Application of long-chain non-coding gene Oip5os1 related to myocardial progenitor cell differentiation

Abstract

The invention relates to an application of a long-chain non-coding gene Oip5os1 (Rik) related to myocardial progenitor cell differentiation, the gene is transferred to a cell nucleus from cytoplasm during myocardial progenitor cell differentiation and is in targeted combination with A2BP1 (RBFOX1), the expression of A2BP1 in the cell nucleus in the myocardial progenitor cell period can be promoted by overexpression of the gene, and the myocardial progenitor cell differentiation related long-chain non-coding gene Oip5os1 (Rik) can be promoted. The splicing level of a specific transcription factor Mef2c alpha 2 in a downstream myocardial progenitor cell period is further promoted, so that a Mef2c alpha 1 / alpha 2 subtype mutual exclusion splicing mode is changed, and finally, the differentiation of myocardial progenitor cells is inhibited.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of a long non-coding gene Oip5os1 related to myocardial progenitor cell differentiation. Background Art

[0002] Mammalian heart development is a complex, multi-stage process that is strictly regulated. It is precisely controlled by multiple transcription factors, chromatin regulatory molecules, and signaling molecules at different times and spaces. If the gene regulatory network in this process is affected or interrupted, it will lead to the occurrence of heart disease.

[0003] Long non-coding RNA (lncRNA) is a non-coding RNA with a length greater than 200 nucleotides. lncRNA plays a crucial regulatory role in cardiac function and development. Both Fendrr and Mhrt are binding protein factors that determine (cardiac) chromatin characteristics. Important transcription factors that regulate cardiac development are recruited in stages, thereby promoting early development of the heart. Knocking down lncRNA Carmen in cardiac progenitor cells inhibits cardiac-specific gene expression and differentiation into cardiomyocytes. In addition, downregulating lncRNA RCPCD promotes embryonic stem cell differentiation into pacemaker-like cells by inhibiting HCN4 promoter methylation. This shows that lncRNA is crucial in regulating early cardiac development and the fate of the cardiac lineage.

[0004] Directed differentiation of cardiomyocytes is a key step in the early stages of cardiac development, but the regulatory mechanism of lncRNA is still not fully understood.

[0005] Exploring new lncRNAs that play an important role in the differentiation of cardiomyocyte progenitor cells will not only reveal important mechanisms regulating the function of cardiomyocyte progenitor cells, but may also provide new detection or treatment targets. This is an important scientific issue that needs to be explored in the research of heart-related diseases. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a long non-coding gene Oip5os1 related to myocardial progenitor cell differentiation.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] One of the technical solutions of the present invention is to provide a guide RNA molecule for inhibiting the expression of the long non-coding gene Oip5os1, wherein the sequence of the guide RNA molecule is selected from any one of SEQ ID NO.1-4.

[0009] The second technical solution of the present invention is to provide a small hairpin structure RNA molecule for inhibiting the expression of the long non-coding gene Oip5os1, wherein the sequence of the small hairpin structure RNA molecule is selected from any one of SEQ ID NO.11-13.

[0010] The third technical solution of the present invention is to provide a cell model for knocking out the long non-coding gene Oip5os1, wherein the cell model comprises the RNA molecule as described in one of the above technical solutions or the second technical solution.

[0011] A fourth technical solution of the present invention is to provide an application of the cell model as described in the third technical solution above in the field of research on differentiation of stem cells into cardiomyocytes.

[0012] The fifth technical solution of the present invention is to provide a vector for promoting the expression of the long non-coding gene Oip5os1, wherein the vector is a lentiviral vector containing the long non-coding gene Oip5os1 or a vector containing both the long non-coding gene Oip5os1 and a strong promoter.

[0013] The sixth technical solution of the present invention is to provide a cell model for overexpression of the long non-coding gene Oip5os1, wherein the cell model comprises the vector as described in the fifth technical solution above.

[0014] The seventh technical solution of the present invention is to provide an application of the cell model as described in the sixth technical solution above in the field of research on differentiation of stem cells into cardiomyocytes.

[0015] The eighth technical solution of the present invention is to provide the use of the ribonucleic acid molecule as described in one or two of the above technical solutions or the vector as described in the fifth technical solution in the preparation of a drug or preparation for inhibiting the differentiation of stem cells into cardiomyocyte progenitor cells.

[0016] In some specific embodiments, the drug or preparation is a drug or preparation that inhibits the differentiation of stem cells into mesoderm.

[0017] In some specific embodiments, the drug or preparation is a drug or preparation that promotes the expression of A2BP1 and / or Mef2cα2.

[0018] Dynamically changing alternative splicing is also very important for cardiomyocyte differentiation. RNA splicing regulated by the RBFOX family splicing factor A2BP1 is essential for zebrafish cardiac function. When RBFOX1 is missing, the heart will undergo incorrect splicing, thus affecting the normal cardiac physiological state. In the human heart, A2BP1 expression levels are downregulated in dilated cardiomyopathy, and CACNA1C (calcium ion voltage-gated channel subunit α1C) mRNA levels are significantly reduced in both dilated and ischemic cardiomyopathy, suggesting that A2BP1 may participate in the development of cardiomyopathy by regulating alternative splicing of CaV1.2 exon 33. In addition, the localization of the A2BP1 protein also affects its splicing. When the mutation controls the localization of A2BP1 in the C-terminal region, A2BP1 lacks splicing activity, but restoring its nuclear localization is not enough to rescue splicing activity.

[0019] Mef2c is a cardiac-specific transcription factor that is essential for cardiac development. Previous studies have shown that A2BP1 can regulate the alternative splicing of MEF2c as an upstream splicer, playing an important regulatory role in differentiation, pathology and other states. Mef2c consists of 13 exons, including three different alternative splicing. Mutually exclusive alternative splicing occurs in exons α1 and α2, located in the region adjacent to the MEF2 domain. The alternative splicing transcript of exon α is expressed in a muscle-specific manner, while exon β is expressed in a nerve-specific manner. Therefore, Mef2c is essential for the development of the heart, muscles and nerves. The ratio of Mef2cα1 / α2 also affects myocardial hypertrophy and myocardial infarction.

[0020] The germ layer differentiation ability of stem cells is the first step of the multidirectional differentiation mechanism. The in-depth understanding of the cell state and fate determination mechanism is not only conducive to understanding the general laws of cell differentiation and development, but also has far-reaching significance for analyzing the mechanisms of developmental malformations and cancer. Therefore, finding regulatory factors that play a decisive role in the fate of early embryonic lineages and clarifying their regulatory mechanisms is an important way to fully understand the differentiation and fate of cell lineages. Therefore, the research based on the differentiation of stem cells into cardiomyocytes of the present invention deepens the understanding of the early germ layer formation of organogenesis, and attempts to determine the regulatory mechanism of early germ layer differentiation and subsequent cardiomyocyte fate.

[0021] Compared with the prior art, the present invention provides a long non-coding gene Oip5os1 (Rik) related to the differentiation of myocardial progenitor cells. This gene is transferred from the cytoplasm to the nucleus during the differentiation of myocardial progenitor cells, and targetedly binds to A2BP1 (RBFOX1), promoting the expression of A2BP1 in the nucleus during the myocardial progenitor cell period, and further promoting the splicing level of the specific transcription factor Mef2cα2 downstream of A2BP1 during the myocardial progenitor cell period, resulting in changes in the mutually exclusive splicing pattern of Mef2cα1 / α2 subtypes, and ultimately inhibiting the differentiation of myocardial progenitor cells. Therefore, it is crucial to have a deep understanding of the transcriptional regulatory network during myocardial differentiation and heart development. Embryonic stem cells, as a type of cell that can be cultured in vitro and has complete developmental omnipotence, are an important tool for analyzing cell fate determination and individual development mechanisms. Combined with mature in vitro directed differentiation technology of myocardial cells, it is possible for us to study the development process of the heart in vitro, which will be conducive to a better understanding of the regulatory mechanisms in heart development. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 A is the location of the designed sgRNA at both ends of Oip5os1, which is specifically located at both ends of the Oip5os1 genome. Figure 1 B is the sgRNA vector. Figure 1 C The positive bands were confirmed by RT-PCR, where 1 (ddH2O) and 2 (blank vector) were negative controls, and 3-10 were positive clone bands. Figure 1 D shows the PCR and sequencing results confirming the knockout effect.

[0023] Figure 2 A shows a diagram of the Oip5os1 overexpression plasmid construction. Figure 2 B and 2C confirmed the positive bands by RT-PCR and sequencing, among which 1 (ddH2O) and 2 (blank vector) were negative controls, and 3-10 were positive clone bands. Figure 2 D. qPCR was used to confirm the overexpression effect.

[0024] Figure 3 The effects of Oip5os1 knockout on the differentiation of cardiomyocytes are shown. Figure 3 A found that the size of mesoderm embryoid bodies was significantly downregulated after Oip5os1 knockout, and the coupling between embryoid bodies in the cardiomyocyte progenitor period was significantly reduced. Figure 3 B, 3C, and 3D used qPCR, WB, and IF to confirm that Oip5os1 knockout inhibited mesoderm differentiation, leading to the inhibition of cardiomyocyte progenitor cell differentiation.

[0025] Figure 4 The effect of Oip5os1 overexpression on the differentiation of cardiomyocyte progenitor cells is shown. Figure 4 A shows that overexpression of Oip5os1 significantly inhibited the coupling between embryoid bodies. Figure 4 B, 4C, and 4D confirmed through qPCR, WB, and IF that overexpression of Oip5os1 significantly inhibited the differentiation of cardiomyocyte progenitor cells.

[0026] Figure 5 Shown is the effect of DOX-induced knockdown of Oip5os1 on the differentiation of cardiomyocytes. Figure 5 A-5C used qPCR, WB, and IF to confirm that after DOX-induced knockdown of Oip5os1, the mRNA and protein levels of the mesoderm's iconic genes Mesp1 and T were downregulated, while the mRNA and protein levels of the cardiomyocyte progenitor cell's iconic genes NKX2.5, TBX5, and ISL1 were significantly upregulated, proving that specific knockdown of Oip5os1 in the cardiomyocyte progenitor cell period promoted the differentiation of cardiomyocyte progenitor cells.

[0027] Figure 6 AC used qPCR, WB, and IF to confirm the effect of DOX-induced Oip5os1 overexpression, indicating that specific overexpression of Oip5os1 in the cardiomyocyte progenitor cell period inhibited the differentiation of cardiomyocyte progenitor cells.

[0028] Figure 7 FISH was used to show the localization of Oip5os1 during cardiomyocyte differentiation. Oip5os1 was localized in the cytoplasm in embryonic stem cells and mesoderm, and in the nucleus in cardiomyocyte progenitor cells.

[0029] Figure 8 AD shows that Oip5os1 promotes the nuclear expression of splicing protein A2BP1 in cardiac progenitor cells. Figure 8 E RIP experiments confirmed that Oip5os1 and A2BP1 (RBFOX1) have a direct targeting binding effect.

[0030] Fig. 9 A shows the construction map of the Minigene vector and sequencing confirmed that the construction was successful. Fig. 9 B, 9C confirmed that A2BP1 promoted the splicing of Mef2cα2 in human 293 cells and mouse MEF cells. Fig. 9 D confirms the effect of A2BP1 overexpression.

[0031] Fig.10 A used bioinformatics methods to analyze two sets of human and one set of mouse cardiomyocyte differentiation data in the public database. The data showed that Mef2cα1 was mainly expressed in normal differentiation. Fig.10 B shows the effects of Oip5os1 overexpression and knockout on Mef2cα1 / α2. Oip5os1 overexpression changed the expression pattern of Mef2cα1 and Mef2cα2. DETAILED DESCRIPTION

[0032] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.

[0033] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.

[0034] In the first stage of the present invention, an Oip5os1 knockout / overexpression mouse embryonic stem cell line was constructed and induced to differentiate into cardiomyocyte progenitor cells using the hanging drop method to explore the effect of Oip5os1 expression on the differentiation of cardiomyocyte progenitor cells.

[0035] In the second stage of the present invention, the localization of Oip5os1 during differentiation of cardiomyocyte progenitor cells and its effect on the expression of splicing protein A2BP1 in the nucleus and cytoplasm are explored by separating nuclear and cytoplasmic proteins.

[0036] In the third stage of the present invention, a minigene experiment was designed to study in vitro the effect of the splicing protein A2BP1 on the mutually exclusive splicing pattern of the α subunit of the third exon of the cardiac progenitor cell-specific transcription factor Mef2c.

[0037] Specifically, the present invention constructs an Oip5os1 knockout mouse embryonic stem cell line by Crisper / Cas9 technology, and constructs an Oip5os1 overexpression mouse embryonic stem cell line by lentivirus. Subsequently, qRT-PCR, Western Blot, and immunofluorescence experiments are used to detect the effect of changes in the expression level of Oip5os1 on the markers of the differentiation stage of myocardial progenitor cells, and the changes in the localization of Oip5os1 in the cytoplasm and nucleus as the cell differentiation proceeds are detected by Fish experiments. The binding level of Oip5os1 and the downstream alternative splicing protein A2BP1 is detected by RIP experiments, and the changes of splicing proteins on the downstream myocardial progenitor cell-specific transcription factor Mef2cα subunit are detected by minigene experiments.

[0038] More specifically, the present invention is described in detail with reference to the following embodiments.

[0039] The primer information related to the qPCR experiment involved in each example is shown in SEQ ID NO.28-53.

[0040] Example 1: Knockout of the Oip5os1 gene inhibits mesoderm differentiation

[0041] 1. Construction of Oip5os1 gene CRISPR / Cas9 knockout cell line, including the following steps:

[0042] (1) sgRNA sequence design

[0043] According to the source design program (https: / / zlab.bio / guide-design-resources), the Oip5os1 gene (see Figure 1 A) Design four sgRNA sequences at both ends:

[0044] sgRNA1 (SEQ ID NO.1):ACTTCCCAGCCAATCCGCGA;

[0045] sgRNA2 (SEQ ID NO.2):AAAGTGAGACTGCCTCCGTG;

[0046] sgRNA3 (SEQ ID NO.3): GAGCACGTATCACCTCTCAC;

[0047] sgRNA4 (SEQ ID NO. 4): CTGGCAACCGTTGCAAACAA.

[0048] 2. Construction of Oip5os1 knockout lentivirus:

[0049] (2-1) According to the sequence characteristics of the introns and exons of the lncRNA Rik gene and the principles of CRISPR / Cas9 target design, the corresponding sgRNA was designed. The sequences rich in NGG and located in the same exon of the lncRNA Rik gene were searched and submitted to the CRISPR online design program (https: / / zlab.bio / guide-design-resources). Based on the results obtained, four sgRNA sequences with high scores and sgRNAs located at both ends of the Rik gene were screened out (Table 1). Figure 1 A is the location of the sgRNAs at both ends of Oip5os1, specifically located at both ends of the Oip5os1 genome. Primers were designed based on the obtained sgRNA sequence, and Bbs restriction sites were added to both ends of the sense strand and the antisense strand to form sticky complementary ends after Bbs restriction. The primers of sgRNA1-sgRNA4 are shown in SEQ ID NO.5-8 respectively.

[0050] (2-2) Take 2 μL of each sgRNA primer, fill it up to 20 μL with ddH2O, perform gradient annealing at 95°C for 5 min, and clone the annealing product into the pX459 vector. Then transform the ligation product into DH5α competent cells, spread it on meat extract peptone medium (LB medium) containing ampicillin resistance, and pick a single clone for sequencing identification. The sequence with correct sequencing was transfected into the human lens epithelial cell line (SRA01 / 04), and the genomic DNA was extracted after conventional culture for 72 hours, and the cutting efficiency of sgRNA was identified using T7E1 enzyme digestion.

[0051] (2-3) The sgRNA vector was combined with a lentiviral plasmid carrying the hSpCas9 element (CV279, see Figure 1 B) Co-transfected into 293T cells, the supernatant was collected after 48 hours, and the virus was precipitated with 5xPEG8000 at 4°C overnight. The next day, the virus was centrifuged at 400 rpm and 4°C for 30 minutes. The supernatant was then removed and the precipitate was gently pipetted on ice with 200 μL DMEM culture medium, and then stored at -80°C to construct a lentivirus containing gRNA.

[0052] 3. Construction of Oip5os1 knockout mouse embryonic stem cell line:

[0053] (3-1) Mouse embryonic stem cell (mESC) recovery: Take out the cells from the liquid nitrogen tank and transfer them to a cryopreservation tube that is gently shaken in a 37°C water bath. When there is still a small amount of crystals in the tube, take it out, disinfect it with 75% ethanol, and transfer it to an ultra-clean bench; transfer all the cell suspension in the cryopreservation tube to a 15 mL centrifuge tube containing 4 mL of complete culture medium; centrifuge at 1000 rpm for 5 min, disinfect the centrifuge tube with 75% ethanol, and transfer it to an ultra-clean bench; discard the supernatant, and resuspend the cell pellet with complete culture medium; aspirate and discard the complete culture medium in the six-well plate, and transfer the mESC to the feeder layer cells (monolayer cells obtained by treating mouse fibroblasts with 50 Gy of X-ray radiation), place it in a cell culture incubator, and culture it as usual.

[0054] (3-2) Virus transfection: When the density of mESCs grows to 60%-70%, the lentivirus constructed in step (2-3) is transfected into mESCs at a concentration of 50 μL / well. After 8 hours, the medium is changed and culture is continued.

[0055] (3-3) mESC passaging: When mESC grows to an appropriate density, aspirate the mESC medium, add 1 mL PBS / well, let stand for 2 minutes, aspirate the PBS; add 0.5 mL trypsin / well, and digest at 37°C for 1 minute. Add 1.5 mL complete medium / well to terminate digestion, then gently pipette the cell pellet up and down, and observe under a microscope to ensure that all cells become single cells. Transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 minutes, disinfect the centrifuge tube with 75% ethanol, and transfer it to a clean bench. Discard the supernatant, add the corresponding volume of mESC medium to the cell pellet, and transfer the mESC to the culture dish containing the feeder layer cells at a ratio of 1 well: 3 wells to 1 well: 6 wells.

[0056] (3-4) Puro-resistant monoclonal screening: First, use puro (puromycin) to preliminarily screen the virus-transfected mESCs, then inoculate 100 cells / well into a 96-well plate and observe whether there is obvious clone growth after 96 hours. After the cell clones grow into a circle, they are continuously subcultured and expanded until they are in a 6-well plate, and then each expanded cell line is verified.

[0057] 4. Validation of Oip5os1 knockout:

[0058] (4-1) Extraction of genomic DNA: Digest the cells with 0.25% trypsin, wash them with PBS, place them in a 1.5 mL centrifuge tube, add 200 μL buffer GA, and then add 20 μL Proteinase K to each tube. Let stand at room temperature for 30 min. Add 200 μL buffer GB to each tube, mix thoroughly by inverting, and place in a 70°C metal bath for 10 min. At this time, the solution becomes clear. Add 200 μL anhydrous ethanol to each tube and shake thoroughly for 15 s. Add all the solution and flocculent precipitate from the previous step to a CB3 adsorption column, place the adsorption column in a collection tube, centrifuge at 12,000 rpm for 1 min, and discard the liquid in the collection tube. Add 500 μL buffer GD to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the liquid in the collection tube. Add 600 μL rinse solution PW to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the liquid in the collection tube. Repeat once. Discard the waste liquid in the collection tube, centrifuge at 12000rpm for 2min, discard the waste liquid, place the adsorption column in a clean 1.5mL centrifuge tube, leave it at room temperature for 5-10min, and dry the rinse liquid. Add 50μL ddH2O to the adsorption column, leave it at room temperature for 2min, centrifuge at 12000rpm for 2min, and collect the solution in a centrifuge tube. Use NanoDrop spectrophotometer to detect the concentration and purity of DNA.

[0059] (4-2) PCR amplification of Oip5os1: The genomic DNA obtained in the above experiment was used as a template, and the primers Oip5os1KO F (SEQ ID NO.9): 5'-ATCTGTCTGTCCCTACTCAGTCCTG-3' and Oip5os1KO R (SEQ ID NO.10): 5'-TCCCAAAGACACACTAATCACACAC-3' were used as upstream and downstream primers for PCR amplification reaction. The reaction system was: 5×Q5 Reaction Buffer, 10 μL; 10 mM dNTPs, 1 uL; 10 μM primer F, 2.5 μL; 10 μM primer R, 2.5 μL; DNA template, 1 μL; Q5 polymerase, 0.5 μL; ddH2O, made up to 50 μL.

[0060] The reaction conditions of PCR amplification were as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 20 s; annealing at 60°C for 20 s; extension at 72°C for 35 s; final extension at 72°C for 2 min; and storage at 4°C, +∞.

[0061] Prepare 1% agarose gel and wait for the agarose gel to solidify. After the PCR reaction is completed, use a 10μL pipette to take 10μL from 50μL PCR product, add 2μL 6× loading buffer, flick the tube wall to mix evenly, and then load the sample. Use 1μL DL 1000DNA marker as a control. In 0.5×TBE buffer, perform electrophoresis at 125V for 30min. After the electrophoresis is completed, observe and take pictures on the UV irradiation table, such as Figure 1 As shown in C, lane 1 ddH2O and lane 2 blank vector are negative controls, and lanes 3-10 are positive clone bands. After the target band is seen, the remaining 40 μL PCR product is sent to Shanghai Biotech for sequencing, and the sequencing results are compared using SnapGene software to identify the genotype of the knockout cell line. Figure 1 As shown in D.

[0062] Figure 3 The effect of Oip5os1 knockout on the differentiation of cardiomyocytes was shown. First, the hanging drop method was used to induce mESCs to differentiate into cardiomyocytes. The specific steps were as follows: mESCs were diluted to 5×10 4cells / mL, transferred to a 10cm culture dish; use an 8-pass gun to dispense 50-60 points of the diluted mESC in the 10cm cell culture dish, 20μL / point, turn the culture dish upside down, and perform hanging drop culture at 37℃, 5% CO2, and record it as day 0; on the first day of hanging drop, gelatin is added to the six-well plate, placed in an incubator, and left overnight; on the second day of hanging drop culture, the cells of hanging drop culture are transferred to a six-well plate, 20 EB / well. After culture in differentiation medium, mesoderm (MES), cardiac progenitor cells (CP), and cardiomyocytes (CM) are gradually formed. Figure 3 A found that the size of mesoderm embryoid bodies was significantly downregulated after Oip5os1 knockout, and the coupling between embryoid bodies in the cardiomyocyte progenitor period was significantly reduced. Figure 3 B, 3C, 3D qPCR, WB, and IF confirmed that the mRNA and protein levels of the mesoderm marker genes Mesp1 and T were downregulated after Oip5os1 knockout, proving that Oip5os1 knockout inhibited mesoderm differentiation, which subsequently led to the inhibition of myocardial progenitor cell differentiation (to exclude the influence of mesoderm, the DOX-induced knockdown system was used to further confirm the effect of Oip5os1 on myocardial progenitor cell differentiation, see Figure 5 ).

[0063] Example 2: Specific knockdown of Oip5os1 in the myocardial progenitor cell stage promotes differentiation of myocardial progenitor cells

[0064] 1. Construction of Oip5os1 gene DOX-induced knockdown cell line, including the following steps:

[0065] (1) shRNA sequence design

[0066] Three RNAi sequences were designed at both ends of the Oip5os1 gene using an open source design program (http: / / rnaidesigner.lifetechnologies.com):

[0067] shRNA1(SEQ ID NO.11):ACCGCAGTAAGTTCCAAATAT;

[0068] shRNA2 (SEQ ID NO. 12): CCGCAGTAAGTTCCAAATATT;

[0069] shRNA3 (SEQ ID NO. 13): CGCAGTAAGTTCCAAATATTT.

[0070] 2. Construction of lentiviral vector for DOX-induced knockdown of Oip5os1 gene:

[0071] (2-1) Based on the sequences predicted by the above website, loop sequences were newly designed at both ends. See SEQ ID NO. 14 / 15 for shRNA1-F / R, SEQ ID NO. 16 / 17 for shRNA2-F / R, and SEQ ID NO. 18 / 19 for shRNA3-F / R.

[0072] (2-2) Take 2 μL of each shRNA upstream and downstream primers, fill with ddH2O to 20 μL, perform gradient annealing at 95℃ for 5 min, and clone the annealing product into the let-PLKO-neo vector. Then transform the ligation product into Stbl3 competent cells, spread it on meat extract peptone medium (LB medium) containing ampicillin resistance, pick a single clone for sequencing identification, and the one with correct sequencing is named PLKO-Oip5os1.

[0073] (2-3) The PLKO-Oip5os1 plasmid and the lentiviral assembly element plasmids MX192 and MX196 were co-transfected into 293T cells. After 48 hours, the supernatant was collected and the virus was precipitated with 5xPEG8000 at 4°C overnight. The next day, the cells were centrifuged at 400 rpm and 4°C for 30 min. The supernatant was discarded and the precipitate was gently pipetted on ice with 200 μL DMEM culture medium and then stored at -80°C. Thus, a lentivirus containing the PLKO-Oip5os1 plasmid was constructed.

[0074] 3. Construction of Oip5os1 gene DOX-induced knockdown mouse embryonic stem cell line:

[0075] The cell line construction method can be referred to Example 1.

[0076] 4. Verification of DOX-induced knockdown of Oip5os1 gene:

[0077] (4-1) Extraction of total RNA: The mESC cell line obtained in the previous step was cultured on feeder cells for three days, then digested with 0.25% trypsin and plated on a 100 mm dish containing gelatin for 45-60 min to separate the mESC from the feeder cells. The cells were then digested with 1 mL of TRIZOL reagent and total RNA was extracted using chloroform / isopropanol. The cells were then washed with 75% ethanol and dissolved in RNAase-free DEPC water. The RNA concentration was measured using a spectrophotometer.

[0078] (4-2) Reverse transcription of RNA to DNA: The total RNA obtained in the above experiment was used as a template and gDNA eraser was used to react with reverse transcriptase. The reaction system was: reverse transcriptase MIX, 5 μL; gDNA eraser, 1 μL; total RNA, 1 μg; RNAase-free H2O, made up to 10 μL.

[0079] The reaction conditions of reverse transcription amplification were as follows: synthesize cDNA at 37°C, 5 min; inactivate reverse transcriptase at 85°C, 5 s; and store at 4°C, +∞.

[0080] qPCR was used to verify the expression level of Oip5os1 between the three groups of shRNA and the control group, and the group of shRNA with the most significant knockdown was screened for subsequent research.

[0081] Figure 5 The effect of Oip5os1 knockdown induced by DOX on the differentiation of cardiomyocyte progenitor cells is shown. First, mESCs were induced to differentiate into cardiomyocytes using the hanging drop method, and the specific steps were the same as those in Example 1. Figure 5 A-5C used qPCR, WB, and IF to confirm that after DOX-induced knockdown of Oip5os1, the mRNA and protein levels of the mesoderm's iconic genes Mesp1 and T were downregulated, proving that mesoderm-specific knockdown of Oip5os1 inhibited mesoderm differentiation, while the mRNA and protein levels of cardiomyocyte progenitor cell-significant genes NKX2.5, TBX5, and ISL1 were significantly upregulated, proving that cardiomyocyte progenitor cell-specific knockdown of Oip5os1 promoted cardiomyocyte progenitor cell differentiation.

[0082] Example 3: Overexpression of Oip5os1 inhibits differentiation of cardiomyocyte progenitor cells

[0083] Construction of Oip5os1 overexpression vector: Design Oip5os1 gene amplification primers Oip5os1-P1 (SEQ ID NO.20) and Oip5os1-P2 (SEQ ID NO.21), and insert the amplified fragment into GV367 vector (such as Figure 2 A) The MCS site in.

[0084] The construction of the mouse embryonic stem cell line overexpressing Oip5os1 can be referred to in Example 1.

[0085] Figure 2 A schematic diagram of the Oip5os1 overexpression vector structure is shown. Figure 2 A shows a diagram of the Oip5os1 overexpression plasmid construction. Figure 2 B and 2C confirmed the positive bands by RT-PCR and sequencing, among which 1 (ddH2O) and 2 (blank vector) were negative controls, and 3-10 were positive clone bands. Figure 2 D. qPCR was used to confirm the overexpression effect.

[0086] Figure 4 The effect of Oip5os1 overexpression on the differentiation of cardiomyocyte progenitor cells is shown. Figure 4 A shows that overexpression of Oip5os1 significantly inhibited the coupling between embryoid bodies. Figure 4 B, 4C, 4D confirmed by qPCR, WB, IF that overexpression of Oip5os1 significantly inhibited the differentiation of cardiomyocytes (to exclude the influence of mesoderm, we subsequently used the DOX-induced overexpression system to further confirm the effect of Oip5os1 on the differentiation of cardiomyocytes, see Figure 6 ).

[0087] Example 4: Overexpression of Oip5os1 specifically in cardiac progenitor cells inhibits differentiation of cardiac progenitor cells

[0088] The Oip5os1 gene fragment was connected to the PLVX-puro vector, and the constructed vector was named Oip5os1-PLVX.

[0089] For the construction of Oip5os1 DOX-inducible overexpression mouse embryonic stem cell line, please refer to Example 2.

[0090] Figure 6 AC used qPCR, WB, and IF to confirm the effect of DOX-induced Oip5os1 overexpression, indicating that specific overexpression of Oip5os1 in the cardiomyocyte progenitor cell period inhibited the differentiation of cardiomyocyte progenitor cells.

[0091] Example 5: Localization changes of Oip5os1 during cardiomyocyte differentiation

[0092] Fish experiment was used to reveal the localization of Oip5os1 during differentiation. The specific steps are as follows:

[0093] (1-1) The Oip5os1 FISH probe (constructed by RiboBio) was incubated in a 75°C constant temperature water bath for 5 min and immediately placed at 0°C for 5-10 min to denature the double-stranded DNA probe.

[0094] (1-2) The prepared specimens of mouse embryonic stem cells at four stages of differentiation were denatured by soaking in 4% paraformaldehyde for 10 min, then soaked in permeabilization solution TritonX 100 for 10 min, then washed three times with 4xSSC, three times with 2xSSC, three times with 1xSSC, and finally three times with PBS. Finally, the specimens were blocked with blocking solution at room temperature for 1 h.

[0095] (1-3) Take 10 μL of denatured or pre-annealed Oip5os1 FISH probe and drop it on the cell specimen, and place it in a humid dark box for hybridization at 37°C overnight (about 15 to 17 hours). Since the Oip5os1 FISH probe forms less hybridization solution, the hybridization temperature is high, and the duration is long, this process is carried out in a humid box to keep the hybridized cell specimen moist.

[0096] (1-4) On the day after hybridization, remove the hybridized cell specimen from the 37°C incubator and wash it three times in 2×SSC preheated to 42-50°C, 5 minutes each time. Then wash it three times in 1×SSC preheated to 42-50°C, 5 minutes each time. Finally, wash the hybridized cell specimen lightly in 2×SSC at room temperature.

[0097] (1-5) Take 200 μL of counterstaining solution (PI / antifade or DAPI / antifade staining solution) and drop it on the hybridized cell specimen, incubate for 10 minutes, and then observe under a microscope.

[0098] Figure 7 FISH was used to show the localization of Oip5os1 during cardiomyocyte differentiation. Oip5os1 was localized in the cytoplasm in embryonic stem cells and mesoderm, and in the nucleus in cardiomyocyte progenitor cells.

[0099] Example 6: Oip5os1 promotes the nuclear expression of splicing protein A2BP1 in cardiac progenitor cells

[0100] The process of nuclear / cytoplasmic protein separation includes the following steps:

[0101] (1-1) Prepare the solution: Dissolve the three reagents in the nuclear / cytoplasmic protein extraction kit at room temperature, place on ice immediately after dissolution, and mix well. Take an appropriate amount of cytoplasmic protein extraction reagent A and add PMSF (phenylmethylsulfonyl fluoride) a few minutes before use to make the final concentration of PMSF 1mM. Take an appropriate amount of nuclear protein extraction reagent and add PMSF a few minutes before use to make the final concentration of PMSF 1mM.

[0102] (1-2) Wash once with PBS, scrape off the differentiated cardiomyocyte samples (specifically cells at four stages) with a cell scraper, or treat the cells with EDTA solution so that the cells are no longer tightly attached to the wall, and blow off the cells with a pipette. Collect the cells by centrifugation, and do your best to aspirate the supernatant, leaving the cell pellet for later use. Try to avoid digesting the cells with trypsin to prevent trypsin from degrading the target protein to be extracted.

[0103] (1-3) Add 200 μL of cytoplasmic protein extraction reagent A supplemented with PMSF to every 20 μL of cell pellet, vortex vigorously at the highest speed for 5 seconds to completely suspend and disperse the cell pellet, and place on ice for 10-15 minutes.

[0104] (1-4) Add 10 μL of cytoplasmic protein extraction reagent B, vortex vigorously at the highest speed for 5 seconds, and place on ice for 1 minute.

[0105] (1-5) Vortex vigorously at maximum speed for 5 seconds and centrifuge at 12,000-16,000 g for 5 minutes at 4°C.

[0106] (1-6) Immediately transfer the supernatant to a pre-cooled plastic tube, which is the extracted cytoplasmic protein.

[0107] (1-7) For the precipitate, completely aspirate the remaining supernatant, add 50 μL of nuclear protein extraction reagent with PMSF, and vortex vigorously at the highest speed for 15-30 seconds to completely suspend and disperse the cell precipitate. Then return it to the ice bath and vortex vigorously at high speed for 15-30 seconds every 1-2 minutes for a total of 30 minutes. Centrifuge at 12,000-16,000g at 4℃ for 10 minutes.

[0108] (1-8) Immediately transfer the supernatant to a pre-cooled plastic tube, which is the extracted nuclear protein.

[0109] The total proteins of three stages of cardiomyocyte differentiation were separated using a nuclear and cytoplasmic protein isolation kit. Figure 8 AD shows that WB experiments show that Oip5os1 promotes the expression of splicing protein A2BP1 in the nucleus during the cardiomyocyte progenitor cell period. Figure 8 E RIP experiments confirmed that Oip5os1 and A2BP1 (RBFOX1) have a direct targeting binding effect.

[0110] Embodiment 7:

[0111] 1. Design of minigene vectors for Mef2cα1 and α2

[0112] The Minigene reporter plasmid used for splicing research clones the variable exon (exon 3) and its upstream (exon 2) and downstream (exon 4) introns and exons to be studied into pcDNA3.1, and enters the cell through transient transfection. The CMV promoter on the plasmid drives transcription, and the splicing is completed by the spliceosome in the cell. Compared with directly studying the splicing of endogenous pre-mRNA in cells, the advantage of minigene is that it can be artificially manipulated to change the elements that may be involved in splicing regulation or introduce point mutations to achieve intervention in splicing.

[0113] The specific operation is: take about 5×10 5HEK293 cells were used to extract genomic DNA (gDNA). 50 ng of gDNA was taken as a template, Mef2c E3α1 and E3α2 were used as primers, and the entire DNA sequence containing exon 3 (Mef2c E3) was amplified with a high-fidelity enzyme, and the fragment to be inserted was obtained after purification. The 5' end of the primer used contained 20 bp of complementary sequence to the vector, thereby introducing homologous fragments complementary to the vector at both ends of the inserted fragment. Subsequently, the pcDNA3.1 vector was linearized by restriction digestion with NheI and EcoRI, and purified by running gel. The inserted fragment and the linearized vector were mixed in a molar ratio of 1:2 for homologous recombination reaction. The product after the reaction was immediately transformed, plated, single clones were selected and fragments 1-3 were sequenced. The primers used for sequencing are shown in SEQ ID NO.22-27.

[0114] like Fig. 9 As shown in A, the schematic diagram of the construction of the Minigene vector and sequencing confirmed that the minigene vector was successfully constructed.

[0115] 2. In vitro minigene validation of the splicing effect of A2BP1 on Mef2c E3

[0116] HEK293 cells in the logarithmic growth phase were taken and digested and then cultured at 3×10 5 Cells / well were seeded in a 6-well plate and cultured overnight to allow them to fully adhere to the wall. On the second day, cells were observed under a microscope to ensure that the confluence was between 70% and 90%. For each well of cells, 3 μL of Lipofetamine 3000 transfection reagent was diluted to 100 μL of Opti-MEM medium, mixed thoroughly, and placed at room temperature for 5 minutes. When transfecting multiple wells at the same time, the amount of transfection reagent and medium was proportionally increased accordingly. Mix 500 ng of minigene plasmid and 500 ng of A2BP1 overexpression plasmid (the plasmid construction steps are the same as those of Oip5os1 overexpression plasmid, and the amplified A2BP1 gene fragment is connected to the pcDNA3.1 vector to construct the A2BP1 overexpression vector) or control plasmid, dilute with 100 μL of Opti-MEM medium, and shake thoroughly. Mix 100 μL of transfection reagent diluent with 100 μL of plasmid diluent and incubate at room temperature for 20 minutes. Subsequently, 200 μL of the plasmid / transfection reagent mixture was added dropwise to the wells, shaken horizontally to mix, and the cells were returned to the incubator. After 8 hours of continued culture, the culture medium containing the transfection reagent was aspirated and fresh complete medium was added. 48 hours after transfection, the fluorescence can be observed and the cells can be collected for related experiments such as RNA extraction, cDNA synthesis, and RT-PCR.

[0117] Fig. 9B, 9C confirmed that A2BP1 promoted the splicing of Mef2cα2 in human 293 cells and mouse MEF cells. Fig. 9 D confirms the effect of A2BP1 overexpression.

[0118] Embodiment 8:

[0119] Bioinformatics methods were used to analyze the cardiomyocyte differentiation data of one set of human (GSE135411) and two sets of mouse (GSE116292, GSE197205) in the NCBI public database. Fig.10 A data show that Mef2cα1 is mainly expressed in normal differentiation. In addition, we used the same method to analyze the data of three sets of mouse skeletal muscle (GSE212675, GSE166071, GSE152467), and the data showed that Mef2cα2 is mainly expressed in skeletal muscle development. Specifically, the raw sequencing data of RNA-seq were downloaded from the Sequence Read Archive (SRA) database using prefetch (2.11.0) and fasterq-dump (2.11.0). The fastq file was quality controlled using rabbit_qc (0.0.1), and the parameter was selected as "-c--detect_adapter_for_pe"; the human and mouse transcriptomes were Ensembl release 107, and then salmon (1.9.0), and the parameters were set as "-l A--seqBias--gcBias--d--posBias--hardFilter-discardOrphansQuasi

[0120] --numGibbsSamples 50". Quantify the fastq file after quality control to obtain the transcript count value.

[0121] Fig.10 B shows the effects of Oip5os1 overexpression and knockout on Mef2cα1 / α2. Oip5os1 overexpression changes the expression pattern of Mef2cα1 and Mef2cα2. Specifically, during normal differentiation into cardiomyocyte progenitor cells, the expression level of Mef2cα1 is higher than that of Mef2cα2, and Mef2cα1 is the main expression. After overexpression of Oip5os1, Oip5os1 promotes the expression of splicing protein A2BP1 in the nucleus and can promote the alternative splicing of Mef2cα2, making Mef2cα2 the main expression. On the contrary, when Oip5os1 is knocked out, Mef2cα1 continues to be the main expression, and the value of Mef2cα1 / α2 is higher. Therefore, we hope that Mef2cα1 / α2 can be used as an indicator to explore the differentiation potential of cardiomyocyte progenitor cells.

[0122] In summary, after extensive and in-depth research, the present invention has found for the first time that overexpression of the Oip5os1 gene during myocardial cell differentiation will inhibit the differentiation of myocardial progenitor cells. At the same time, using the PLVX system, we also found that when DOX was added for induction, overexpression of Oip5os1 specifically in the myocardial progenitor period would also inhibit its differentiation. On the contrary, using the PLKO system to specifically knock down Oip5os1 in the myocardial progenitor period will promote its differentiation. Subsequently, FISH experiments showed that Oip5os1 would be localized to the nucleus during the myocardial progenitor period, and RIP experiments confirmed that Oip5os1 directly targeted and bound to the splicing protein A2BP1. In addition, it was further found that overexpression of Oip5os1 would also promote the expression of A2BP1 in the nucleus during the myocardial progenitor period, thereby promoting the splicing level of the downstream myocardial progenitor period's specific transcription factor Mef2cα2, and ultimately inhibiting the differentiation of myocardial progenitor cells. Therefore, the present invention discloses that the long non-coding RNA Oip5os1 (Rik) is a lncRNA that regulates the alternative splicing of downstream myocardial progenitor cell-specific transcription factors by changing its localization in a temporal and spatial specific manner, thereby ultimately regulating the differentiation of myocardial progenitor cells.

[0123] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A guide RNA molecule for inhibiting the expression of the long non-coding gene Oip5os1, characterized in that: The sequence of the guide RNA molecule is selected from any one of SEQ ID NO.1-4.

2. A small hairpin RNA molecule that inhibits the expression of the long non-coding gene Oip5os1, characterized in that: The sequence of the small hairpin structure RNA molecule is selected from any one of SEQ ID NO.11-13.

3. A cell model with long non-coding gene Oip5os1 knockout, characterized in that: The cell model comprises the RNA molecule as described in claim 1 or 2.

4. An application of the cell model as claimed in claim 3 in the field of research on differentiation of stem cells into cardiomyocytes.

5. A vector for promoting the expression of the long non-coding gene Oip5os1, characterized in that: The vector is a lentiviral vector containing the long non-coding gene Oip5os1 or a vector containing both the long non-coding gene Oip5os1 and a strong promoter.

6. A cell model for overexpression of the long non-coding gene Oip5os1, characterized in that: The cell model comprises the vector as claimed in claim 5.

7. Use of the cell model as claimed in claim 6 in the field of research on differentiation of stem cells into cardiomyocytes.

8. Use of the ribonucleic acid molecule according to any one of claims 1 or 2 or the vector according to claim 5 in the preparation of a drug or preparation for inhibiting the differentiation of stem cells into cardiomyocyte progenitor cells.

9. The use according to claim 8, characterized in that: The medicine or preparation is a medicine or preparation that inhibits the differentiation of stem cells into mesoderm.

10. The use according to claim 8, characterized in that: The drug or preparation is a drug or preparation that promotes the expression of A2BP1 and / or Mef2cα2.

Images