DsRNA pesticide targeting ustilaginoidea virens and application

Abstract

The invention discloses a chimera dsRNA (double-stranded ribonucleic acid). The chimera dsRNA comprises an efficient silencing segment in a Ustilaginoidea virens cytochrome P450 sterol 14 alpha-demethylase UvCYP51 gene, an efficient silencing segment in a Ustilaginoidea virens transcription factor UvbZIP11 gene and an efficient silencing segment in a Ustilaginoidea virens apoptosis related gene UvBI-1 gene. The invention also discloses a preparation method of the chimera dsRNA. The invention also discloses application of the chimera dsRNA in prevention and treatment of false smut. The invention also discloses a use method of the chimera dsRNA, and the chimera dsRNA can be prepared into a nucleic acid pesticide which acts on rice panicles and is used for preventing and treating false smut.

Description

Technical Field

[0001] The present invention relates to the technical field of pesticides, and in particular to a nucleic acid pesticide. Background Art

[0002] Pathogenic microorganisms, including viruses, bacteria, fungi and fungi-like organisms, pose a major threat to global agricultural production. According to a report by the Food and Agriculture Organization of the United Nations, about 20% to 40% of global crop yields are lost each year due to the influence of pathogenic microorganisms. These pathogens not only directly lead to reduced crop yields, but may also indirectly affect food safety and human health by producing toxins. In the face of these challenges, although traditional chemical pesticides have controlled diseases to a certain extent, due to their potential harm to the environment and the problem of pathogen resistance, people are increasingly concerned about the sustainability of their long-term use. Therefore, the development of new green, efficient and safe pesticides and the establishment of new environmentally friendly plant protection strategies have become the only way to achieve sustainable agricultural development.

[0003] Rice false smut is widely distributed in rice-growing areas around the world, causing 2.8% to 49% of global yield losses. The pathogen of rice false smut is Ustilaginoidea virens, which mainly damages the rice panicle during infection. The conidia of Ustilaginoidea virens germinate outside the glume, and the hyphae formed gradually extend to the inner side of the glume, seeds, filaments, anthers and other parts, eventually forming a yellow-green rice false smut ball surrounded by thick-walled spores. However, Ustilaginoidea virens does not directly harm the host plant cells, but adopts a "surrounding but not killing" strategy, growing and reproducing continuously by absorbing nutrients from the apoplast, and the besieged cells are degraded due to lack of nutrient supply. In addition, Ustilaginoidea virens can also produce secondary metabolites such as Ustilaginoidins and Ustiloxins, among which Ustiloxins can inhibit the formation of the intracellular cytoskeleton and endanger the health of humans and animals. Therefore, it is crucial to take comprehensive and effective measures to curb the occurrence and spread of rice false smut.

[0004] Cytochrome P450 sterol 14α-demethylase (CYP51) is the target of sterol demethylase inhibitors (DMIs). There is only one CYP51 gene in U. oryzae var. oryzae, named UvCYP51. The point mutation Y137H on UvCYP51 is the cause of resistance of U. oryzae var. oryzae to the triazole fungicide tebuconazole (Wang Fei, Study on the genetic diversity of U. oryzae var. oryzae and its molecular mechanism of resistance to DMI fungicides, Huazhong Agricultural University, PhD dissertation, 2015).

[0005] UvBI-1, as an inhibitor of the apoptosis-related protein Bax, negatively regulates the nutritional growth and conidia production of U.S. smut fungus. Knocking out this gene can reduce the pathogenicity of U.S. smut fungus (Xie Songlin, Study on the function of BI-1 gene of U.S. smut fungus and the identification method of secretory protein signal peptide, Huazhong Agricultural University, Master's thesis, 2019).

[0006] Spray-Induced Gene Silencing (SIGS) is a plant protection strategy that uses RNA interference (RNAi) technology. By utilizing cross-border silencing between plants and pathogens, the purpose of controlling plant diseases is achieved by spraying a solution containing double-stranded ribonucleic acid (dsRNA) with a specific target, namely a nucleic acid pesticide, on the plants. Nucleic acid pesticides based on RNAi technology have gradually become the focus of scientific research due to their advantages such as strong targeting, low toxicity, low impact on the environment and short research and development cycle. The mechanism of plant absorption of dsRNA has not yet been fully clarified, but the silencing mechanism after plant cells absorb dsRNA has been clarified. After exogenous dsRNA enters the cell, it will be cleaved by the nuclease Dicer or Dicer-like protein into 21-24nt small interfering RNA (siRNA). These siRNAs bind to the RNA-induced silencing complex (RISC) loaded with small RNA (sRNA) and then unwind into single-stranded RNA. The antisense strand guides RISC to specifically bind to the complementary sequence of mRNA, causing mRNA degradation and ultimately leading to gene silencing. In recent years, the research on SIGS technology has gradually been carried out in a variety of plant pathogenic fungi and has made some progress.

[0007] Patent application CN202211628713.3 discloses the preparation and application of a dsRNA nanopesticide for preventing and controlling Rhizoctonia solani disease.

[0008] There is no effective nucleic acid pesticide for rice false smut fungus. Summary of the invention

[0009] In view of the technical problems existing in the prior art, the object of the present invention is to provide a nucleic acid pesticide targeting rice false smut fungus for use in treating rice in order to reduce the incidence of rice false smut fungus.

[0010] To achieve the above object, the present invention adopts the following scheme.

[0011] The key to SIGS technology is to select appropriate target genes, design and screen dsRNA with inhibitory effects on pathogens.

[0012] The present invention is based on SIGS technology, combined with Escherichia coli HT115 (DE3) recombinant bacteria induction technology, with UvCYP51, UvbZIP11 and UvBI-1 as target genes. In order to improve the efficiency of disease prevention and control, the present invention screened the fragments with the highest silencing efficiency of each target gene of UvCYP51, UvbZIP11 and UvBI-1, and took a part of the fragments with high silencing efficiency and connected them in series to prepare chimeric DNA. The chimeric DNA of the series-connected fragments is constructed onto the L4440 vector plasmid expressing dsRNA. After the recombinant vector plasmid is transferred into the Escherichia coli HT115 (DE3) strain, it is induced and purified to obtain a chimeric dsRNA molecule with high-efficiency silencing fragments connected in series with UvCYP51, UvbZIP11 and UvBI-1 as target genes. A solution containing the chimeric dsRNA molecule was injected into the rice panicle, targeting the silencing of UvCYP51, UvbZIP11 and UvBI-1. The pathogenicity of the rice false smut fungus was inhibited, thereby achieving the effect of preventing and controlling the rice false smut.

[0013] Cytochrome P450 sterol 14α-demethylase (CYP51) is the target of sterol demethylase inhibitors (DMIs). There is only one CYP51 gene in U. oryzae var. oryzae, named UvCYP51.

[0014] Research conducted by the applicant has shown that UvbZIP11, one of the 28 bZIP transcription factor family proteins identified when the rice false smut fungus infects rice, loses its spore-producing ability after gene knockout and plays an important function in the nutritional growth of the rice false smut fungus.

[0015] UvBI-1, as an inhibitor of the apoptosis-related protein Bax, negatively regulates the vegetative growth and conidia production of U. oryzae var. oryzae.

[0016] The present invention firstly screens the fragments with high silencing efficiency for each gene of UvCYP51, UvbZIP11 and UvBI-1 through the PEG-mediated protoplast transformation technology.

[0017] The present invention divides the coding sequence (CDS) fragment of the target gene into sections of about 500 bp, and constructs pSilent-1 silencing expression vectors of the target gene fragments respectively. UvCYP51 is divided into four sections, namely UvCYP51-1, UvCYP51-2, UvCYP51-3 and UvCYP51-4; UvbZIP11 is divided into four sections, namely UvbZIP11-1, UvbZIP11-2, UvbZIP11-3 and UvbZIP11-4; UvBI-1 is divided into two sections, namely UvBI-1-1 and UvBI-1-2.

[0018] Experiments have shown that UvCYP51-3, UvbZIP11-4 and UvBI-1-2 are the fragments with the highest gene silencing efficiency.

[0019] After a portion of each of the three fragments with high gene silencing efficiency is taken and concatenated, the concatenated fragments are constructed into the L4440 vector plasmid expressing dsRNA. The L4440 vector plasmid is a dsRNA expression vector plasmid, which is characterized by containing T7 polymerase promoters in opposite directions at both ends of the multiple cloning site.

[0020] Limited by the cost of synthesis, the kit synthesis technology is only applicable to laboratory-level research. Field trials can use L4440-HT115 (DE3) recombinant bacteria to save costs and expand applications. The Escherichia coli HT115 (DE3) strain has the lambda phage DE3 region, which enables the cell to synthesize T7 RNA polymerase under the induction of isopropyl β-D-thiogalactopyranoside (IPTG). IPTG induces the synthesis of T7 RNA polymerase, and T7 RNA polymerase recognizes the T7 promoter to transcribe dsRNA. At the same time, Escherichia coli HT115 (DE3) cells lack the specific nuclease RNase III enzyme encoded by the rnc gene, so Escherichia coli HT115 (DE3) cells cannot degrade the dsRNA produced by themselves. Therefore, a large amount of dsRNA can be obtained by introducing the L4440 vector plasmid into the Escherichia coli HT115 (DE3) strain.

[0021] After constructing the L4440 recombinant vector plasmid of the CYP-bZIP-BI fragment, the recombinant vector plasmid was transferred into the competent cells of Escherichia coli HT115 (DE3) to obtain recombinant bacteria. After the recombinant bacteria were shaken and cultured to an OD value of 0.4-0.5, 400 μL of 100 mM IPTG was added to each 100 mL of bacterial solution, and total RNA was extracted after induction for 6 hours. After DNase I and RNase A enzymatic hydrolysis, a chimeric dsRNA molecule with highly efficient silencing fragments in series with UvCYP51, UvbZIP11 and UvBI-1 as target genes was obtained for subsequent experiments.

[0022] A solution containing a chimeric dsRNA molecule related to the target gene was injected into the rice panicle, and the rice smut fungus was inoculated into the rice panicle 12 hours later, and an investigation was conducted 21 days later. GFP-dsRNA synthesized using a green fluorescent protein (GFP) gene fragment as a template was used as a negative control to verify whether the effect observed in the experiment was specific to the target gene. Compared with rice that was not treated with dsRNA and treated with GFP-dsRNA, the target gene expression level in the fungus decreased significantly after 48 hours of treatment with the target gene chimeric dsRNA and inoculation with rice smut fungus, and the number of rice smut balls decreased significantly after inoculation with rice smut fungus, proving that the chimeric dsRNA provided by the present invention has a significant effect on the inhibition of rice smut.

[0023] The invention discloses a chimeric dsRNA, which is a chimeric dsRNA of a UvCYP51 gene fragment of cytochrome P450 sterol 14α-demethylase of U. oryzae var. oryzae, a UvbZIP11 gene fragment of a transcription factor of U. oryzae var. oryzae and a UvBI-1 gene fragment of a cell apoptosis-related gene of U. oryzae var. oryzae.

[0024] Furthermore, the chimeric dsRNA includes a portion of the highly efficient silencing fragment in the UvCYP51 gene of cytochrome P450 sterol 14α-demethylase of U.S. pyogenes, a portion of the highly efficient silencing fragment in the UvbZIP11 gene of U.S. pyogenes transcription factor, and a portion of the UvBI-1 gene of U.S. pyogenes apoptosis-related gene.

[0025] Furthermore, the size of the chimeric dsRNA is about 600 bp.

[0026] The present invention also discloses a method for preparing chimeric dsRNA, comprising the following steps:

[0027] 1) Clone the UvCYP51 gene fragment, the UvbZIP11 gene fragment and the UvBI-1 gene fragment of the U.S. smut pathogen into a silencing expression vector plasmid to obtain a silencing expression vector plasmid of the target gene fragment;

[0028] 2) transforming the silencing expression vector plasmid of the target gene fragment into the protoplasts of the U.S. smut fungus to obtain transformants;

[0029] 3) culturing transformants, determining the expression levels of each target gene of U.S. smut pathogen in the transformants, and screening highly efficient silencing fragments of each target gene;

[0030] 4) connecting the highly efficient silencing fragment of the UvCYP51 gene of the U.S. smut pathogen, the highly efficient silencing fragment of the UvbZIP11 gene of the U.S. smut pathogen, and the highly efficient silencing fragment of the UvBI-1 gene of the U.S. smut pathogen to prepare a chimeric DNA;

[0031] 5) cloning the chimeric DNA into a dsRNA expression vector plasmid to obtain a chimeric dsRNA expression vector plasmid;

[0032] 6) Transforming the chimeric dsRNA expression vector plasmid into competent cells to obtain recombinant bacteria;

[0033] 7) Cultivating the recombinant bacteria, extracting and purifying the dsRNA, and obtaining the chimeric dsRNA.

[0034] Furthermore, the silent expression vector plasmid in the above step 1) is a pSilent-1 vector plasmid.

[0035] Furthermore, the dsRNA expression vector plasmid in the above step 5) is L4440 vector plasmid.

[0036] Furthermore, the competent cells in the above step 6) are Escherichia coli HT115 (DE3) competent cells.

[0037] The invention also discloses a method for using the chimeric dsRNA, which comprises injecting the chimeric dsRNA into rice panicles.

[0038] Furthermore, the chimeric dsRNA is used at a concentration of 100 ng / μl.

[0039] The invention also discloses the application of the chimeric dsRNA as nucleic acid pesticide in the prevention and treatment of rice false smut.

[0040] The invention also discloses a method for using the chimeric dsRNA, which comprises preparing the chimeric dsRNA into nucleic acid pesticide and injecting the pesticide into rice panicles.

[0041] Furthermore, the chimeric dsRNA nucleic acid pesticide formulation may include a chimeric sRNA and a pesticide adjuvant.

[0042] Furthermore, the pesticide adjuvants of the chimeric dsRNA nucleic acid pesticide formulation may include dispersants, emulsifiers, solvents, carriers, fillers, stabilizers, controlled release adjuvants, synergists, wetting agents, penetrants, spreaders, adhesives, safeners, antidotes, defoamers, warning colors and other ingredients.

[0043] Furthermore, the chimeric dsRNA nucleic acid pesticide can be formulated with other effective ingredients to form a compound pesticide.

[0044] The present invention also discloses a method for preparing a chimeric dsRNA nucleic acid pesticide, comprising the following steps:

[0045] 1) Select several genes related to pathogenicity in the genome of crop pathogens;

[0046] 2) Clone the pathogenicity-related gene fragment into a silencing expression vector plasmid to obtain a silencing expression vector plasmid of the target gene fragment;

[0047] 3) Transforming the silencing expression vector plasmid of the target gene fragment into the protoplasts of crop pathogenic bacteria to obtain transformants;

[0048] 4) Cultivating transformants, determining the expression levels of target genes of pathogenic bacteria in the transformants, and screening highly efficient silencing fragments of target genes related to pathogenicity;

[0049] 5) Connect the efficient silencing fragments of different target genes related to pathogenicity to prepare chimeric DNA;

[0050] 6) cloning the chimeric DNA into a dsRNA expression plasmid vector to obtain a chimeric dsRNA expression vector plasmid;

[0051] 7) Transforming the chimeric dsRNA expression vector plasmid into competent cells to obtain recombinant bacteria;

[0052] 8) Cultivating the recombinant bacteria, extracting and purifying the dsRNA, and obtaining the chimeric dsRNA;

[0053] 9) Formulate chimeric dsRNA into nucleic acid pesticides.

[0054] Furthermore, the silencing expression vector plasmid in the above step 2) is a pSilent-1 vector plasmid.

[0055] Furthermore, the dsRNA expression vector plasmid in the above step 6) is L4440 vector plasmid.

[0056] Furthermore, the competent cells in the above step 7) are Escherichia coli HT115 (DE3) competent cells.

[0057] Furthermore, the size of the chimeric dsRNA is about 600 bp.

[0058] Specifically, the present invention is as follows.

[0059] 1. A chimeric dsRNA, comprising: a highly efficient silencing fragment in the UvCYP51 gene of cytochrome P450 sterol 14α-demethylase of U. oryzae var. oryzae, a highly efficient silencing fragment in the UvbZIP11 gene of transcription factor of U. oryzae var. oryzae, and a highly efficient silencing fragment in the UvBI-1 gene of apoptosis-related gene of U. oryzae var. oryzae.

[0060] 2. The chimeric dsRNA according to item 1, characterized in that the size of the chimeric dsRNA is about 600 bp.

[0061] 3. The chimeric dsRNA according to item 2, characterized in that: the chimeric dsRNA is transcribed from a DNA comprising the sequence shown in Seq_63.

[0062] 4. A method for preparing a chimeric dsRNA according to any one of items 1 to 3, comprising the following steps:

[0063] 1) Clone the UvCYP51 gene fragment, the UvbZIP11 gene fragment and the UvBI-1 gene fragment of the U.S. smut pathogen into a silencing expression vector plasmid to obtain a silencing expression vector plasmid of the target gene fragment;

[0064] 2) transforming the silencing expression vector plasmid of the target gene fragment into the protoplasts of the U.S. smut fungus to obtain transformants;

[0065] 3) culturing transformants, determining the expression levels of each target gene of U.S. smut pathogen in the transformants, and screening highly efficient silencing fragments of each target gene;

[0066] 4) connecting the highly efficient silencing fragment of the UvCYP51 gene of the U.S. smut pathogen, the highly efficient silencing fragment of the UvbZIP11 gene of the U.S. smut pathogen, and the highly efficient silencing fragment of the UvBI-1 gene of the U.S. smut pathogen to prepare a chimeric DNA;

[0067] 5) cloning the chimeric DNA into a dsRNA expression vector plasmid to obtain a chimeric dsRNA expression vector plasmid;

[0068] 6) Transforming the chimeric dsRNA expression vector plasmid into competent cells to obtain recombinant bacteria;

[0069] 7) Cultivating the recombinant bacteria, extracting and purifying the dsRNA, and obtaining the chimeric dsRNA.

[0070] 5. The method for preparing the chimeric dsRNA according to item 4, characterized in that:

[0071] The silencing expression vector plasmid in step 1) is a pSilent-1 vector plasmid, the dsRNA expression vector plasmid in step 5) is a L4440 vector plasmid, and the competent cells in step 6) are Escherichia coli HT115 (DE3) competent cells.

[0072] 6. The method for using the chimeric dsRNA according to any one of items 1 to 3, comprising injecting the chimeric dsRNA into rice panicles.

[0073] 7. The method for using the chimeric dsRNA according to item 6, characterized in that the chimeric dsRNA is used at a concentration of 100 ng / μl.

[0074] 8. Use of the chimeric dsRNA according to any one of items 1 to 3 in controlling rice false smut.

[0075] 9. Use of the chimeric dsRNA according to any one of items 1 to 3 in the preparation of nucleic acid pesticides.

[0076] 10. A nucleic acid pesticide comprising the chimeric dsRNA according to any one of items 1 to 3 and a pesticide adjuvant.

[0077] 11. The nucleic acid pesticide according to item 10 is characterized in that: the pesticide adjuvant includes a dispersant, an emulsifier, a solvent, a carrier, a filler, a stabilizer, a controlled release adjuvant, a synergist, a wetting agent, a penetrant, a spreader, an adhesive, a safener, an antidote, a defoaming agent and / or a warning color.

[0078] 12. A method for using the nucleic acid pesticide according to item 10 or 11, comprising injecting the nucleic acid pesticide into rice ears.

[0079] 13. The method for using the nucleic acid pesticide according to item 12, characterized in that the chimeric dsRNA in the nucleic acid pesticide is used at a concentration of 100 ng / μl.

[0080] 14. Use of the nucleic acid pesticide described in item 10 or 11 in the prevention and control of rice false smut.

[0081] 15. A method for preparing a chimeric dsRNA nucleic acid pesticide, comprising the following steps:

[0082] 1) Select several genes related to pathogenicity in the genome of crop pathogens;

[0083] 2) Clone the pathogenicity-related gene fragment into a silencing expression vector plasmid to obtain a silencing expression vector plasmid of the target gene fragment;

[0084] 3) Transforming the silencing expression vector plasmid of the target gene fragment into the protoplasts of crop pathogenic bacteria to obtain transformants;

[0085] 4) Cultivating transformants, determining the expression levels of target genes of pathogenic bacteria in the transformants, and screening highly efficient silencing fragments of target genes related to pathogenicity;

[0086] 5) Connect the efficient silencing fragments of different target genes related to pathogenicity to prepare chimeric DNA;

[0087] 6) cloning the chimeric DNA into a dsRNA expression vector plasmid to obtain a chimeric dsRNA expression vector plasmid;

[0088] 7) Transforming the chimeric dsRNA expression vector plasmid into competent cells to obtain recombinant bacteria;

[0089] 8) Cultivating the recombinant bacteria, extracting and purifying the dsRNA, and obtaining the chimeric dsRNA;

[0090] 9) Formulate chimeric dsRNA into nucleic acid pesticides.

[0091] 16. The method for preparing the chimeric dsRNA nucleic acid pesticide according to item 15, characterized in that:

[0092] The silencing expression vector plasmid in step 2) is a pSilent-1 vector plasmid, the dsRNA expression vector plasmid in step 6) is a L4440 vector plasmid, and the competent cells in step 7) are Escherichia coli HT115 (DE3) competent cells.

[0093] 17. The method for preparing a chimeric dsRNA nucleic acid pesticide according to item 15 or 16, characterized in that the size of the chimeric dsRNA is about 600 bp.

[0094] The beneficial effects obtained by the present invention are as follows:

[0095] 1. The present invention provides a method for producing and preparing a chimeric dsRNA molecule that plays a role in SIGS, and provides an application method of SIGS technology in preventing and controlling rice false smut fungi.

[0096] 2. The present invention provides a chimeric dsRNA that can be used to control rice false smut fungi, which can be prepared into a nucleic acid pesticide to act on rice crops, thereby avoiding cultivation as a genetically modified crop and being rejected by the consumer group. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 This is a schematic diagram of segment segmentation and construction of a silencing expression vector according to an embodiment of the present invention.

[0098] Figure 2 This is the validation result of each target gene fragment transformant according to an embodiment of the present invention.

[0099] Figure 3 The results of measuring gene expression levels in transformants of each target gene fragment according to an embodiment of the present invention are shown.

[0100] Figure 4 This is the phenotype verification result of the transformant corresponding to the highly efficient silencing fragment of one embodiment of the present invention.

[0101] Figure 5 This is an electrophoresis picture of a chimeric DNA according to an embodiment of the present invention.

[0102] Figure 6 This is an electrophoresis picture of the purified chimeric dsRNA induced by expression according to one embodiment of the present invention.

[0103] Figure 7 This is the test result of the effect of the chimeric dsRNA on the pathogenicity of U.S. smut fungus according to one embodiment of the present invention. DETAILED DESCRIPTION

[0104] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, a brief introduction is given below in conjunction with the drawings required for use in the embodiments or the prior art description. It should be understood that the embodiments of the present invention are only used to explain the present invention rather than to limit it, and the protection scope of the present invention is limited only by the claims of the present invention. The embodiments provided by the present invention are only preferred embodiments of the present invention and are not intended to limit the present invention in any form. Obviously, for those of ordinary skill in the art, other embodiments can also be obtained based on these embodiments without paying creative work. Those skilled in the art can make changes, equivalent substitutions or modifications based on the content of the present invention to form different implementation methods. However, without violating the concept of the present invention, any changes and deformations made to the method of the present invention, any equivalent substitutions, are within the protection scope of the present invention.

[0105] Example 1. Instruments, reagents and culture medium

[0106] The CFX96 real-time fluorescence quantitative PCR detection system was purchased from Bio-Rad Laboratories Inc., USA.

[0107] Primer synthesis and sequence sequencing were completed by Wuhan Tianyi Huayu Gene Technology Co., Ltd. and Beijing Qingke Biotechnology Co., Ltd.

[0108] RNA-related reagents are as follows: dsRNA in vitro transcription T7 High Yield RNA Transcription Kit was purchased from Nanjing Novogene Biotechnology Co., Ltd., RNA extraction kit was purchased from Beijing Aidelai Biotechnology Co., Ltd., qRT-PCR enzyme 2×Sybr Green qPCR Mix was purchased from ABclonal, DNase I and RNaseA were purchased from Beijing Solebow Technology Co., Ltd., and DEPC-treated water was purchased from Yishen Biotechnology (Shanghai) Co., Ltd.

[0109] The reagents related to gene amplification and vector construction are as follows: 2000 bp DNA Marker, 5000 bp DNA Marker, Loading Buffer, restriction endonuclease were purchased from TAKARA and NEW ENGLAND Biolabs (NEB). PCR Mix was purchased from Tolo Biotech (TOLOBIO). TRIzol reagent was purchased from ThermoFisher Scientific (China) Co., Ltd. II First Strand cDNA Synthesis Kit ( Ⅱ1st Strand cDNASynthesis SuperMix) and PCR Master Mix (With Dye) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. The vector cloning One Step Cloning Kit was purchased from Nanjing Novogene Biotechnology Co., Ltd. The gel excision purification recovery kit and plasmid recovery kit were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0110] The relevant enzymes used for protoplast preparation are as follows: Driselase, Lysing enzyme and Lywallzyme were purchased from Sigma-Aldrich, USA.

[0111] The relevant reagents for inducing L4440-HT115 recombinant bacteria to express dsRNA are as follows: IPTG was purchased from Beijing Lanjieke Technology Co., Ltd., PBS phosphate buffer (dry powder) was purchased from Wuhan Saiweier Biotechnology Co., Ltd. Escherichia coli HT115 (DE3) competent cells were purchased from Shanghai Angyu Biotechnology Co., Ltd.

[0112] The DNA extraction buffer was prepared as follows: 2% CTAB, 100 mM Tris-HCl (pH=8.0), 25 mM EDTA, 2 M NaCl, and sterilized at 121° C. for 20 minutes.

[0113] 1×STC buffer was prepared as follows: 100 g Sucrose, 50 mL 0.5 M Tris-Cl (pH 8.0), 3.6755 g CaCl 2 ·2H 2 O, supplemented with ddH 2 0 to 500 mL and sterilize at 121°C for 20 minutes.

[0114] The preparation method of 40% PTC is as follows: 40g PEG8000, add 1×STC buffer to 100mL, dissolve in a 65℃ water bath, filter and sterilize with a bacterial filter, and store at 4℃.

[0115] The preparation method of protoplast buffer is as follows: 500 mg of Driselase, 200 mg of Lysingenzyme, 1 mg of Lywallzyme, add sterile 1.2M KCl to make up to 30 mL, shake on an orbital shaker at room temperature for 20 minutes, centrifuge at 4000 r / min for 6 minutes, and aspirate the supernatant for filtration and sterilization.

[0116] The preparation method of 75% ethanol-PBS is as follows: PBS and anhydrous ethanol are mixed evenly in a ratio of 1:3.

[0117] The formula and preparation method of the culture medium for the U.S. smut pathogen and the transformation-related culture medium used in the present invention are as follows:

[0118] PSB medium: weigh 200 g fresh potatoes, chop and cook, filter with filter cloth, add 20 g sucrose to the filtrate, supplement with ddH 2 0 to 1 L, sterilize at 121℃ for 20 min.

[0119] PSA medium: weigh 200g fresh potatoes, chop and cook, filter with filter cloth, add 20g Sucrose and 15g agar powder to the filtrate, add ddH 2 0 to 1 L, sterilize at 121℃ for 20 min.

[0120] PDA medium: weigh 200g fresh potatoes, chop and cook, filter with filter cloth, add 20g glucose, 15g agar, and ddH 2 0 to 1 L, sterilize at 121℃ for 20 min.

[0121] Rice leaf culture medium: Take 1.5g of Late Indica 98 leaves and add ddH 2 O, then crush with a blender, make up to 50 mL, and sterilize at 121°C for 30 min.

[0122] TB3 medium: 3g Yeast Extract, 3g Casein acid hydrolysate, 200g Sucrose, supplemented with ddH 2 0 to 1 L, sterilize at 121℃ for 20 min.

[0123] TB3 Bottom medium: 3g Yeast Extract, 3g acid hydrolyzed casein, 200g Sucrose, 10g Agar, supplemented with ddH 2 0 to 1 L, sterilize at 121℃ for 20 min.

[0124] TB3 Top medium: 3 g Yeast Extract, 3 g acid hydrolyzed casein, 200 g Sucrose, 180 μg / mL hygromycin, 10 g Agar, supplemented with ddH 2 0 to 1 L and sterilize at 121℃ for 20 min.

[0125] Luria-Bertani (LB) medium: 5 g sodium chloride (NaCl), 10 g tryptone, 10 g yeast extract, supplemented with ddHO 2 0 to 1 L and sterilize at 121℃ for 20 min.

[0126] Solid Luria-Bertani (LB) medium: 5 g sodium chloride, 10 g peptone, 10 g yeast extract, supplemented with ddH 2 0 to 1 L, add 15 g agar powder, and sterilize at 121°C for 20 min.

[0127] Example 2: Construction of silent expression vector and acquisition of silent transformants

[0128] Figure 1 A represents the segmentation of the target gene coding sequence (CDS) fragment. The cDNA fragments of UvCYP51 (1587 bp), UvbZIP11 (1776 bp), and UvBI-1 (837 bp) were obtained from the cDNA of U. smut fungus. Then, using the cDNA fragments as templates, the UvCYP51 gene sequence was divided into four segments of 427 bp, 416 bp, 427 bp, and 427 bp respectively through PCR reaction; the UvbZIP11 gene sequence was divided into four segments of 447 bp, 458 bp, 483 bp, and 454 bp respectively; and the UvBI-1 gene sequence was divided into two segments of 437 bp and 420 bp respectively.

[0129] The primers used in the PCR reaction for cloning the target gene coding sequence fragment are shown in Table 1.

[0130] Table 1. PCR primers used in cloning target gene coding sequence fragments

[0131] Primer name Purpose pSilent-CYP51-1-F Cloning of CYP51-1 into pSilent-1 pSilent-CYP51-1-R Cloning of CYP51-1 into pSilent-1 pSilent-antiCYP51-1-F Cloning of antiCYP51-1 into pSilent-1 pSilent-antiCYP51-1-R Cloning of antiCYP51-1 into pSilent-1 pSilent-CYP51-2-F Cloning of CYP51-2 into pSilent-1 pSilent-CYP51-2-R Cloning of CYP51-2 into pSilent-1 pSilent-antiCYP51-2-F Cloning of antiCYP51-2 into pSilent-1 pSilent-antiCYP51-2-R Cloning of antiCYP51-2 into pSilent-1 pSilent-CYP51-3-F Cloning of CYP51-3 into pSilent-1 pSilent-CYP51-3-R Cloning of CYP51-3 into pSilent-1 pSilent-antiCYP51-3-F Cloning of antiCYP51-3 into pSilent-1 pSilent-antiCYP51-3-R Cloning of antiCYP51-3 into pSilent-1 pSilent-CYP51-4-F Cloning of CYP51-4 into pSilent-1 pSilent-CYP51-4-R Cloning of CYP51-4 into pSilent-1 pSilent-antiCYP51-4-F Cloning of antiCYP51-4 into pSilent-1 pSilent-antiCYP51-4-R Cloning of antiCYP51-4 into pSilent-1 pSilent-bZIP-1-F Cloning of bZIP11-1 into pSilent-1 pSilent-bZIP-1-R Cloning of bZIP11-1 into pSilent-1 pSilent-antibZIP-1-F Cloning of antibZIP11-1 into pSilent-1 pSilent-antibZIP-1-R Cloning of antibZIP11-1 into pSilent-1 pSilent-bZIP-2-F Cloning of bZIP11-2 into pSilent-1 pSilent-bZIP-2-R Cloning of bZIP11-2 into pSilent-1 pSilent-antibZIP-2-F Cloning of antibZIP11-2 into pSilent-1 pSilent-antibZIP-2-R Cloning of antibZIP11-2 into pSilent-1 pSilent-bZIP-3-F Cloning of bZIP11-3 into pSilent-1 pSilent-bZIP-3-R Cloning of bZIP11-3 into pSilent-1 pSilent-antibZIP-3-F Cloning of antibZIP11-3 into pSilent-1 pSilent-antibZIP-3-R Cloning of antibZIP11-3 into pSilent-1 pSilent-bZIP-4-F Cloning of bZIP11-4 into pSilent-1 pSilent-bZIP-4-R Cloning of bZIP11-4 into pSilent-1 pSilent-antibZIP-4-F Cloning of antibZIP11-4 into pSilent-1 pSilent-antibZIP-4-R Cloning of antibZIP11-4 into pSilent-1 pSilent-BI-1-F Clone BI-1-1 into pSilent-1 pSilent-BI-1-R Clone BI-1-1 into pSilent-1 pSilent-antiBI-1-F Clone antiBI-1-1 into pSilent-1 pSilent-antiBI-1-R Clone antiBI-1-1 into pSilent-1 pSilent-BI-2-F Clone BI-1-2 into pSilent-1 pSilent-BI-2-R Clone BI-1-2 into pSilent-1 pSilent-antiBI-2-F Clone antiBI-1-2 into pSilent-1 pSilent-antiBI-2-R Clone antiBI-1-2 into pSilent-1

[0132] The primer sequences used in the PCR reaction are as follows:

[0133] pSilent-CYP51-1-F:

[0134] 5'-CAAGCATCGATACCGTCGACATGGGCGTCCTTCAAG-3'(Seq_1)pSilent-CYP51-1-R:

[0135] 5'-GCTCACCTGTATCCTCCAGCTCAAAACAGTGTATATTTCC-3'(Seq_2)pSilent-antiCYP51-1-F:

[0136] 5'-ACACACAGCCAGGGAACGGCTCAAAACAGTGTATATTTCC-3'(Seq_3)pSilent-antiCYP51-1-R:

[0137] 5'-TTAAGTGGATCCGGGGCCCAATGGGCGTCCTTCAAG-3'(Seq_4)pSilent-CYP51-2-F:

[0138] 5'-CAAGCATCGATACCGTCGACAGGAAATATACACTGTTT-3'(Seq_5)pSilent-CYP51-2-R:

[0139] 5'-GCTCACCTGTATCCTCCAGCAATCTTGGCAACAGTCCG-3'(Seq_6)pSilent-antiCYP51-2-F:

[0140] 5'-ACACACAGCCAGGGAACGGCAATCTTGGCAACAGTCCG-3'(Seq_7)pSilent-antiCYP51-2-R:

[0141] 5'-TTAAGTGGATCCGGGGCCCAAGGAAATATACACTGTTT-3'(Seq_8)pSilent-CYP51-3-F:

[0142] 5'-CAAGCATCGATACCGTCGACCAGCGGACTGTTGCCAAG-3'(Seq_9)pSilent-CYP51-3-R:

[0143] 5'-GCTCACCTGTATCCTCCAGCTGACATACTTGGTGCCAG-3'(Seq_10)pSilent-antiCYP51-3-F:

[0144] 5'-ACACACAGCCAGGGAACGGCTGACATACTTGGTGCCAG-3'(Seq_11)pSilent-antiCYP51-3-R:

[0145] 5'-TTAAGTGGATCCGGGGCCCACAGCGGACTGTTGCCAAG-3'(Seq_12)pSilent-CYP51-4-F:

[0146] 5'-CAAGCATCGATACCGTCGACTCCTGGCACCAAGTATGT-3'(Seq_13)pSilent-CYP51-4-R:

[0147] 5'-GCTCACCTGTATCCTCCAGCCTAATCTCGTCGTTCCCA-3'(Seq_14)pSilent-antiCYP51-4-F:

[0148] 5'-ACACACAGCCAGGGAACGGCCTAATCTCGTCGTTCCCA-3'(Seq_15)pSilent-antiCYP51-4-R:

[0149] 5'-TTAAGTGGATCCGGGGCCCATCCTGGCACCAAGTATGT-3'(Seq_16)pSilent-bZIP-1-F:

[0150] 5'-CAAGCATCGATACCGTCGACATGGCTTCCAGCGGCAACG-3'(Seq_17)pSilent-bZIP-1-R:

[0151] 5'-GCTCACCTGTATCCTCCAGCCTTTTCCGCGCTCTCCCG-3'(Seq_18)pSilent-antibZIP-1-F:

[0152] 5'-ACACACAGCCAGGGAACGGCCTTTTCCGCGCTCTCC-3'(Seq_19)pSilent-antibZIP-1-R:

[0153] 5'-TTAAGTGGATCCGGGGCCCAATGGCTTCCAGCGGCA-3'(Seq_20)pSilent-bZIP-2-F:

[0154] 5'-CAAGCATCGATACCGTCGACAGACGGGAGAGCGCGGAAAA-3'(Seq_21)pSilent-bZIP-2-R:

[0155] 5'-GCTCACCTGTATCCTCCAGCCTGCCTTTGCCGCCCAG-3'(Seq_22)pSilent-antibZIP-2-F:

[0156] 5'-ACACACAGCCAGGGAACGGCCTGCCTTTGCCGCCCAG-3'(Seq_23)pSilent-antibZIP-2-R:

[0157] 5'-TTAAGTGGATCCGGGGCCCAAGACGGGAGAGCGCGGAA-3'(Seq_24)pSilent-bZIP-3-F:

[0158] 5'-CAAGCATCGATACCGTCGACGCCCCGGCCTGGGCGG-3'(Seq_25)pSilent-bZIP-3-R:

[0159] 5'-GCTCACCTGTATCCTCCAGCAGTCGCCGAACAGCTGGG-3'(Seq_26)pSilent-antibZIP-3-F:

[0160] 5'-ACACACAGCCAGGGAACGGCAGTCGCCGAACAGCTGGG-3'(Seq_27)pSilent-antibZIP-3-R:

[0161] 5'-TTAAGTGGATCCGGGGCCCAGCCCCGGCCTGGGCGG-3'(Seq_28)pSilent-bZIP-4-F:

[0162] 5'-CAAGCATCGATACCGTCGACCCCCCAGCTGTTCGGCGA-3'(Seq_29)pSilent-bZIP-4-R:

[0163] 5'-GCTCACCTGTATCCTCCAGCCTACGGCAGTGTCGCC-3'(Seq_30)

[0164] pSilent-antibZIP-4-F:

[0165] 5'-ACACACAGCCAGGGAACGGCCTACGGCAGTGTCGCC-3'(Seq_31)pSilent-antibZIP-4-R:

[0166] 5'-TTAAGTGGATCCGGGGCCCACCCCCAGCTGTTCGGCGA-3'(Seq_32)pSilent-BI-1-F:

[0167] 5'-CAAGCATCGATACCGTCGACATGGCCTCGAGCACCACCAA-3'(Seq_33)pSilent-BI-1-R:

[0168] 5'-GCTCACCTGTATCCTCCAGCGCAAAGGTGAAGAGCGCAAG-3'(Seq_34)pSilent-antiBI-1-F:

[0169] 5'-ACACACAGCCAGGGAACGGCGCAAAGGTGAAGAGCGACAG-3'(Seq_35)pSilent-antiBI-1-R:

[0170] 5'-TTAAGTGGATCCGGGGCCCAATGGCCTCGAGCACCACCAA-3'(Seq_36)pSilent-BI-2-F:

[0171] 5'-CAAGCATCGATACCGTCGACCTGTCGCTCTTCACCTTTGC-3'(Seq_37)pSilent-BI-2-R:

[0172] 5'-GCTCACCTGTATCCTCCAGCTCAGTTGTTAGACTGGCTGT-3'(Seq_38)pSilent-antiBI-2-F:

[0173] 5'-ACACACAGCCAGGGAACGGCTCAGTTGTTAGACTGGCTGT-3'(Seq_39)pSilent-antiBI-2-R:

[0174] 5'-TTAAGTGGATCCGGGGCCCACTGTCGCTCTTCACCTTTGC-3'(Seq_40)

[0175] Figure 1B represents the schematic diagram of the construction of the inserted fragment of the pSilent-1 silencing expression vector. The intron used in this embodiment is the second intron of the CUT gene of the rice blast fungus (Magnaporthe oryzae), and other sequences can also be used as introns. PtrpC is the trpC promoter of Aspergillus nidulans, and TtrpC is the trpC terminator of A. nidulans. Each short DNA fragment of the target gene is cloned into both sides of the intron in the pSilent-1 silencing expression vector, one side is the positive strand, and the other side is the antisense strand, thereby generating an RNAi construct expressing the hairpin RNA (hpRNA) of the target gene. For example, the forward fragment was amplified by the primer pair pSilent-CYP51-1-F and pSilent-CYP51-1-R and inserted into the left side of the intron, and the reverse fragment was amplified by the primer pair pSilent-antiCYP51-1-F and pSilent-antiCYP51-1-R and inserted into the right side of the intron to obtain the pSilent-1 silencing expression vector of the target gene CYP51-1 fragment.

[0176] The cells of the wild-type strain JS60-2 of U.S. smut fungus were treated with driselase, lysing enzyme and lywallzyme to obtain the protoplasts of the wild-type strain JS60-2 of U.S. smut fungus. The protoplast preparation method is as follows: the wild-type strain JS60-2 of U.S. smut fungus was activated on PSA medium, and after 10 to 15 days, two pieces of bacterial cake were taken with a 5 mm diameter puncher and inoculated into the rice leaf medium, and cultured for 6 to 7 days (the spore concentration was about 10 7 -10 8 / mL). Pipette about 10mL of culture solution into 50mL PSB medium, shake and culture for about 36 hours, until more than 90% of spores germinate (microscope examination). Use a funnel with a layer of lens paper to filter the mycelium, rinse with sterile water twice, and rinse with 1.2M KCl twice. Pick an appropriate amount of mycelium and suspend it in protoplast buffer, and enzymatically hydrolyze the mycelium at 30℃ and 90r / min for 3 to 5 hours (check the protoplast concentration under a microscope after 3 hours of enzymatic hydrolysis. If the lysis is not complete, the time can be appropriately extended). Filter the protoplasts with 6 layers of gauze, transfer to a 50mL centrifuge tube, and rinse the protoplasts remaining on the gauze with 20mL1.2M KCl. Centrifuge the protoplasts at 3500r / min for 10 minutes at room temperature, discard the supernatant, slowly suspend the protoplasts on ice with 20mL 1×STC (add slowly by rotating along the tube wall), and repeat the above steps once more. Finally, slowly rotate along the tube wall and add 1×STC to suspend the protoplasts to a concentration of about 1×10 8 / mL, and dispense into 50mL centrifuge tubes (150μl / tube).

[0177] Protoplast transformation of pSilent-1 silencing expression vector recombinant plasmid of target gene fragment: add 50 μL of pSilent-1 silencing expression vector recombinant plasmid of 300 ng / μL target gene fragment purified by culture to the protoplasts of rice smut pathogen with a cut 200 μL pipette tip, mix gently, and let stand at room temperature for 20 minutes; add 1 mL 40% PTC (PEG8000 configuration) along the tube wall by slow rotation, mix gently and let stand at room temperature for 20 minutes; add 5 mL TB3 culture medium (containing 50 μg / mL Amp) to each tube, and culture overnight at 27°C and 90 r / min; add the culture solution to 50 mL TB3 Bottom culture medium cooled to 47-55°C; pour the culture medium into about 5-6 culture dishes (diameter of culture dish 9 cm) after mixing, and culture overnight at 27°C with 15 mL TB3 Top medium (containing 180 μg / mL hygromycin) was overlaid and cultured at 27° C. for 15 to 20 days to achieve PEG-mediated protoplast transformation, so that the recombinant plasmids of each silencing expression vector were transformed into the wild-type strain JS60-2 of U.S. oryzae for stable expression.

[0178] After culturing in a 27°C constant temperature incubator for 15 to 20 days, the transformants on the surface of the breakthrough culture medium were picked up and placed on PSA culture medium (containing 180 μg / mL hygromycin) and cultured in a 27°C constant temperature incubator for 10 days. The transformants were verified using the upstream primers of the vector and the downstream primers of the vector. Three transformants were selected for each fragment for PCR verification.

[0179] The primer pair sequences used for transformant verification are as follows:

[0180] pSilent-YZ-F: 5'-GGACATTATTATCATCTGCT-3'(Seq_41)

[0181] pSilent-YZ-R: 5'-GTGGGTACACTATTCGGC-3'(Seq_42)

[0182] PCR Mix Use PCR Master Mix(With Dye). PCR system (50μL): PCR Master Mix 25 μL, transformant template DNA 2 μL, forward primer 2.5 μL, reverse primer 2.5 μL, ddH 2 O 18 μL. PCR program: 95°C, 2 minutes; 95°C, 10 seconds, 58°C, 20 seconds, 72°C, 1 minute, 35 cycles; 72°C, 2.5 minutes; 16°C, 1 minute.

[0183] Verification results can be found in Figure 2 , with β-tubulin gene as reference.

[0184] Example 3: Determination of gene expression levels and phenotypic observation in transformants of each target gene

[0185] Two silencing transformants corresponding to each gene fragment were selected for subsequent expression analysis and phenotype verification. Quantitative real-time fluorescence quantitative PCR (qRT-PCR) was used to screen the efficient silencing fragments in the bacteria.

[0186] use The total RNA of the selected positive transformants was extracted with TRIzol reagent and used II First-Strand cDNA Synthesis Kit was used to reverse transcribe total RNA samples into cDNA.

[0187] The steps for cDNA synthesis are as follows.

[0188] Prepare in an RNase-free centrifuge tube, 5× gDNA digester Buffer 2μL, gDNA digester 1μL, template RNA 500ng, RNase-free H 2 Mix gently and incubate at 42°C for 2 minutes. Add 10 μL of ⅡSuperMix plus, gently mix. Reverse transcription program: 25℃, 5 minutes; 42℃, 30 minutes; 85℃, 5 minutes. The final product is stored at -20℃.

[0189] The steps of quantitative real-time fluorescence quantitative PCR are as follows.

[0190] After reverse transcription, the reaction mixture was diluted 10 times and used as a template. Quantitative detection primers were designed according to the amplified fragment between 150 bp and 200 bp.

[0191] The primers for quantitative real-time fluorescence quantitative PCR are as follows:

[0192] qPCR-CYP-1-F: 5'-TGGCATCGCAAATTGCATTG-3'(Seq_43)

[0193] qPCR-CYP-1-R: 5'-GGTGAAGACATCTCCGAACT-3'(Seq_44)

[0194] qPCR-CYP-3-F: 5'-CGACATCATGAAGCATCTGA-3'(Seq_45)

[0195] qPCR-CYP-3-R: 5'-TTGGCTAGGTCTTCGTATGT-3'(Seq_46)

[0196] qPCR-bZIP-1-F: 5'-ATTCATCTCAGGCTTCCCCG-3'(Seq_47)

[0197] qPCR-bZIP-1-R: 5'-GCGACTCGTTTTCGGTGGAT-3'(Seq_48)

[0198] qPCR-bZIP-4-F: 5'-GCAACCCTTCCTTTGACGAC-3'(Seq_49)

[0199] qPCR-bZIP-4-R: 5'-CACTTTGCCTTTTTGGCGAG-3'(Seq_50)

[0200] qPCR-BI-1-F: 5'-TTCAAGTTTTGGAGGATCCGT-3'(Seq_51)

[0201] qPCR-BI-1-R: 5'-TAGGACTTGCGCTTCCAGTA-3'(Seq_52)

[0202] qPCR-BI-2-F: 5'-TCCGTCGTCGTCTCCTTCTA-3'(Seq_53)

[0203] qPCR-BI-2-R: 5'-GCGTGTCCACCAGGATGTAG-3'(Seq_54)

[0204] Uv-βtubulin-F: 5'-GGCGTTTACAATGGCACTTC-3'(Seq_55)

[0205] Uv-βtubulin-R: 5'-CGGAACAGTTGACCAAAAGG-3'(Seq_56)

[0206] The CFX96 real-time fluorescence quantitative PCR detection system was used for qRT-PCR to detect gene expression.

[0207] The qRT-PCR system and procedure are as follows.

[0208] qRT-PCR system (20 μL): 2×Sybr Green qPCR Mix 10 μL, cDNA 4 μL, forward primer 1 μL, reverse primer 1 μL, ddH2 O 4 μL. The qRT-PCR reaction program was: 95°C, 3 minutes; 95°C, 20 seconds, 58°C, 20 seconds, 72°C, 20 seconds, 40 cycles; 72°C, 5 minutes; 16°C, 10 minutes.

[0209] The expression level of the target gene in the fungus was determined by qRT-PCR, with the β-tubulin gene (UV8b_05680) of U. oryzae var. oryzae as the internal reference gene and the wild-type strain JS60-2 of U. oryzae var. oryzae as the control. -ΔΔCT The relative gene expression was calculated by inspection method, and the results were analyzed by corresponding software CFX Manager Software. The experiment was repeated 3 times, and 3 replicates were set for each independent experiment. The difference significance analysis was performed by SPSS26.0 software, and the mean and standard deviation were calculated using the data from three biological replicates to screen out the most efficient silencing fragments of each target gene.

[0210] Figure 3 The results of gene expression determination in transformants of each target gene fragment are shown in Table 1. Error bars represent standard deviations, “*” represents significant differences (P<0.05), “**” represents significant differences (P<0.01), and “ns” represents no significant differences. Figure 3 A represents the expression level determination of UvCYP51 in the four gene fragment transformants of UvCYP51-RNAi. Figure 3 B shows the expression level determination of UvbZIP11 in the four gene fragment transformants of UvbZIP11-RNAi. Figure 3 C represents the expression level of UvBI-1 in the transformants of the two gene fragments of UvBI-1-RNAi.

[0211] In order to verify the phenotype of the transformants of the highly efficient fragments screened out, phenotype observations were performed according to the characteristics of the corresponding genes. Two silencing transformants produced by the fragment with the highest silencing efficiency were selected for phenotypic analysis. Figure 4 The results of phenotype verification of transformants corresponding to the highly efficient silencing fragments of UvCYP51, UvbZIP11 and UvBI-1.

[0212] In order to determine the inhibition rate of the UvCYP51 gene fragment, the activated wild-type strain and the two silent transformants of the UvCYP51 gene fragment UvCYP51-3 were punched on the edge of the bacterial cake with a 3mm puncher, and the bacterial cakes with the same growth conditions were inoculated on PSA medium without tebuconazole and PSA medium containing 0.1μg / mL triazole fungicide tebuconazole, and 3 replicates were set up for each treatment. The culture dish was placed in a 27℃ constant temperature incubator in the dark for 14 days, and the colony morphology was observed. The colony size was measured using the cross method and photographed and recorded. Figure 4A is a colony photograph of the tebuconazole resistance phenotype determination of UvCYP51-3-RNAi silencing transformants.

[0213] The colony diameters of the wild-type strain JS60-2, two UvCYP51-3-RNAi silenced transformants UvCYP51-3-1-RNAi, and UvCYP51-3-2-RNAi grown on PSA medium without tebuconazole or PSA medium containing 0.1 μg / mL tebuconazole for 14 days were determined by the cross method. The colony diameter grown on PSA medium without tebuconazole for 14 days was the control colony diameter, and the colony diameter grown on PSA medium containing 0.1 μg / mL tebuconazole for 14 days was the treated colony diameter.

[0214] The mycelial growth inhibition rate grown on PSA medium containing 0.1 μg / mL tebuconazole for 14 days was calculated by colony diameter to verify the silencing efficiency of the corresponding fragment of the transformant.

[0215] The calculation formula of mycelium growth inhibition rate is as follows:

[0216] Mycelium growth inhibition rate = (control colony diameter - treated colony diameter) / (control colony diameter - bacterial cake diameter) (Formula 1)

[0217] Figure 4 B is the statistical analysis results of tebuconazole resistance of UvCYP51-3-1-RNAi and UvCYP51-3-2-RNAi silencing transformants. SPSS26.0 software was used to perform one-way analysis of variance on the data (P=0.05), error bars represent standard deviations, and "*" represents significant differences (P<0.05).

[0218] In order to determine the growth rate, after activating the two silent transformants of UvbZIP11-4, a 3mm punch was used to punch holes on the edge of the bacterial cake, and the bacterial cakes with consistent growth conditions were inoculated on PSA or PDA medium, with 3 replicates for each strain and each medium. The culture dish was placed in a 27°C constant temperature incubator and cultured in the dark for 14 days. The colony morphology was observed, and the colony size was measured by the cross method and photographed and recorded. Figure 4 C is a photograph of the colony morphology of two UvbZIP11-4-RNAi silencing transformants, UvbZIP11-4-1-RNAi and UvbZIP11-4-2-RNAi, cultured on PSA and PDA culture media for 14 days. Figure 4 D is the statistical analysis result of colony diameter of UvbZIP11-4-1-RNAi and UvbZIP11-4-2-RNAi silencing transformants. SPSS26.0 software was used to perform one-way ANOVA on the data (P=0.05) to verify the silencing efficiency of the corresponding fragment of the transformant. The error bars represent the standard deviation, and "*" represents a significant difference (P<0.05).

[0219] In order to determine the growth rate, after activating the two transformants of UvBI-1-2, a 3mm punch was used to punch holes on the edge of the bacterial cake, and the bacterial cakes with the same growth conditions were inoculated on PSA or PDA medium, with 3 replicates for each strain and each medium. The culture dish was placed in a 27°C constant temperature incubator and cultured in the dark for 14 days. The colony morphology was observed, and the colony size was measured by the cross method and photographed and recorded. Figure 4 E is a photograph of the colony morphology of two UvBI-1-2-RNAi silencing transformants, UvBI-1-2-1-RNAi and UvBI-1-2-2-RNAi, cultured on PSA or PDA medium for 14 days. Figure 4 F is the statistical analysis result of colony diameter of UvBI-1-2-1-RNAi and UvBI-1-2-2-RNAi silencing transformants. SPSS26.0 software was used to perform one-way ANOVA (P=0.05) on the data to verify the silencing efficiency of the corresponding fragment of the transformant. The error bars represent the standard deviation, and "*" represents a significant difference (P<0.05).

[0220] Example 4. dsRNA-related expression vectors, recombinant bacteria, and induced expression and purification

[0221] As a dsRNA expression vector plasmid, the L4440 vector plasmid has the characteristics of containing reverse T7 polymerase promoters at both ends of the multiple cloning site, and the size of the vector is about 2800bp. Using the primers of each gene efficient silencing fragment, the UvCYP51, UvbZIP11 and UvBI-1 gene efficient silencing fragments screened in the early stage of the experiment were taken in series by overlapping PCR to obtain the CYP-bZIP-BI chimeric DNA fragment.

[0222] The primers used in this example are shown in Table 2.

[0223] Table 2. Primers for constructing L4440-CYP-bZIP-BI gene fragment expression vector

[0224] Primer name Purpose overlap-CYP-bZIP-F Connecting CYP51 and bZIP11 fragments overlap-CYP-bZIP-R Connecting CYP51 and bZIP11 fragments overlap-bZIP-BI-F Ligation of bZIP11 and BI-1 fragments overlap-bZIP-BI-R Ligation of bZIP11 and BI-1 fragments Xba-CbB-F Cloning of CYP-bZIP-BI fragment into L4440 vector plasmid Xho-CbB-R Cloning of CYP-bZIP-BI fragment into L4440 vector plasmid

[0225] The primer sequences used in this example are as follows:

[0226] overlap-CYP-bZIP-F:

[0227] 5'-CCTGGCACCAAGTATGTCACCCCCAGCTGTTCGGCGAC-3'(Seq_57)

[0228] overlap-CYP-bZIP-R:

[0229] 5'-GTCGCCGAACAGCTGGGGGTGACATACTTGGTGCCAGG-3'(Seq_58)

[0230] overlap-bZIP-BI-F:

[0231] 5'-GCCCGCGCCCAAGAAGAGCCTGTCGCTCTTCACCTTTG-3'(Seq_59)

[0232] overlap-bZIP-BI-R:

[0233] 5'-CAAAGGTGAAGAGCGACAGGCTCTTCTTGGGCGCGGGC-3'(Seq_60)

[0234] Xba-CbB-F:

[0235] 5'-TCTAGACGACCTCCCTGCGCTCACATAC-3'(Seq_61)

[0236] Xho-CbB-R:

[0237] 5'-CTCGAGTAAAGTCGTACTTTGTCTGGCA-3'(Seq_62)

[0238] The sequence of the amplified chimeric DNA fragment between the XbaI and XhoI restriction sites is as follows:

[0239] 5'-CGACCTCCCTGCGCTCACATACGAAGACCTAGCCAAGCTGCCGCTGAGTCAGGC CATTGTCAAGGAAACTCTCCGAATGCACGCTCCCATCCACTCCATCATGCGAGCTGTCAAGCAGCCCATGCCGGTTCCTGGCACCAAGTATGTCACCCCCAGCTGTTCGGCGACTACCGAGAATCGCAGGAAAGCGTCCTCGCCGGCAACCCTTCCTTTGACGACTTTTTGCTCAGCGACGGGCTCGACGCCGACTTCTTCACG CCCTTCAACACCGCGACCGCGCCCGCGCCCGCGCCCAAGAAGAGCCTGTCGCTCTTCACCTTTGCCGAGGCCTACTCCATCTCCGTCGTCGTCTCCTTCTACCAGACAGCTGTTGTCCTCAACGGCAGTCGTCCTCACGGCCGGCATCTTCGTCTTCTTGACCCTTTTCGCCTGCCAGACAAAGTACGACTTTA-3'(Seq_63)

[0240] The size of the amplified chimeric DNA fragment including the restriction site sequence was 463 bp. Figure 5 A is the electrophoresis image of the amplified fragment of CYP-bZIP-BI chimera DNA.

[0241] The primer pair sequences used to construct the L4440-GFP vector are as follows:

[0242] Xba-GFP-F:

[0243] 5'-CCGCTCTAGAAGCCGCTACCCCGACCACAT-3'(Seq_64)

[0244] Xho-GFP-R:

[0245] 5'-CTCGAGGGGGCTTGTACAGCTCGTCCATGC-3'(Seq_65)

[0246] The amplified CYP-bZIP-BI chimeric DNA fragment and the amplified GFP DNA fragment were inserted between the XbaI and XhoI restriction sites of the L4440 linear vector after double restriction digestion to construct the dsRNA expression vector plasmid of the CYP-bZIP-BI fragment and the GFP fragment.

[0247] The constructed L4440-CYP-bZIP-BI dsRNA expression vector plasmid and L4440-GFP dsRNA expression vector plasmid were transformed into Escherichia coli HT115 (DE3) competent cells to construct L4440-CYP-bZIP-BI-HT115 (DE3) recombinant bacteria and L4440-GFP-HT115 (DE3) recombinant bacteria.

[0248] The transformation method of Escherichia coli HT115 (DE3) is as follows: take out the competent cells of Escherichia coli HT115 (DE3) from -80℃, quickly insert them into ice, wait for the bacterial block to melt after 5 minutes, add the L4440 recombinant plasmid and gently mix it by hand on the bottom of the Eppendorf centrifuge tube, and let it stand in ice for 25 minutes; heat shock in a 42℃ water bath for 45 seconds, quickly put it back in ice and let it stand for 2 minutes; add 700μl LB culture medium without antibiotics to the centrifuge tube, and resuscitate at 37℃ and 200r / min for 1 hour; collect the bacteria by centrifugation at 5000r / min for 1 minute, retain about 50μl of supernatant, gently blow to resuspend the bacterial block and spread it on an LB (15μg / mL Amp+20μg / mL Tet) solid plate; place the plate upside down in a 37℃ incubator for overnight culture.

[0249] After transformation into Escherichia coli HT115 (DE3) competent cells, the CYP-bZIP-BI chimera of isolated colonies was verified by PCR using primers Xba-CbB-F and L4440-YZ-R.

[0250] The sequences of the primer pairs for PCR verification are as follows:

[0251] Xba-CbB-F: 5'-TCTAGACGACCTCCCTGCGCTCACATAC-3'(Seq_61)

[0252] L4440-YZ-R:5'-GTAAAACGACGGCCAGT-3'(Seq_66)

[0253] Use a 10μl pipette tip to pick up an appropriate amount of single colonies and put them into the PCR reaction solution. Repeatedly pipette and mix well, and use them as templates for PCR.

[0254] Verification. PCR Mix used PCR Master Mix(With Dye). PCR system (50μL): PCR Master Mix 25μL, forward primer 2.5μL, reverse primer 2.5μL, appropriate amount of template, ddH 2O 18 μL. PCR reaction program: 95°C, 2 minutes; 95°C, 10 seconds, 58°C, 20 seconds, 72°C, 1 minute, 35 cycles; 72°C, 2.5 minutes; 16°C, 1 minute.

[0255] The amplified CYP-bZIP-BI chimeric DNA fragment was 531 bp and was detected by agarose gel electrophoresis. Figure 5 As shown in B, the selected single colony contains the target plasmid, and the fragment size is in line with expectations. The verified positive strains were stored at -70°C. One of the positive colonies was selected for dsRNA induction.

[0256] In order to induce the recombinant bacteria to produce CYP-bZIP-BI chimeric dsRNA, take 10μL of L4440-CYP-bZIP-BI-HT115 (DE3) recombinant bacterial solution and 10μL of L4440-GFP-HT115 (DE3) bacterial solution as a control, add them to 10mL liquid LB medium (20μg / mL Amp + 10μg / mL Tet), and shake and culture overnight at 37°C and 200r / min. Take 1mL of the shaking culture solution and add it to 100mL of liquid LB medium, shake and culture for about 2.5 hours to an OD value of 0.4-0.5. Add 400μL of freshly prepared 100mM IPTG to each 100mL of bacterial solution, and continue shaking and culturing for 6 hours. Use a 50mL centrifuge tube and centrifuge at 10°C and 10000r / min for 2 minutes to collect the bacteria. Add 4 mL of 75% ethanol-PBS to the collected cells of each 100 mL of bacterial liquid, and mix them by ultrasonic. After mixing, let it stand for 5 minutes, centrifuge at 10000 r / min for 10 minutes, discard the waste liquid, and collect the cells. Add 1 mL of 150 mM NaCl solution to the collected cells of each 100 mL of bacterial liquid, mix, let it stand for 1 hour, centrifuge at 10000 r / min for 10 minutes, and aspirate the supernatant into an RNase-free centrifuge tube to obtain a crude bacterial total RNA extract.

[0257] In order to purify dsRNA, DNase I and RNase A are mixed in proportion (1μL DNase I + 24μL 200-fold diluted RNase A), and 25μL of the mixed enzyme is added to 500μL of crude extract. Place the centrifuge tube in a 37°C incubator for 30 minutes. Add an equal volume of isopropanol to 500μL of the enzymatically hydrolyzed sample, mix it upside down, and let it stand for 10 minutes. Centrifuge at 4°C and 10000r / min for 15 minutes, and discard the waste liquid. Add 1mL of 75% ethanol prepared with DEPC-treated water to wash the precipitate, centrifuge at 4°C and 10000r / min for 10 minutes, discard the supernatant, and air-dry for 5 minutes. Add 400μL RNase-free water (DEPC-treated water) to dissolve, obtain a dsRNA solution, and store it at -70°C.

[0258] The electrophoresis images of CYP-bZIP-BI chimera dsRNA and GFP dsRNA were shown in Figure 2. Figure 6 As shown, the electrophoresis fragment of the chimeric dsRNA is about 600 bp, which is consistent with the designed 581 bp dsRNA fragment size.

[0259] Example 5: Effect of chimeric dsRNA on the pathogenicity of U.S. smut fungus

[0260] The chimeric dsRNA solution was used to treat rice and the rice variety (Wanxian-98) susceptible to U. oryzae oryzae was used for inoculation.

[0261] The wild-type strain JS60-2 of U. oryzae var. oryzae was placed in PSB medium and cultured at 27°C and 160 r / min for 7 days. The cultured bacterial liquid was broken. The conidia concentration was adjusted to 5×10 6 Pieces / mL.

[0262] In the late booting stage (3 to 5 days before heading), the purified CYP-bZIP-BI chimera dsRNA solution was diluted to 100 ng / μL dsRNA, and 2 mL per ear was injected into the upper part of the rice ear to allow it to flow down naturally and penetrate into the rice ear.

[0263] 12 hours after the injection of the dsRNA solution, the conidia suspension of U. oryzae oryzae was inoculated. About 5 mL of the PSB suspension of conidia and mycelium was injected into a single rice panicle using a syringe, and the inoculation point was the dsRNA treatment site.

[0264] The plants inoculated with U.S. smut were placed in a greenhouse at 27°C and a relative humidity of 90% to 100%. Total RNA from the panicles was extracted 48 hours after inoculation with U.S. smut, and qRT-PCR was performed after reverse transcription. Figure 7 A represents the results of the target gene expression measurement in the rice smut fungus after the chimera dsRNA was used to treat rice. SPSS26.0 software was used to perform a one-way analysis of variance on the number of rice smut balls (P=0.05), the error bars represent the standard deviation, and "***" represents a very significant difference (P<0.001). The expression levels of the target genes UvCYP51, UvbZIP11, and UvBI-1 in the CYP-bZIP-BI chimera dsRNA treatment group were significantly reduced, proving that the CYP-bZIP-BI chimera dsRNA of the present invention significantly inhibited the expression of the target genes compared to the GFP-dsRNA control group.

[0265] Plants inoculated with U. oryzae were placed in a greenhouse at 27°C and a relative humidity of 90% to 100% for 7 days, and then placed in an environment at 27°C and a relative humidity of 80% until rice spherical balls appeared. At least 8 ears were inoculated for each treatment, and the experiment was repeated 3 times independently. Symptoms were observed, and photos were taken 21 days after inoculation and the number of rice spherical balls was counted. Figure 7 B is a photograph of the disease resistance test results after dsRNA treatment of rice panicles. Figure 7 C represents the results of disease resistance analysis after dsRNA treatment of rice panicles. SPSS26.0 software was used to perform one-way analysis of variance on the number of rice spur balls (P=0.05), and the error bars represent standard deviations, "***" represents a very significant difference (P<0.001), and "ns" represents no significant difference. Compared with the control group without treatment and GFP-dsRNA treatment, the number of rice spur balls was significantly reduced after the CYP-bZIP-BI chimera dsRNA of the present invention was treated with rice, indicating that the CYP-bZIP-BI chimera dsRNA can significantly inhibit rice spur disease.

Claims

1. A chimeric dsRNA comprising: The highly efficient silencing fragments are in the UvCYP51 gene of cytochrome P450 sterol 14α-demethylase of U.S. pyrrhotite, the UvbZIP11 gene of transcription factor of U.S. pyrrhotite, and the UvBI-1 gene of apoptosis-related gene of U.S. pyrrhotite.

2. The chimeric dsRNA according to claim 1, characterized in that: The chimeric dsRNA is approximately 600 bp in size.

3. The chimeric dsRNA according to claim 2, characterized in that: The chimeric dsRNA is transcribed from a DNA comprising the sequence shown in Seq_63.

4. The method for preparing the chimeric dsRNA according to any one of claims 1 to 3, comprising the following steps: 1) Clone the UvCYP51 gene fragment, the UvbZIP11 gene fragment and the UvBI-1 gene fragment of the U.S. smut pathogen into a silencing expression vector plasmid to obtain a silencing expression vector plasmid of the target gene fragment; 2) transforming the silencing expression vector plasmid of the target gene fragment into the protoplasts of the U.S. smut fungus to obtain transformants; 3) culturing transformants, determining the expression levels of each target gene of U.S. smut pathogen in the transformants, and screening highly efficient silencing fragments of each target gene; 4) connecting the highly efficient silencing fragment of the UvCYP51 gene of the U.S. smut pathogen, the highly efficient silencing fragment of the UvbZIP11 gene of the U.S. smut pathogen, and the highly efficient silencing fragment of the UvBI-1 gene of the U.S. smut pathogen to prepare a chimeric DNA; 5) cloning the chimeric DNA into a dsRNA expression vector plasmid to obtain a chimeric dsRNA expression vector plasmid; 6) Transforming the chimeric dsRNA expression vector plasmid into competent cells to obtain recombinant bacteria; 7) Cultivating the recombinant bacteria, extracting and purifying the dsRNA, and obtaining the chimeric dsRNA.

5. The method for preparing chimeric dsRNA according to claim 4, characterized in that: The silencing expression vector plasmid in step 1) is a pSilent-1 vector plasmid, the dsRNA expression vector plasmid in step 5) is a L4440 vector plasmid, and the competent cells in step 6) are Escherichia coli HT115 (DE3) competent cells. 6 . The method for using the chimeric dsRNA according to claim 1 , comprising injecting the chimeric dsRNA into rice panicles.

7. The method for using the chimeric dsRNA according to claim 6, characterized in that: The chimeric dsRNA was used at a concentration of 100 ng / μl.

8. Use of the chimeric dsRNA according to any one of claims 1 to 3 in controlling rice false smut.

9. Use of the chimeric dsRNA according to any one of claims 1 to 3 in the preparation of nucleic acid pesticides.

10. A nucleic acid pesticide comprising the chimeric dsRNA according to any one of claims 1 to 3 and a pesticide adjuvant.

11. The nucleic acid pesticide according to claim 10, characterized in that: The pesticide adjuvants include dispersants, emulsifiers, solvents, carriers, fillers, stabilizers, controlled release adjuvants, synergists, wetting agents, penetrants, spreaders, adhesives, safeners, antidotes, defoamers and / or warning colors.

12. The method for using the nucleic acid pesticide according to claim 10 or 11, comprising injecting the nucleic acid pesticide into rice ears.

13. The method for using the nucleic acid pesticide according to claim 12, characterized in that: The chimeric dsRNA in the nucleic acid pesticide is used at a concentration of 100 ng / μl.

14. Use of the nucleic acid pesticide according to claim 10 or 11 in the prevention and treatment of rice false smut.

15. A method for preparing a chimeric dsRNA nucleic acid pesticide, comprising the following steps: 1) Select several genes related to pathogenicity in the genome of crop pathogens; 2) Clone the pathogenicity-related gene fragment into a silencing expression vector plasmid to obtain a silencing expression vector plasmid of the target gene fragment; 3) Transforming the silencing expression vector plasmid of the target gene fragment into the protoplasts of crop pathogenic bacteria to obtain transformants; 4) Cultivating transformants, determining the expression levels of target genes of pathogenic bacteria in the transformants, and screening highly efficient silencing fragments of target genes related to pathogenicity; 5) Connect the efficient silencing fragments of different target genes related to pathogenicity to prepare chimeric DNA; 6) cloning the chimeric DNA into a dsRNA expression vector plasmid to obtain a chimeric dsRNA expression vector plasmid; 7) Transforming the chimeric dsRNA expression vector plasmid into competent cells to obtain recombinant bacteria; 8) Cultivating the recombinant bacteria, extracting and purifying the dsRNA, and obtaining the chimeric dsRNA; 9) Formulate chimeric dsRNA into nucleic acid pesticides.

16. The method for preparing the chimeric dsRNA nucleic acid pesticide according to claim 15, characterized in that: The silencing expression vector plasmid in step 2) is a pSilent-1 vector plasmid, the dsRNA expression vector plasmid in step 6) is a L4440 vector plasmid, and the competent cells in step 7) are Escherichia coli HT115 (DE3) competent cells.

17. The method for preparing the chimeric dsRNA nucleic acid pesticide according to claim 15 or 16, characterized in that: The chimeric dsRNA is approximately 600 bp in size.

Images