Application of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth

Abstract

The invention discloses an application of an OsRALF6 gene and / or an OsRALF6 protein in promoting the growth of rice. The application is as follows. The function of the rice rapid alkalization factor OsRALF6 gene is disclosed for the first time, growth of roots and ears of rice can be remarkably promoted by inhibiting expression of the OsRALF6 gene and OsRALF6 protein in rice, and a homozygous mutant with the OsRALF6 gene stably knocked out is constructed. The invention provides a new molecular breeding resource for promoting rice growth and cultivating a new high-yield rice variety, and has an important application value in the aspect of agricultural planting and production.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to application of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth. Background Art

[0002] The root system of a plant is not only essential for absorbing water and nutrients to maintain plant survival, but also provides mechanical support for the plant to keep the plant upright. The root system type of cereal plants belongs to the fibrous root system, which is mainly composed of post-embryonic adventitious roots, also known as nodal roots or crown roots, which originate from the base of the stem nodes. The root apical meristem (RAM) differentiated during embryogenesis produces the radicle, and then five crown roots emerge from the nodes of the coleoptile. The post-embryonic crown roots originate from the base of the nodes of the main stem and tillers. The taproot and crown roots can branch to produce two types of secondary roots, namely large lateral roots and small lateral roots. The small lateral roots no longer produce more branches, while the large lateral roots can produce smaller lateral roots. The taproot plays an important role for a period of time after seed germination, until about the tenth day, when the taproot degenerates and the crown root begins to function. Although the taproot only functions within ten days after germination, the normal development of the taproot is essential for the growth of plants in the seedling stage.

[0003] The elongation of the taproot is affected by many factors, including rapid-alkalinization-factor (RALF). The structure of RALF mainly includes a signal peptide at the N-terminus and a conserved RALF domain at the C-terminus. The RALF family is very large, and the functions of each member are complex and diverse. There are at least 35 RAIF members in Arabidopsis, and each member has different effects on root growth. Some have different degrees of inhibitory effects on root growth, while others promote root development (Qiang Xiaonan, Li Xin, Chen Jia, Liao Hongdong, Yu Feng. Preliminary analysis of the functional diversity of the Arabidopsis RALF polypeptide family [J]. Biotechnology Bulletin, 2019, 35(1): 2-10.).

[0004] Rice is one of the important food crops in my country, and rice yield is directly related to my country's food security. The growth and development of roots and panicles determine rice yield. Root length and panicle length of rice are two important growth indicators, representing the growth of the underground part (root system) and the aboveground part (rice panicle) of rice plants, respectively. Promoting the growth and development of roots and panicles helps to increase rice yield. There are more than 40 RALF members (OsRALFs) in rice, but so far there are few reports on the effects of OsRALFs on the growth and development of roots and panicles of rice. Summary of the invention

[0005] In order to solve the above problems existing in the prior art, the present invention provides the use of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.

[0006] The first object of the present invention is to provide the use of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.

[0007] The second object of the present invention is to provide the use of OsRALF6 gene and / or OsRALF6 protein in promoting the growth of roots and / or panicles of rice.

[0008] The third object of the present invention is to provide the use of OsRALF6 gene and / or OsRALF6 protein in increasing rice yield.

[0009] The fourth object of the present invention is to provide use of an agent for inhibiting the expression of the OsRALF6 gene and / or the OsRALF6 protein in promoting rice growth.

[0010] A fifth object of the present invention is to provide use of an agent for inhibiting the expression of the OsRALF6 gene and / or the OsRALF6 protein in promoting the growth of roots and / or panicles of rice.

[0011] The sixth object of the present invention is to provide an application of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in improving rice yield.

[0012] A seventh object of the present invention is to provide a method for promoting rice growth.

[0013] In order to achieve the above object, the present invention is implemented by the following scheme:

[0014] The present invention uses a genome targeted editing system to perform targeted editing on the OsRALF6 gene in rice, causing the target gene to mutate, resulting in base deletion and addition in the mutated gene, resulting in the inability to generate the normally encoded OsRALF6 protein, and obtaining a mutant rice with OsRALF6 functional deficiency. Compared with wild-type rice, the mutant rice with OsRALF6 functional deficiency has a significantly different growth phenotype, such as increased root length and increased panicle length.

[0015] The present invention requests protection for the following contents:

[0016] Application of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.

[0017] Application of OsRALF6 gene and / or OsRALF6 protein in promoting root and / or panicle growth of rice.

[0018] Application of OsRALF6 gene and / or OsRALF6 protein in improving rice yield.

[0019] Application of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.

[0020] Use of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in promoting the root and / or panicle growth of rice.

[0021] Application of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in improving rice yield.

[0022] The reagent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein causes the deletion, addition or substitution of bases in OsRALF6 gene, which cannot normally encode OsRALF6 protein, resulting in reduced expression of OsRALF6 protein or loss of OsRALF6 protein.

[0023] Preferably, the reagent comprises a gRNA, a recombinant expression vector or a recombinant microorganism targeting the OsRALF6 gene and / or the OsRALF6 protein.

[0024] More preferably, the nucleotide sequence of the targeting site of the gRNA, recombinant expression vector or recombinant microorganism is as shown in SEQ ID NO: 3, a completely complementary sequence of the sequence shown in SEQ ID NO. 3, SEQ ID NO: 4 or a completely complementary sequence of the sequence shown in SEQ ID NO: 4.

[0025] Further preferably, the gRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 5 or a completely complementary sequence of the sequence shown in SEQ ID NO: 5.

[0026] More preferably, the recombinant expression vector comprises a CRISPR / CAS9 vector.

[0027] Further preferably, the CRISPR / CAS9 vector is the pYLCRISPR / Cas9-MH vector in the prior art "CN115011618A".

[0028] More preferably, the recombinant microorganism comprises Agrobacterium.

[0029] More preferably, the Agrobacterium is EHA105.

[0030] A method for promoting rice growth, comprising reducing the expression level of OsRALF6 gene and / or OsRALF6 protein in rice.

[0031] Preferably, the rice is treated with an agent that inhibits the expression of the OsRALF6 gene and / or the OsRALF6 protein.

[0032] The reagent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein causes the deletion, addition or substitution of bases in OsRALF6 gene, which cannot normally encode OsRALF6 protein, resulting in reduced expression of OsRALF6 protein or loss of OsRALF6 protein.

[0033] More preferably, the reagent comprises a gRNA, a recombinant expression vector or a recombinant microorganism targeting the OsRALF6 gene and / or the OsRALF6 protein.

[0034] Further preferably, the nucleotide sequence of the targeting site of the gRNA, recombinant expression vector or recombinant microorganism is as shown in SEQ ID NO: 3, the complete complementary sequence of the sequence shown in SEQ ID NO. 3, SEQ ID NO: 4 or the complete complementary sequence of the sequence shown in SEQ ID NO: 4.

[0035] More preferably, the gRNA comprises a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 5 or a completely complementary sequence of the sequence shown in SEQ ID NO: 5.

[0036] Further preferably, the recombinant expression vector comprises a CRISPR / CAS9 vector.

[0037] More preferably, the CRISPR / CAS9 vector is the pYLCRISPR / Cas9-MH vector in the prior art "CN115011618A".

[0038] Further preferably, the recombinant microorganism comprises Agrobacterium.

[0039] More preferably, the Agrobacterium is EHA105.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] The present invention reveals for the first time the function of the rice rapid alkalinization factor OsRALF6 gene, inhibiting the expression of the OsRALF6 gene and OsRALF6 protein in rice can significantly promote the growth of rice roots and panicles, and constructs a homozygous mutant with a stable knockout of the OsRALF6 gene. The present invention provides a new molecular breeding resource for promoting rice growth and cultivating new high-yield rice varieties, and has important application value in agricultural planting and production. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1Figure 2 shows the editing status of the OsRALF6 gene. a is a schematic diagram of the structure of the OsRALF6 gene. The OsRALF6 gene has only one exon, and two gene editing targets T1 and T2 were selected from its exons as targeted editing sites. b shows the gene editing status of the four stably inherited OsRALF6 gene mutant strains obtained. Bold fonts represent base insertions in the gene editing target, and * represents base deletions in the gene editing target.

[0043] Figure 2 The phenotype and statistical data of the increased taproot length of the osralf6 mutant; a is a photo of the rice taproot after 5 days of culture, scale bar = 1 cm; b is the quantitative statistical results of the taproot length of ZH11 and ralf6 mutants, statistical sample n = 20, error bars are ± SD, and asterisks represent significant differences (one-way analysis of variance, *** indicates extremely significant differences, P ≤ 0.0001).

[0044] Figure 3 This is the spectrum of PET-32a(+) carrier.

[0045] Figure 4 This is the result of SDS-PAGE gel Coomassie blue staining identification of the recombinant OsRALF6 fusion protein. All three lanes are eluate samples.

[0046] Figure 5 The phenotype and statistical graph of the inhibitory effect of exogenous OsRALF6 protein on rice taproot; a is a photo of rice taproot after 7 days of culture, scale = 1 cm; b is the statistical result of the length of rice taproot in a, statistical sample n = 8, error bars are ± SD (one-way analysis of variance, *** indicates extremely significant difference, P ≤ 0.0001).

[0047] Figure 6 The phenotypes and statistical graphs of the panicle length of ZH11 and ralf6 mutants at maturity; a is a photo of the rice panicle length at maturity, scale bar = 5 cm; b is a statistical graph of the panicle length in a, statistical sample n = 6, error bars are ± SD, (one-way ANOVA, ** indicates significant difference, P ≤ 0.01). DETAILED DESCRIPTION

[0048] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0049] Example 1 Construction and identification of rice OsRALF6 gene deletion mutant

[0050] 1. Construction of gene editing vector

[0051] According to Figure 1 The reference sequence of the OsRALF6 gene of rice (variety: ZH11, LOC_Os01g25560) shown in a (SEQ ID NO: 1) was used to determine the gene editing target 1 (i.e., T1, nucleotide sequence: 5'-CTGCTCATCGCGCTGGCCAC-3' (SEQ ID NO: 3)) and gene editing target 2 (i.e., T2, nucleotide sequence: 5'-AGCTGGGAGCTCGGGGTTGT-3' (SEQ ID NO: 4)) for knocking out the OsRALF6 protein (SEQ ID NO: 2).

[0052] Referring to the method in the prior art "CN115011618A", a gRNA expression cassette (connected with gRNA (nucleotide sequence: 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGAT GGACC-3' (SEQ ID NO: 5)) was constructed and connected to the pYLCRISPR / Cas9-MH vector, and transformed into Escherichia coli competent cells (DH5α) according to conventional methods. After cloning, culture and sequencing identification, the positive clones with correct identification results were subjected to plasmid extraction to obtain the gene editing fusion vector pYLCRISPR / Cas9-OsRALF6.

[0053] 2. Conversion screening

[0054] Induce wild-type rice (ZH11) to form callus tissue, the process is about 1 month, and the pYLCRISPR / Cas9-OsRALF6 vector is introduced into the callus tissue by Agrobacterium (EHA105), and placed in a 28°C incubator for 2 days in the dark, then the infected callus tissue is thoroughly washed with sterile water and placed on a clean bench to dry the moisture. According to conventional methods, positive transgenic regenerated seedlings are obtained after screening (2 weeks), pre-differentiation (2 weeks), differentiation (1 month), rooting (2 weeks) and other stages.

[0055] 3. Identification of transgenic plants

[0056] Sequencing primers RALF6-F and RALF6-R were designed in the UTR region of the RALF6 gene. The positive transgenic regenerated seedlings screened in the previous step were sequenced and identified using primers RALF6-F (5'-CCAATTCCTCCTCCTCCTCC-3') and RALF6-R (5'-CGGACACATGTACAGTGTACAT-3'). A total of four stable inherited rice OsRALF6 gene deletion mutants (i.e., ralf6 mutants) were obtained, namely ralf6-L1, ralf6-L5, ralf6-L10, and ralf6-L11. Their gene editing conditions are shown in Figure 2. Figure 1 As shown in b, these four ralf6 mutants all caused amino acid frameshift or premature termination of OsRALF6 protein due to gene editing, and all showed the absence of normal OsRALF6 protein, indicating that the ralf6 mutants were successfully constructed.

[0057] Example 2 Effect of OsRALF6 protein deficiency on rice root length

[0058] 1. Rice sowing and cultivation

[0059] The seeds of wild-type rice (ZH11) and the four ralf6 mutants (ralf6-L1, ralf6-L5, ralf6-L10 and ralf6-L11) constructed in Example 1 were shelled, surface-sterilized with 25% sodium hypochlorite, and then sown in culture bottles containing 1 / 2MS culture medium in an ultra-clean workbench, and seedlings were cultured according to conventional methods.

[0060] After the rice seedlings grew for 5 days, the seedlings were taken out, photographed and the taproot length was measured. The taproot length was measured using Image J software, and the data were analyzed and plotted using Graphpad software.

[0061] 2. Root length statistics

[0062] like Figure 2 As shown in a and b, the taproot length of ZH11 seedlings is about 4 cm, while the taproot length of the four ralf6 mutant seedlings is 5 to 5.3 cm, indicating that the taproot length of the ralf6 mutant is significantly greater than that of ZH11, indicating that the loss of OsRALF6 protein increases the root length of rice and promotes root growth of rice.

[0063] Example 3 Effect of adding OsRALF6 protein on rice root length

[0064] 1. Construction of OsRALF6 protein recombinant expression vector

[0065] The RALF6 genomic coding region (SEQ ID NO: 1) was ligated to Figure 3The PET-32a(+) expression vector shown (containing a 6×His tag at the N-terminus and the C-terminus, and a TrxA solubilizing protein tag at the N-terminus) was cloned between the EcoRⅠ site and the HindⅢ site, and then transformed into Escherichia coli competent cells (DH5α). After cloning, culture and sequencing, the positive clones identified as correct were subjected to plasmid extraction to obtain the OsRALF6 protein recombinant expression vector, which was recorded as PET-32a-OsRALF6 vector.

[0066] 2. Prokaryotic expression and purification of recombinant OsRALF6 protein

[0067] The PET-32a-OsRALF6 vector was transformed into competent Escherichia coli (BL21), and after picking a single clone, BL21 was cultured in LB medium until OD = 0.6-0.8, and the inducer IPTG was added at a final concentration of 1 mM. The mixture was induced at 37°C and 160 rpm for 4 h, and the culture supernatant containing the recombinant OsRALF6 fusion protein was collected and purified and recovered using Ni-NTA Agarose. The eluate was collected and identified by SDS-PAGE gel and Coomassie blue staining. The results are shown in FIG. Figure 4 As shown, the size of the protein band was consistent with expectations, indicating that the recombinant OsRALF6 fusion protein was successfully obtained.

[0068] 3. Rice sowing and cultivation

[0069] The seeds of wild-type rice (ZH11) were shelled, surface disinfected with 25% sodium hypochlorite, and then sown in culture bottles containing 1 / 2MS culture medium in an ultra-clean workbench. Recombinant OsRALF6 fusion protein (i.e., +RALF6) was added at a final concentration of 0.5 μM and cultured. The control without recombinant OsRALF6 fusion protein (i.e., MOCK) was used.

[0070] After the rice seedlings grew for 7 days, the seedlings were taken out, photographed and the taproot length was measured. The taproot length was measured using Image J software, and the data were analyzed and plotted using Graghpad software.

[0071] 4. Root length statistics

[0072] like Figure 5 As shown in a and b, compared with the control, the main root of ZH11 was significantly shorter when OsRALF6 protein was applied, indicating that OsRALF6 protein can significantly inhibit the growth of rice roots.

[0073] Example 4 Effect of OsRALF6 protein deficiency on rice panicle length

[0074] 1. Field cultivation

[0075] Wild-type rice (ZH11) and the two ralf6 mutants (ralf6-L1 and ralf6-L11) constructed in Example 1 were transplanted into rice fields for field cultivation after conventional sowing and seedling raising.

[0076] When the rice grows to yellow and ripe, the main panicle of rice is collected for photographing and length measurement, and 6 data are counted for each sample. The length of the main panicle is measured using Image J software, and the data is analyzed and plotted using Graghpad software.

[0077] 2. Statistical results of ear length

[0078] like Figure 6 As shown in a and b, the average panicle length of ZH11 is about 18.9 cm, while the panicle lengths of ralf6-L1 and ralf6-L11 are 22.1 cm and 21.9 cm, respectively. It can be seen that the panicle length of the ralf6 mutant is significantly greater than that of ZH11, indicating that the loss of OsRALF6 protein increases the panicle length of rice and promotes the growth of rice panicles.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.

2. Application of OsRALF6 gene and / or OsRALF6 protein in promoting root and / or panicle growth of rice.

3. Application of OsRALF6 gene and / or OsRALF6 protein in improving rice yield.

4. Use of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.

5. Use of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in promoting the root and / or panicle growth of rice.

6. Use of an agent for inhibiting the expression of OsRALF6 gene and / or OsRALF6 protein in improving rice yield.

7. The use according to any one of claims 4 to 6, characterized in that: The reagent includes a gRNA, a recombinant expression vector or a recombinant microorganism targeting the OsRALF6 gene and / or the OsRALF6 protein.

8. The use according to claim 7, characterized in that: The nucleotide sequence of the targeting site of the gRNA, recombinant expression vector or recombinant microorganism is shown in SEQ ID NO: 3, a completely complementary sequence of the sequence shown in SEQ ID NO. 3, SEQ ID NO: 4 or a completely complementary sequence of the sequence shown in SEQ ID NO:

4.

9. The use according to claim 8, characterized in that: The gRNA includes a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 5 or a completely complementary sequence of the sequence shown in SEQ ID NO:

5.

10. A method for promoting rice growth, characterized in that: Reducing the expression level of OsRALF6 gene and / or OsRALF6 protein in rice.

Images