain LT1534 (WT), control empty strain (CK), PcPRMT5 gene knockdown mutant (Kd_PcPRMT5-1), and PcPRMT5 gene knockdown complement strain (PcPRMT5-C3) on tobacco and pepper leaves, as well as the lesion area data.

[0069] Figure 5 These are the results of toxicity tests of wild-type pepper Phytophthora strain LT1534, wild-type soybean Phytophthora strain P6497, and wild-type infesting Phytophthora strain DH50 under different concentrations of lead compounds GSK591, JNJ-64619178, and HLCL-61.

[0070] Figure 6 These are the molecular docking results of PRMT5 proteins of pepper, soybean and Phytophthora infestans and the lead compound GSK591.

[0071] Figure 7 These are the molecular docking results of PRMT5 proteins of pepper, soybean and Phytophthora infestans and the lead compound JNJ-64619178.

[0072] Figure 8 These are the molecular docking results of PRMT5 proteins of pepper, soybean and Phytophthora infestans with the lead compound HLCL-61. DETAILED DESCRIPTION

[0073] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0074] The pepper phytophthora standard strain LT1534 is preserved by the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. It has been published in the document "Wang, W., et al., PcMuORP1, an Oxathiapiprolin-Resistance Gene, Functions as a Novel Selection Marker for Phytophthora Transformation and CRISPR / Cas9 Mediated Genome Editing. Frontiers in Microbiology, 2019.10." and is available to the public from China Agricultural University.

[0075] Culture medium or reagent formula:

[0076] 10% V8 solid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir to mix, dilute 10 times with deionized water, i.e. add 900 mL deionized water, add 15 g Agar, and sterilize at 121°C for 20 min.

[0077] 10% V8 liquid culture medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir and mix, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute 10 times with deionized water, and sterilize at 121°C for 20 min.

[0078] Nutrient pea broth (NPB): 125g peas were added to 1L deionized water, sterilized at 121℃ high pressure and heat for 20min, and filtered through gauze to obtain pea nutrient solution; 2.0g yeast extract, 5.0g glucose, 5.0g mannitol, 5.0g sorbitol, 2.0g CaCO3, 0.1g CaCl2, 0.5g MgSO4, 3.0g KNO3, 1.0g K2HPO4, 1.0g KH2PO4, stirred and mixed, centrifuged at 3000rpm for 10min or allowed to stand for 30min, the supernatant was taken, and the volume was adjusted to 1L with pea nutrient solution, and 15g agar powder was added to the solid culture medium (NPBA), and sterilized by heat and heat for 20min. Before use, 2mL vitamin stock solution (Biotin 6.7×10 -7 g / mL; Folic acid 6.7×10 -7 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid 4.0×10 -5 g / mL; Pyridoxine-HCl 6.0×10 -4 g / mL; Riboflavin 5.0×10 - 5 g / mL; Thiamine-HCl 1.3×10 -3 g / mL) and 2 ml of trace element stock solution (FeC6H5O7·3H2O 5.4×10 -4 g / mL; ZnSO4·7H2O 3.8×10 -4 g / mL; CuSO4·5H2O 7.5×10 -4 g / mL; MgSO4·H2O 3.8×10 -5 g / mL; H3BO32.5×10 -5 g / mL; Na2MoO4·H2O 3.0×10 -5 g / mL).

[0079] Pea Mannitol Medium (PM): 91.1 g mannitol, 1 g CaCl2, 2 g CaCO3, add about 900 mL pea nutrient solution, stir and mix for about 30 minutes, centrifuge at 3000 rpm for 10 minutes or let stand for 30 minutes, take the supernatant, make up to 1 L with pea nutrient solution, add 15 g agar powder to the solid culture medium (PMA), and sterilize with wet heat for 20 minutes.

[0080] Mycelial hydrolysate (20 mL): 10 mL 0.8 M mannitol, 0.8 mL 0.5 M KCl, 0.8 mL 0.5 M 4-morpholineethanesulfonic acid, 0.4 mL 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyase (Sigma, cat. No. L1412), dilute to 20 mL with sterile ultrapure water, mix well to dissolve, filter and sterilize with 0.22 μm filter membrane, and prepare before use.

[0081] MMG solution (250 mL): 18.22 g mannitol, 0.76 g MgCl2·6H2O, 2.0 mL 0.5 M 4-morpholineethanesulfonic acid (pH = 5.7), dilute to 250 mL with ultrapure water, and sterilize by filtration with a 0.22 μm filter membrane.

[0082] W5 solution: 0.1 g KCl, 4.6 g CaCl2·2H2O, 2.25 g NaCl, 7.8 g glucose, dissolved in ultrapure water to 250 mL, and sterilized by filtration with a 0.22 μm filter membrane.

[0083] PEG-CaCl2 solution (40% w / v): 12 g PEG 4000, 3.75 mL 0.5 M CaCl2, 3 mL sterile ultrapure water, sterilized by filtration with a 0.22 μm filter membrane.

[0084] Example 1. Obtaining the PcPRMT5 protein of Phytophthora capsici and its encoding gene and comparing the homology of PRMT5 proteins of Phytophthora plant pathogenic oomycetes

[0085] In this embodiment, the PcPRMT5 protein of Phytophthora capsici and its coding gene (or cDNA) can be obtained by amplification of the primers listed in Table 1 using the DNA (or cDNA) of the Phytophthora capsici strain LT1534 as a template. Among them, the material for DNA or RNA extraction is the mycelium of the Phytophthora capsici strain LT1534. Among them, sequence 1 (PcPRMT5) in the sequence list consists of 2958 nucleotides; the nucleotides 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 1 are the coding sequence, encoding the protein PcPRMT5 shown in sequence 6 in the sequence list. The above-mentioned protein or gene can also be artificially synthesized.

[0086] The DNA sequence (coding gene and cDNA) of the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora can be specifically shown as sequences 2-3 in the sequence table, and the amino acid sequence of the PRMT5 protein of Phytophthora sojae is shown as sequence 2 (PsPRMT5) in the sequence table, and sequence 2 consists of 2174 nucleotides; nucleotides 6-71, 148-197, 271-853, 899-1574, and 1641-2173 from the 5' end of sequence 2 are the coding sequence, encoding the protein PsPRMT5 shown in sequence 7 in the sequence table.

[0087] The amino acid sequence of the PRMT5 protein of Phytophthora infestans is shown in sequence 3 (PiPRMT5) in the sequence list, and sequence 3 consists of 2166 nucleotides; nucleotides 150-184, 258-822, 888-1563, 902-1577, and 1634-2166 from the 5' end of sequence 3 are coding sequences, encoding the protein PiPRMT5 shown in sequence 8 in the sequence list.

[0088] Table 1. Primers for amplifying the full-length coding gene of PcPRMT5

[0089]

[0090] As shown in Table 2, the amino acid sequence similarity of the proteins from the three phytopathogenic oomycetes of the genus Phytophthora (PcPRMT5, PsPRMT5, PiPRMT5) is more than 90%, and the amino acid sequence similarity between them and human PRMT5 is 63.17%, 63.32%, and 61.56%, respectively. At the same time, the PRMT5 proteins of the three phytopathogenic oomycetes of the genus Phytophthora all have a PRMT-specific domain (motif I,). Through phylogenetic analysis of the PRMT5 proteins of the genus Phytophthora and the arginine methyltransferase protein sequence co-construction tree of various model research species, it was found that the PRMT5 of the three phytopathogenic oomycetes of the genus Phytophthora (PcPRMT5, PsPRMT5, PiPRMT5) and human PRMT5 are clustered together, indicating that the PRMT5 of the genus Phytophthora and human PRMT5 are orthologous proteins. By predicting the PRMT functional domains of three Phytophthora plant pathogenic oomycetes, it was found that the PRMT5 of the three Phytophthora plant pathogenic oomycetes each contained a PRMT5 TIM barrel domain (PRMT5-TIM), a PRMT5 arginine-N-methyltransferase domain (PRMT5-N), and a PRMT5 C terminal domain (PRMT5-C). The above results mean that PRMT5 is evolutionarily conserved across species and plays a similar role in different organisms.

[0091] Table 2 Amino acid sequence similarity between PRMT5 of three Phytophthora plant pathogenic oomycetes and human PRMT5 (%)

[0092]

[0093] Example 2: Construction of a gene knockout and complementation vector for PcPRMT5 of Phytophthora capsici

[0094] The method for constructing a gene knockout vector based on CRISPR / Cas9 and the sequences of the related vectors in this embodiment are disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of aneffector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.” The pBluescript II SK+ homology arm vector plasmid (Donor vector) used in this example was donated by Professor Brett M. Tyler of Oregon State University, USA. The expression vector pYF515 fused with sgRNA and Cas9 and the Phytophthora expression vector pTOR fused with 3×Flag tags were provided by the Plant Pathogens and Fungicide Interaction Laboratory, College of Plant Protection, China Agricultural University.

[0095] Among them, the vector pBluescript II SK+ is used to carry Donnor and homology arm fragments. The vector pYF515 is used to transcribe the sgRNA targeting the target sequence and express the Cas9 protein for enzyme cleavage of the target fragment. The vector pTOR is used for the complementary expression of Phytophthora protein. Through the CRISPR / Cas9 system based on non-homologous end joining (NHEJ), the target gene sequence can be edited by designing the sgRNA sequence that specifically targets the target protein encoding gene and the homology arm sequence based on 1000bp upstream and downstream of the target sequence.

[0096] The specific construction methods of the Donor-carrying and homology arm fragment vector pBS-PcPRMT5-NPTII, the sgRNA transcription and Cas9 protein expression vector pYF515-PcPRMT5, and the complementation vector pTOR-3Flag-PcPRMT5 used in this embodiment are as follows:

[0097] 1) Construction of homology arm vector of pBS-PcPRMT5-NPTII: Using DNA of pepper Phytophthora strain LT1534 as template, primers were designed using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the upstream 1000 bp of the target gene PcPRMT5 (shown in sequence 4 in the sequence table), and the primers shown in pBS-PcPRMT5-NPTII-F1 and pBS-PcPRMT5-NPTII-R1 shown in Table 3 were used for amplification. The NPTII gene (NPTII gene) was amplified using the pYF2-Cas9 backbone plasmid as a template using the primers pBS-PcPRMT5-NPTII-F2 and pBS-PcPRMT5-NPTII-R2 shown in Table 3. The downstream 1000 bp sequence of the PcPRMT5 gene (shown in sequence 5 in the sequence table) was amplified using the primers pBS-PcPRMT5-NPTII-F2 and pBS-PcPRMT5-NPTII-R2 shown in Table 3. The three amplified fragments of the three genes were fused and connected into the linearized plasmid pBluescript II SK+ (EcoR V digested) using the HD Cloning Kit. The ligation products were then transformed into Escherichia coli DH5α competent cells. After overnight culture at 37°C, single clones were picked and verified by PCR using universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') and sequenced.

[0098] 2) Construction of pYF515-PcPRMT5: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the RNA structure online analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), sgRNA sequences that specifically target the PcPRMT5 gene sequence and have a weak secondary structure (sgPcPRMT5: GTACGAAAAGGCCATCACTC, targeting positions 1222-1242 of SEQ ID No. 1 of the PcPRMT5 gene) were selected, and sgRNA sequence primers with NheI and BsaI restriction sites and HH ribozyme were synthesized (as shown in Table 3). Dissolved in sterile water to a 100 μM solution. Annealing reaction was used to synthesize double-stranded sgRNA sequences. The reaction system was as follows: 3 μL forward chain solution, 3 μL reverse chain solution, 3 μL 10×T4 DNA Ligase Buffer (NEB), 4 μL 0.5 M NaCl, and 21 μL ultrapure sterile water. Mix by pipetting, react at 100°C for 2 min, and cool naturally at room temperature for 4 h. The reaction solution was then diluted 500 times. Then take 2 μL 10×T4 DNA Ligase Buffer (NEB), 50 ng pYF515 vector (Nhe I / Bsa I double enzyme digestion), 4 μL diluted double-stranded sgRNA solution, 1 μL T4 DNA Ligase, and make up to 20 μL with sterile ultrapure water. React at room temperature for 30 min, use 5 μL of ligation product to transform Escherichia coli DH5α competent cells, and culture at 37°C overnight. Use primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') to verify the monoclonal colony by PCR, and sequence to verify the positive clone.

[0099] 3) Construction of pTOR-3Flag-PcPRMT5: Using the cDNA of pepper phytophthora strain LT1534 as a template, primers were designed using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the target gene PcPRMT5 CDS fragment for insertion into the vector. The fragment was amplified using the primers pTOR-PcPRMT5-CDS-F1 and pTOR-PcPRMT5-CDS-R1 shown in Table 3. 50 ng of pTOR vector (Nhe I / Not I double digestion) and 4 μL of PcPRMT5 CDS fragment gel were used to recover the product solution. The above gene fragments were fused and connected into the linearized plasmid pTOR vector (double digested with Nhe I / Not I) using the HD Cloning Kit, and the ligation product was then transformed into Escherichia coli DH5α competent cells. After overnight culture at 37°C, single clones were picked and verified by PCR using universal primers pTOR_F (sequence: 5'-GCACAGGGATCGTTTCTGAT-3') / pTOR_R (sequence: 5'-GCACAGGGATCGTTTCTGAT-3') and sequenced.

[0100] Table 3. Primers used for the construction and amplification of the knockout and complementation vectors of PcPRMT5 gene in Phytophthora capsici

[0101]

[0102] Example 3. Obtaining PcPRMT5 gene knockdown mutants and complemented strains of Phytophthora capsici

[0103] The PcPRMT5 gene knockout mutant was prepared by a CaCl2-PEG-mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the document “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17 (1), 127-139.”

[0104] The gene sequence of the insert fragment PcMuORP1 used in this example has been published in the document “Wang, W., Xue, Z., Miao, J., Cai, M., Zhang, C., Li, T., Zhang, B., Tyler, BM and Liu, X. (2019) PcMuORP1, an Oxathiapiprolin-Resistance Gene, Functions as a Novel Selection Marker for Phytophthora Transformation and CRISPR / Cas9 Mediated Genome Editing. Front. Microbiol. 10, 2402.”

[0105] The acquisition of single gene knockout mutants is specifically to use the knockout series vectors in Example 2 in combination (for example: Donor vector pBS-PcPRMT5-NPTII with fusion sgRNA and Cas9 expression vector pYF515-PcPRMT5), and transfer them into the wild-type strain LT1534 of pepper phytophthora by PEG-mediated protoplast transformation. After the transferred protoplasts are revived as mycelium, they are covered with G418 V8 solid culture medium containing 50 μg / ml concentration, and the plates are placed in the dark at 25°C for incubation. After 2-3d screening, resistance-marked mycelium is obtained, and DNA is extracted for PCR verification. The mutants that are positive for PCR verification are then extracted for RNA RT-qPCR verification. After continuous attempts, the homozygous knockout mutant of the PcPRMT5 gene was not successfully obtained, and the heterozygous knockdown mutant Kd_PcPRMT5-1 with a PcPRMT5 expression level below 50% of the WT strain was selected as the research object. At the same time, the wild-type strain of Phytophthora capsici that was transformed with the backbone vector plasmid and successfully obtained the resistance selection marker was used as the vector control strain CK.

[0106] The single gene knockout complementation strain was obtained by using the same PEG-mediated protoplast transformation method to transform the vector pTOR-3Flag-PcPRMT5 connected with the PcPRMT5 CDS fragment in Example 2 into the obtained knockdown mutant Kd_PcPRMT5-1 for PcPRMT5 gene complementation expression, and detecting and selecting the strain PcPRMT5-C3 with an expression level close to that of the wild type as the research object through RT-qPCR.

[0107] Example 4: Analysis of biological characteristics of knockout mutants of the PcPRMT5 gene sequence of Phytophthora capsici

[0108] 1. Mycelial growth rate detection

[0109] The wild-type pepper Phytophthora strain LT1534 (WT), the vector control (CK), the PcPRMT5 heterozygous knockdown mutant (Kd_PcPRMT5-1) obtained in Example 3, and the PcPRMT5 complemented strain (PcPRMT5-C3) obtained in Example 4 were inoculated in the center of a 90 mm V8 solid plate and cultured at 25 ° C in the dark for 3 days. The colony diameter of each strain was measured by the cross method, and three technical replicates were recorded for each strain, and three biological replicates were performed.

[0110] The results are as follows Figure 3 As shown in the figure, the mycelial growth rate of the PcPRMT5 knockdown mutant was significantly lower than that of the wild type, CK, and complemented strains (*, P<0.05). The experimental results showed that the decrease in the expression level of PcPRMT5 affected the mycelial growth rate of P. capsici.

[0111] 2. Detection of the number of sporangia and zoospores

[0112] The wild-type pepper phytophthora strain LT1534 (WT), the vector control (CK), the PcPRMT5 heterozygous knockdown mutant (Kd_PcPRMT5-1) obtained in Example 3, and the PcPRMT5 complementation strain (PcPRMT5-C3) obtained in Example 4 were inoculated in the center of a 90mm V8 solid plate, cultured for 3d under 25°C dark conditions, and then placed under 25°C strong light / dark alternating conditions for 3d to induce sporangium production. The morphology of the sporangium in the plate was then observed under a microscope at 100 times the field of view and the number was recorded by taking photos. The plate treated with light-induced spore production under the same conditions was completely infiltrated with 15ml of sterile precooled on ice, placed in a 4°C refrigerator for 30min, and at room temperature (25°C) for 30min to induce zoospore release. The zoospore suspension in the plate was aspirated and the morphology of zoospore production was observed through a hemocytometer under a microscope at 100 times the field of view, and the number was recorded by taking photos. Three technical replicates were recorded for each strain, and three biological replicates were performed.

[0113] The results are as follows Figure 3 As shown in the figure, the number of sporangia and zoospores of the PcPRMT5 knockdown mutant was significantly lower than that of the wild type, CK, and complemented strains (*, P<0.05). In addition, some sporangia of the PcPRMT5 knockdown mutant were morphologically deformed. The experimental results showed that the reduced expression level of PcPRMT5 had a certain effect on the asexual spore development of Phytophthora capsici.

[0114] 3. Morphological detection of resting spores and statistics of germination rate

[0115] The above method was used to obtain the zoospores of wild-type pepper phytophthora strain LT1534 (WT), vector control (CK), PcPRMT5 heterozygous knockdown mutant (Kd_PcPRMT5-1) obtained in Example 3, and PcPRMT5 complementation strain (PcPRMT5-C3) obtained in Example 4. The zoospore suspension of each strain was oscillated on a vortex oscillator for 1 min to obtain a resting spore suspension, which was placed in the dark at 25°C for 4 h, and the morphology of each treatment resting spore was observed under a microscope at a 100x field of view and photographed, and the germination ratio of the resting spores in each field of view was counted at the same time point in the photo. Three technical replicates were recorded for each strain, and three biological replicates were performed.

[0116] The results are as follows Figure 3 As shown, the apnospore germination rate of the PcPRMT5 knockdown mutant was not significantly different from that of the WT, CK, and complemented strains (*, P<0.05), indicating that PcPRMT5 does not affect the apnospore germination of pepper Phytophthora.

[0117] 4. Statistics and observation of pathogenicity results

[0118] The test plants were Capsicum annuum and Nicotiana benthamiana. The plant seedlings were planted in seedling trays (540 mm × 280 mm, 48 holes per tray), the culture medium was peat soil and vermiculite in a ratio of 2:1, and an appropriate amount of deionized water was added, and cultured in a greenhouse (27 ± 2 ° C) for 3-4 weeks.

[0119] A 5 mm round hole punch was used to punch a fungus cake on the solid medium of Capsicum frutescens V8 cultured for 3-4 days, and the cake was inoculated on the back of leaves with a length of 5-8 cm. Each leaf was inoculated with one fungus cake. After culturing at 25°C in the dark and moisturizing for 3 days, the lesion area (mm2) of pepper and Nicotiana benthamiana leaves infected by Capsicum frutescens was investigated. 2 ). Three technical replicates and three biological replicates were set for each strain.

[0120] The results are as follows Figure 4 As shown, the pathogenicity level of the PcPRMT5 knockdown strain Kd_PcPRMT5-1 on pepper leaves was significantly lower than that of WT, CK, and complemented strains (*, P<0.05). The results showed that PcPRMT5 protein has the ability to affect the ability of pepper Phytophthora to infect host plants.

[0121] Experiments have shown that the PcPRMT5 protein provided by the present invention can affect the growth and development of pepper phytophthora and the infection of host plants. Compared with the wild-type strain and the control strain into which the empty vector was transferred, the PcPRMT5 knockdown mutant also showed significantly lower mycelial growth levels, sporangia and zoospore numbers, and pathogenicity than the wild-type and control strains. Therefore, the infection process of pepper phytophthora can be controlled, the disease cycle can be cut off, and the purpose of controlling the large-scale occurrence of the disease can be achieved by inhibiting or affecting the function of the PcPRMT5 protein.

[0122] Example 5: Study on the activity of small molecule compound inhibitors against PRMT5 protein of plant pathogenic oomycetes of the genus Phytophthora

[0123] 5. Screening of lead compounds and toxicity determination

[0124] AlphaFold 2 was used to predict the PRMT5 protein structures of pepper, soybean and infestation phytophthora. The virtual screening software Schrodinger Maestro12.8 was used to screen small molecule active compounds based on the crystal structures of the three phytophthora PRMT5 proteins. The ligand small molecule compounds were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ). In this study, nine small molecule compounds were selected based on the binding ability of PRMT5 protein with small molecule compounds and the structure of small molecule compounds. Wild-type pepper phytophthora strain LT1534 and wild-type soybean phytophthora strain P6497 were inoculated in the center of 90mm V8 solid plates containing different concentrations (5μg / mL, 10μg / mL, 20μg / mL) of small molecule compounds, and wild-type infestation phytophthora strain DH50 was inoculated in the center of 90mm tomato rye solid plates containing different concentrations (5μg / mL, 10μg / mL, 20μg / mL) of small molecule compounds. Wild-type pepper Phytophthora strain LT1534 and wild-type soybean Phytophthora strain P6497 were cultured at 25℃ in the dark for 3 days, and wild-type infesting Phytophthora strain DH50 was cultured at 18℃ in the dark for 7 days. The colony diameter of each strain was measured by the cross method, and three technical replicates were recorded for each treatment, and three biological replicates were performed. By measuring their inhibitory activity on the mycelial growth of the three Phytophthora fungi, three small molecule inhibitor lead compounds, GSK591, JNJ-64619178, and HLCL-61 were finally screened out.

[0125] The molecular formulas of GSK591, JNJ-64619178 and HLCL-61 are as follows:

[0126]

[0127] The results are as follows Figure 5 As shown in the figure, the mycelial growth rate of pepper phytophthora, soybean phytophthora, and infestation phytophthora was significantly lower than that of the respective DMOS control treatments under the three different concentrations of lead compounds GSK591, JNJ-64619178, and HLCL-61 (*, P<0.05). This indicates that some lead compounds targeting PRMT5 can have certain activity against pepper phytophthora, soybean phytophthora, and infestation phytophthora. The lead compound HLCL-61 showed a high inhibitory effect on pepper phytophthora, soybean phytophthora, and infestation phytophthora. The EC 50 The above toxicity test results prove that the PRMT5 protein of the plant pathogenic oomycete of the genus Phytophthora has the potential to be developed as a new type of fungicide target.

[0128] VI. Molecular docking of PRMT5 proteins of Phytophthora capsici, Phytophthora sojae, and Phytophthora infestans with compounds GSK591, JNJ-64619178, and HLCL-61

[0129] Auto Dock Vina software was used for molecular docking analysis. The ligands were derived from the PubChem small molecule library (https: / / pubchem.ncbi.nlm.nih.gov / ), and the receptors were protein structures predicted by AlphaFold 2. First, the ligand molecules obtained from PubChem were preprocessed, including removing water molecules, adding hydrogen atoms, and converting to PDBQT format; similarly, the receptor structure generated by AlphaFold 2 was preprocessed accordingly. The processed ligand and receptor molecules were imported into Auto Dock Vina, and a grid box was set to cover the active site of the receptor. Then, the simulation was run and the binding free energy (binding affinity) of each ligand binding to the receptor was recorded. Molecular docking results ( Figure 6-8) showed that the binding free energies of the lead compound GSK591 with the PRMT5 protein receptors of pepper phytophthora, soybean phytophthora, and infestation phytophthora were -5.5Kcal / mol, -6.3Kcal / mol, and -5.9Kcal / mol, respectively. The binding free energies of the lead compound JNJ-64619178 with the PRMT5 protein receptors of pepper phytophthora, soybean phytophthora, and infestation phytophthora were -7.9Kcal / mol, -8.3Kcal / mol, and -7.6Kcal / mol, respectively. The binding free energies of the lead compound HLCL-61 with the PcPRMT5 protein receptors of pepper phytophthora, soybean phytophthora, and infestation phytophthora were -6.9Kcal / mol, -7.1Kcal / mol, and -7.9Kcal / mol, respectively. The above results show that the lead compounds GSK591, JNJ-64619178, and HLCL-61 have certain binding affinity with the three Phytophthora PRMT5 proteins. Combined with conformational analysis, it was revealed that GSK591, JNJ-64619178 and PRMT5d protein mainly interacted with each other through hydrophobic forces. HLCL-61 was able to form multiple stable hydrogen bonds and hydrophobic interactions, which may be one of the key reasons why it showed higher activity than GSK591 and JNJ-64619178. In addition, the results of molecular docking were consistent with the results of biological activity experiments, indicating the effectiveness of molecular docking predictions. These results provide important structural information support for further optimization and improvement of lead compounds, and also provide a theoretical basis for the design of more specific and efficient agricultural inhibitors.

Claims

1. The arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora, which is the protein of A1) or A2) or A3) or A4) as follows: A1) The amino acid sequence is a protein as shown in any one of SEQ ID NOs. 6-8; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a protein as shown in any one of SEQ ID NOs. 6-8; A3) a protein derived from the protein shown in SEQ ID NO: 2, which has the same function as the amino acid sequence shown in any one of SEQ ID NO: 6-8, by substitution and / or deletion and / or addition of one or more amino acid residues; A4) An amino acid sequence that has a similarity of more than 75%, preferably more than 85%, and more preferably more than 95% to the amino acid sequence shown in any one of SEQ ID NOs. 6-8 and has the same function as the amino acid sequence shown in any one of SEQ ID NOs. 6-8.

2. A gene encoding the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora as shown in claim 1; preferably, the encoding gene is the following B1) or B2) or B3): B1) a DNA molecule represented by the nucleotide sequence described in any one of sequences 1 to 3 in the sequence list; B2) a cDNA molecule or a DNA molecule having 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1), and encoding the protein of claim 1; B3) A cDNA molecule or a DNA molecule which hybridizes with the nucleotide sequence defined in B1) or B2) under stringent conditions and encodes the protein described in claim 1.

3. The RNA molecule obtained by transcription of the coding gene according to claim 2; preferably, the sequence of the RNA molecule is as follows C1) or C2): C1) an RNA sequence having a similarity of 75% or more, more preferably 85% or more, and more preferably 95% or more to an RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1 and having the same function as the RNA sequence transcribed from the DNA sequence as shown in SEQ ID NO: 1; C2) RNA sequence transcribed from the DNA sequence shown in SEQ ID NO:

1.

4. A biological material containing a nucleic acid molecule related to the coding gene as described in claim 2 or the RNA molecule as described in claim 3, which is any one of the following D1) to D10): D1) an expression cassette containing the coding gene according to claim 2; D2) a recombinant vector containing the coding gene according to claim 2, or a recombinant vector containing the expression cassette according to D1); D3) a recombinant microorganism containing the coding gene according to claim 2, or a recombinant microorganism containing the expression cassette according to D1), or a recombinant microorganism containing the recombinant vector according to D2); D4) a transgenic plant cell line containing the coding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1); D5) transgenic plant tissue containing the coding gene of claim 2, or transgenic plant tissue containing the expression cassette of D2); D6) A transgenic plant organ containing the coding gene according to claim 2, or a transgenic plant organ containing the expression cassette according to D2); D7) a nucleic acid molecule that inhibits the expression of the gene encoding the gene according to claim 2; D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in D7); D9) a nucleic acid molecule that inhibits the translation of the RNA molecule according to claim 3; D10) An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule described in D9).

5. Use of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora according to claim 1, the coding gene shown in claim 2, the RNA molecule according to claim 3, or the biomaterial according to claim 4, characterized in that: The application is any one or more of the following 1)-5): 1) Application in inhibiting the number of sporangia, the developmental capacity of sporangia and / or the zoospore production of Phytophthora; 2) Application in inhibiting the growth rate of Phytophthora mycelium; 3) Application in inhibiting the ability of Phytophthora to infect the host; 4) Application in inhibiting the pathogenicity of Phytophthora to the host; 5) Application in inhibiting and / or killing plant pathogenic oomycetes of the genus Phytophthora.

6. The use according to claim 5, wherein: The use described in 1) to 5) is achieved by inhibiting the transcription of the coding gene as described in claim 2 or making it inactive, or inhibiting the translation of the RNA molecule as described in claim 3, or inhibiting the activity of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora as described in claim 1 and / or making it inactive.

7. Use of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora as described in claim 1 and the encoding gene as described in claim 2 as targets for screening antibacterial or fungicidal agents for the plant pathogenic oomycetes of the genus Phytophthora.

8. A method for screening or auxiliary screening of antibacterial and / or fungicidal agents for plant pathogenic oomycetes of the genus Phytophthora, the method comprising applying a small molecule inhibitor to the plant pathogenic oomycete of the genus Phytophthora, when the small molecule inhibitor can inhibit the transcription of the coding gene as described in claim 2, or inhibit the translation of the RNA molecule as described in claim 3, or inhibit the activity of one or more of the arginine methyltransferase proteins of the plant pathogenic oomycete of the genus Phytophthora as described in claim 1 or make them inactive, then the object to be detected is an antibacterial and / or fungicide for the plant pathogenic oomycete of the genus Phytophthora.

9. A method for reducing the activity of a plant pathogenic oomycete of the genus Phytophthora, comprising the following steps: inhibiting the transcription of the coding gene as claimed in claim 2 or making it deleted, or inhibiting the translation in the RNA molecule as claimed in claim 3, or inhibiting the activity of one or more of the arginine methyltransferase proteins of the plant pathogenic oomycete of the genus Phytophthora as claimed in claim 1 or making them inactive; in, The reducing the activity of the plant pathogenic oomycetes of the genus Phytophthora is to reduce the infection ability and / or pathogenicity of the plant pathogenic oomycetes of the genus Phytophthora to the host, and / or reduce the hyphae growth rate of the plant pathogenic oomycetes of the genus Phytophthora, and / or reduce the yield of zoospores; Preferably, the activity of the proteins shown in sequences 6-8 in the sequence list is inactivated by knocking out the genes shown in sequences 1-3 in the sequence list in the plant pathogenic oomycetes of the genus Phytophthora.

10. Use of a substance that inhibits the expression and / or activity of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora according to claim 1 in the preparation of a fungicide for the plant pathogenic oomycete of the genus Phytophthora; preferably, the substance that inhibits the expression and / or activity of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora is a substance that inhibits the expression of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora and / or inhibits the transcription of the gene encoding the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora and / or inhibits the translation of the RNA molecule transcribed from the gene encoding the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora; The substance that inhibits the expression and / or activity of the arginine methyltransferase protein of the plant pathogenic oomycete of the genus Phytophthora is preferably an inhibitor lead compound; the inhibitor lead compound is preferably a compound as shown in Formula I to Formula III;

Images