Bifidobacterium lactis recombinant bacterium for expressing arsenic transcription factor related gene as well as construction method and application of bifidobacterium lactis recombinant bacterium

Abstract

The invention discloses bifidobacterium lactis recombinant bacteria for expressing arsenic transcription factor related genes as well as a construction method and application of the bifidobacterium lactis recombinant bacteria. The construction method of the recombinant bacterium comprises the following steps: (1) adding a signal peptide amyB, a terminator ter and enzyme cutting sites BamH I and Sal I on the basis of a plasmid pKO403lacZcm, so as to obtain a recombinant vector pKO403-amyB-ter; (2) connecting an arsR or arsB gene segment to a recombinant vector pKO403-amyB-ter, so as to obtain a recombinant plasmid; and (3) electrically transferring the recombinant plasmid into bifidobacterium lactis competent cells, and screening to obtain bifidobacterium lactis recombinant bacteria. The recombinant bifidobacterium lactis constructed by the method is not influenced by As (III), has high As (III) conversion efficiency, and can be used for treating arsenic pollution.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to a recombinant bacterium of Bifidobacterium lactis expressing an arsenic transcription factor-related gene, and a construction method and application thereof. Background Art

[0002] Arsenic (As) is a common toxic substance in the environment. Trivalent arsenic (As(III)) is more harmful to humans and nature due to its higher toxicity and mobility. The treatment of arsenic pollution mainly relies on traditional physical and chemical methods and biological methods. Among them, traditional methods such as adsorption, precipitation, and chemical agents have high economic costs and are prone to secondary pollution. Among biological methods, plant remediation has the disadvantage of not being able to be applied to large-scale pollution. Therefore, the remediation of arsenic pollution through microorganisms is efficient, low in economic cost, and not prone to secondary pollution. It is currently the key research method for treating arsenic pollution and has broad application prospects.

[0003] There are four different systems for microbial arsenic transformation, all of which are controlled by operons or genes. Arsenic resistance ( art Arsenic detoxification involving the ) system is the most widely studied and applied, among which arsR The gene encoding ArsR can negatively regulate itself and other art Operons play a key role in multiple arsenic detoxification mechanisms. artB The genetically encoded arsenite efflux permease ArsB is a membrane transport protein that functions as an arsenite transport channel. It can use membrane potential to catalyze the excretion of As(III) from the cell, and can also act as an arsenite efflux pump to promote the transport of As(III).

[0004] As an important probiotic in the human and animal intestines, bifidobacteria not only have a positive intervention effect on diseases, but also show strong antioxidant and anti-toxic activity, which can convert heavy metals from more toxic forms to less toxic forms, thereby achieving detoxification. However, due to the limitations of the activity-limited modification system and the thickness of the Gram-positive bacterial envelope, the difficulty of bifidobacterium transformation is greatly increased. At present, the effect of bifidobacteria on arsenic transformation is still unclear, and it is impossible to provide an accurate and effective scientific basis for the application of microorganisms in the treatment of environmental arsenic pollution. Summary of the invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a method for constructing a recombinant strain of Bifidobacterium lactis that expresses an arsenic transcription factor-related gene.

[0006] Another object of the present invention is to provide a recombinant strain of Bifidobacterium lactis expressing an arsenic transcription factor-related gene constructed by the method.

[0007] Another object of the present invention is to provide the application of the recombinant Bifidobacterium lactis expressing the arsenic transcription factor-related gene.

[0008] The purpose of the present invention is achieved through the following technical solutions: A method for constructing a recombinant strain of Bifidobacterium lactis expressing an arsenic transcription factor-related gene comprises the following steps: (1) Vector construction: Connect the signal peptide amyB and terminator ter fragment to the BamH I and Salt I double-digested vector pKO403_lacZ_cm to obtain the recombinant plasmid pKO403-amyB-ter; then the recombinant plasmid pKO403-amyB-ter was BamH Ⅰ. Salt Ⅰ double enzyme digestion to obtain the linearized vector pKO403-amyB-ter; wherein the nucleotide sequence of the signal peptide amyB is shown in SEQ ID NO.3, and the nucleotide sequence of the terminator ter fragment is shown in SEQ ID NO.4; (2) Construction of episomal expression plasmid: arsR or artB The gene fragment is connected to the linearized vector pKO403-amyB-ter obtained in step (1) to obtain recombinant plasmids pKO403-amyB-arsR-ter and pKO403-amyB-arsB-ter; wherein, arsR The nucleotide sequence of the gene fragment is shown in SEQ ID NO.1. artB The nucleotide sequence of the gene fragment is shown in SEQ ID NO.2; (3) Construction of recombinant bacteria: The recombinant plasmid pKO403-amyB-arsR-ter or pKO403-amyB-arsB-ter was electroporated into competent cells of Bifidobacterium lactis. The recombinant Bifidobacterium lactis (HN019-arsR or HN019-arsB) was obtained through chloramphenicol resistance screening and transformant verification.

[0009] In step (1), the signal peptide amyB can be synthesized artificially or obtained from Bifidobacterium adolescentis B. adolescent Amplified from the i01-0019-E5 genome.

[0010] In step (1), the terminator ter fragment can be synthesized artificially or obtained from Bifidobacterium longum B. long The gene was amplified from the JSRL02 genome.

[0011] In step (2), arsR The gene is a gene encoding an arsenic transcription factor ( arsR 318), which can be synthesized artificially or from Bacillus subtilis Bacillus subtilis Amplified from the ATCC6051 genome.

[0012] In step (2), artB The gene is a gene encoding arsenite efflux permease ( artB 1041 ), which can be synthesized artificially or from Bacillus subtilis Bacillus subtilis Amplified from the ATCC6051 genome.

[0013] The ligation described in step (2) is performed using the one-step ligation method using the OK Clon DNA ligation kit.

[0014] The Bifidobacterium lactis described in step (3) is Bifidobacterium lactis Bifidobacteirumanimalis subsp. Milk ; preferably Bifidobacterium lactis Bifidobacterium animalis subsp. Lactis HN019.

[0015] The concentration of chloramphenicol in the chloramphenicol resistance screening described in step (3) is 20 μg / mL.

[0016] The transformant verification described in step (3) is performed by PCR.

[0017] A recombinant strain of Bifidobacterium lactis expressing an arsenic transcription factor-related gene is prepared by any of the methods described above.

[0018] The application of the recombinant Bifidobacterium lactis expressing the arsenic transcription factor-related gene in removing or reducing the arsenic content in the environment (treating environmental arsenic pollution).

[0019] The environment includes water environment, soil environment and the like.

[0020] The application of the recombinant Bifidobacterium lactis expressing arsenic transcription factor related genes in As(III) transformation.

[0021] The As(III) conversion includes the conversion of As(III) in food or crops to remove or reduce the As(III) content in food or crops.

[0022] The application of the recombinant Bifidobacterium lactis expressing the arsenic transcription factor-related gene in As(III) conversion comprises the following specific steps: (I) inoculating the above-mentioned recombinant Bifidobacterium lactis into a liquid seed culture medium for culturing to obtain a seed liquid; (II) The seed solution is inoculated into a fermentation medium containing As(III) and co-cultivated to convert the As(III) in the fermentation medium.

[0023] The culture conditions in step (I) are as follows: anaerobic static culture at 37±1°C until OD 600 The value is approximately 1.8 to 2.0.

[0024] The inoculation amount of the seed solution in step (II) is 1% to 5% of the volume of the fermentation system; preferably 2% of the volume of the fermentation system.

[0025] The concentration of As(III) in the fermentation medium containing As(III) in step (II) is 5-15 mg / L, preferably 5 mg / L.

[0026] The formula of the fermentation medium in step (II) is: MRS broth medium + 1 g / L cysteine ​​+ 30 g / L glucose.

[0027] The co-cultivation time in step (II) is 0 to 132 h (excluding 0), preferably 30 to 48 h.

[0028] Compared with the prior art, the present invention has the following advantages and effects: 1. The present invention is the first to use Bifidobacterium lactis B.animalis HN019 was the starting strain, and the gene amplified from Bacillus subtilis ATCC6051 was arsR and artB , replaced into the recombinant plasmid pKO403-amyB-ter preserved in our laboratory, which has a signal peptide added to the expression plasmid pKO403_lacZ_cm AmyB , terminator ter and restriction site BamH I and Salt I, get available for arsR , artB The recombinant plasmid pKO403-amyB-arsR / arsB-ter for episomal expression of genes. The recombinant plasmid was introduced into the electroporation competent cells of Bifidobacterium lactis HN019 and verified, and the episomal expression strains HN019-arsR and HN019-arsB were successfully obtained.

[0029] 2. The present invention co-cultures recombinant bifidobacteria (HN019-arsR and HN019-arsB) with As(Ⅲ). By measuring the growth and evaluating the arsenic conversion effect, it is found that the growth of bifidobacteria is not affected by As(Ⅲ), and the conversion effect of recombinant bifidobacteria on As(Ⅲ) is better than that of original bifidobacteria. When co-cultured for 132 hours, the conversion rate of As(Ⅲ) in the extracellular space of Bifidobacterium lactis HN019 is 78.1%, the conversion rate of As(Ⅲ) by HN019-arsB is 87.9%, and the conversion rate of As(Ⅲ) by HN019-arsR is 86.3%, and more than half of As(Ⅲ) can be converted when co-cultured for 30 hours.

[0030] 3. The present invention provides two recombinant strains of Bifidobacterium lactis that express an arsenic transcription factor and an arsenite efflux permease, respectively, and provides a reference for the conversion effect of the recombinant bacteria on As(III), thereby providing a certain theoretical basis for the transformation of Bifidobacterium strains and their application in the treatment of arsenic pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is a schematic diagram of the construction process of two free expression plasmids in Example 1.

[0032] Figure 2 is the electrophoresis diagram of the construction and verification of pKO403-amyB-arsR-ter and pKO403-amyB-arsB-ter plasmids in Example 1 (M1: DL2000 DNA ladder; M2: 200 bp DNA ladder); wherein A is arsR Gene PCR amplification product (lane 1); B is artB Gene PCR amplification product (lane 2); C is the double restriction enzyme digestion product of pKO403-amyB-ter plasmid (lane 3); D is the PCR amplification product of pKO403-amyB-arsR-ter transformant colony (lane 4) and arsR Gene verification fragment (lane 5); E is the PCR amplification product of pKO403-amyB-arsB-ter transformant colony (lane 6) and artB Gene verification fragment (lane 7).

[0033] Figure 3 is the PCR electrophoresis of the two recombinant bacterial electrotransformant colonies in Example 2 (M: DL2000 DNA ladder); wherein A is the PCR amplification product of the HN019-arsB transformant colony (lane 1) and artB A is the gene verification fragment (lane 2); B is the PCR amplification product of the HN019-arsR transformant colony (lane 3) and arsR Gene verification fragment (lane 4).

[0034] Figure 4 This is a graph showing the growth of the two recombinant bacteria and the original bacteria in Example 3 when co-cultured with 5 mg / L As(III).

[0035] Figure 5 This is a diagram of the extracellular transformation of the two recombinant bacteria and the original bacteria co-cultured with 5 mg / L As(III) in Example 4. DETAILED DESCRIPTION

[0036] The present invention will be described in further detail below in conjunction with the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. The test methods for which specific experimental conditions are not specified in the following examples are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0037] Bifidobacterium adolescentis involved in the embodiments of the present invention B. adolescent The sequence information of i01-0019-E5 was obtained from the NCBI database (Sequence ID: AP031418.1); Bifidobacterium longum B. longum JSRL02 was purchased from ATCC strain library; Bifidobacterium lactis Bifidobacterium animalis subsp. Lactis HN019 was purchased from Shanghai Collection Biotechnology Center; Bacillus subtilis Bacillus subtilis ATCC6051 was purchased from ATCC strain bank.

[0038] The expression plasmid pKO403_lacZ_cm involved in the examples of the present invention was purchased from Addgene (Cat. No. 174725).

[0039] Example 1: Construction of recombinant plasmid The specific steps for constructing the recombinant plasmid are as follows (see the construction process for details). Figure 1 ): (1) First, the expression plasmid pKO403_lacZ_cm was modified by synthesizing the signal peptide amyB and terminator ter fragments by the company. The two element sequences are derived from Bifidobacterium adolescentis B. adolescent i01-0019-E5 and Bifidobacterium longum B. longum JSRL02. The two sequence fragments are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively. The two fragments were connected with the plasmid pKO403_lacZ_cm to construct the expression plasmid pKO403-amyB-ter, which can be BamH I and SaltI double enzyme digestion to replace the gene to be expressed. The plasmid pKO403-amyB-ter was streaked on an LB plate containing chloramphenicol resistance and expanded in liquid LB medium. The plasmid was extracted using the HiPure Plasmid Micro Kit from Guangzhou Meiji Biotechnology Co., Ltd. Using the plasmid DNA as a template, BamH Ⅰ. Salt Ⅰ Double restriction enzyme digestion to obtain the linearized vector pKO403-amyB-ter.

[0040] Signal peptide amyB (SEQ ID NO.3): ATGAAACATCGGAAACCCGCACCGGCCTGGCATAGGCTGGGGCTGAAGATTAGCAAGAAAGTGGTGGTCGGCATCACCGCCGCGGCGACCGCCTTCGGCGGACTGGCAATCGCCAGCACCGCAGCACAGGCCAGC; Terminator ter fragment (SEQ ID NO.4): ACAGAAGCCCCGACCCCAACGGTCGGGGCTTCTTTCGTTTGTT.

[0041] (2) Bacillus subtilis B. subtilis ATCC6051 was streaked and revived on LB plates and cultured at 37 °C for 16-24 h. A single colony was picked and cultured in 20 mL LB liquid culture medium (37 °C, 200 rpm) for 16-24 h. The genome was extracted using the HiPure Gel Pure Micro Kit. The genome was used as a template and PCR amplification was performed using primers F-arsR and R-arsR, as well as F-arsB and R-arsB, respectively. DNA fragments of 318 bp and 1041 bp were amplified, i.e. arsR and artB Gene fragment (SEQ ID NO.1, SEQ ID NO.2) ( Figure 2 ), which is consistent with the size of the target product. The primer sequences involved are as follows: F-arsR: 5'-GCAGCACAGGCCAGCggatccATGGATGAGACGAAATCAGAAC-3' (SEQ IDNO.5); R-arsR: 5'-GGTCGGGGCTCTGTgtcgacTTAGCAGCAATCTCCTTCACCT-3' (SEQ ID NO. 6); F-arsB: 5'-GCAGCACAGGCCAGCggatccATGAAACGTTTATCTTTTTTAGACC-3' (SEQ ID NO.7); R-arsB: 5'-GGTCGGGGCTTCTGTgtcgacCTACATCGAGTGACTTCCAAAGTAT-3' (SEQ ID NO.8).

[0042] arsR Gene fragment (SEQ ID NO.1): ATGGATGAGACGAAATCAGAACTGCTACGGAAATATGAACAAAAATTTAAGGCTCTTGCTGATCAGAAACGATTAGAGATCATGTATGAACTTTGTCAAAGGGGAAAAACCTGTGTTTGTGATCTGACTGAGATTTTTGAGGTGACGCAATCTAAACTTTCTTATCATCTAAAAATTTTATTGGATGCCAACTTAATAACGAAAGAGACAAAGGGAACATGGAGTTATTATGATCTAAATGATGAGGAAGTAAATGGTTTATTATCAGAAGAGCTTTGTTGTATATTTAGAAAAAAAGGTGAAGGAGATTGCTGCTAA; artB Gene fragment (SEQ ID NO.2):

[0043] (3) The linearized vector pKO403-amyB-ter obtained above was connected with the DNA ligation kit in one step. artB , arsR The gene fragment was cloned and transformed into competent E. coli cells. The transformants were verified, and the colonies correctly identified by sequencing results were picked and inoculated into liquid LB medium containing 20 μg / mL chloramphenicol, and cultured at 37 °C and 200 rpm for 16-24 h to obtain gene free expression plasmids pKO403-amyB-arsR-ter and pKO403-amyB-arsB-ter.

[0044] Example 2: Screening and identification of recombinant strains The expression plasmids pKO403-amyB-arsR-ter and pKO403-amyB-arsB-ter were electroporated into Bifidobacterium lactis B.animalis In HN019 competent cells, the voltage was 2.5 KV and the current was 4 mS. After PCR verification, the target recombinant strains HN019-arsR and HN019-arsB were confirmed ( Figure 3 ).

[0045] Example 3: Growth of recombinant bacteria and original bacteria co-cultured with trivalent arsenic The free expression strains HN019-arsR, HN019-arsB and the original strain Bifidobacterium lactis HN019 were inoculated into liquid seed culture medium (MRS broth medium) and cultured anaerobically at 37 °C until OD 600 The value was about 1.8; then the inoculum was inoculated with 2% (v / v) in the fermentation medium containing 5, 10, and 15 mg / L As(Ⅲ) (the As(Ⅲ) used was arsenite standard material purchased from Weiliangji Industry) and co-cultured for 132 h. The fermentation medium was MRS broth medium + 1 g / L cysteine ​​+ 30 g / L glucose. The blank group was directly cultured without As(Ⅲ). The fermentation broth was taken at 0, 6, 12, 15, 18, 24, 30, 36, 48, 60, 84, 108, and 132 h, respectively, and the fermentation broth was diluted 10 times with 1× phosphate buffer. 100 μL was taken in a quartz cuvette for testing. The blank control was PBS solution. The absorbance value (OD) of the diluted bacterial solution at a wavelength of 600 nm was measured. 600 ) was measured, OD 600 The value can reflect the bacterial cell density. After zeroing, the diluted bacterial solution to be tested is measured in turn. The experiment is repeated three times. The horizontal axis is time and the vertical axis is OD 600The growth curves were drawn to preliminarily determine the growth of different bifidobacteria when co-cultured with three concentrations of As(Ⅲ). Figure 4 The growth curve shows that the original strain HN019 had an OD of 0.134 when co-cultured with 5 mg / L As(Ⅲ) for 132 h. 600 The values ​​were 3.88 and the OD of the blank control group was 600 The value was 4.27. The OD of recombinant strains HN019-arsR and HN019-arsB 600 The values ​​were 3.51 and 3.61 respectively. In summary, Bifidobacterium lactis is arsenic-resistant. The recombinant strain grew slowly in the initial stage of culture and resumed normal growth after 18 h.

[0046] Example 4: Determination of trivalent arsenic and conversion effect Prepare standard curve: pipette 0.00 mL (blank), 1.25 mL, 2.5 mL, 3.75 mL, 5 mL, 6.25 mL, 7.5 mL of As(Ⅲ) standard solution (1 μg / mL) into six 50 mL volumetric flasks, add 6 mL of thiourea-ascorbic acid solution (5g thiourea, 5g ascorbic acid, pure water to prepare 100ml mixed solution), dilute to scale with 5% hydrochloric acid solution, shake well, and let stand for 30 min. The mass concentrations of As(Ⅲ) in this series of solutions are 0 μg / L, 25 μg / L, 50 μg / L, 75 μg / L, 100 μg / L, 125 μg / L, 150 μg / L. The standard blank is measured with carrier liquid. After the instrument was stabilized, sodium borohydride-sodium hydroxide solution (first prepare 0.5% (w / v) sodium hydroxide solution, then weigh 2.0g of sodium borohydride and dissolve it in 100mL of 0.5% (w / v) sodium hydroxide solution) was used as the reducing agent and 5% mass concentration hydrochloric acid solution was used as the carrier solution. The fluorescence value was measured under the optimal working conditions of the instrument, and a standard curve was drawn. The correlation coefficient was 0.9999, which met the national standard requirements.

[0047] Determination of trivalent arsenic content: The fermentation culture samples collected at different time points in Example 3 were centrifuged at 8000 r / min to obtain the supernatant, which was the extracellular fluid. Subsequently, the supernatant was diluted to 1 / 100 of the original volume using a phosphate buffer solution (PBS) with a pH value of 7.4 for the analysis of As(III). Use a pipette to measure an appropriate amount of sample (5-10 mL) in a 50 mL volumetric flask, add 6 mL of thiourea-ascorbic acid solution, dilute to the scale with hydrochloric acid, and shake well. At the same time, make a sample blank, leave it for 30 minutes, and then test it. Turn on the instrument before measurement and preheat it for more than 20 minutes. Set the instrument conditions: lamp current: 50 mA~80 mA; negative high voltage: 260 V; atomizer furnace height: 6 mm~8 mm; carrier gas (Ar) flow: 500 mL / min; shielding gas (Ar): 800 mL / min; reading time: 10 s; delay time: 0 s; measurement method: fluorescence intensity; degree method: peak area. Insert the injection tube into the sample to be tested, insert the reducing agent tube into the sodium borohydride solution, use the sodium borohydride-sodium hydroxide solution as the reducing agent, and use the hydrochloric acid solution as the carrier solution. Measure the fluorescence value of the sample under the optimal working conditions of the instrument, take the average of three measured values, and make a blank correction. The content of As(Ⅲ) can be checked from the calibration curve (refer to the national standard GB / T 39306-2020 and the industry standard HY / T152-2013).

[0048] When the original strain HN019 was co-cultured with 5 mg / L As(Ⅲ) for 132 h, the extracellular As(Ⅲ) conversion rate was 78.1%. The As(Ⅲ) conversion rates of the recombinant strains HN019-arsB and HN019-arsR were 87.9% and 86.3%, respectively. Arsenic conversion by Bifidobacterium mainly occurred in the first 48 h of culture, and the conversion effect was best at 30 h of co-culture. The extracellular As(Ⅲ) conversion rates of the free expression strains HN019-arsB and HN019-arsR were 54.1% and 58.1%, respectively. That is, at 30 h, the two recombinant strains could convert more than half of As(Ⅲ) ( Figure 5 ).

[0049] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for constructing a recombinant strain of Bifidobacterium lactis expressing an arsenic transcription factor-related gene, characterized in that: The steps include: (1) Vector construction: Connect the signal peptide amyB and terminator ter fragment to the Bm I and Sal I double-digested vector pKO403_lacZ_cm to obtain the recombinant plasmid pKO403-amyB-ter; then the recombinant plasmid pKO403-amyB-ter was Bm Ⅰ. Sal Ⅰ double enzyme digestion to obtain the linearized vector pKO403-amyB-ter; wherein the nucleotide sequence of the signal peptide amyB is shown in SEQ ID NO.3, and the nucleotide sequence of the terminator ter fragment is shown in SEQ ID NO.4; (2) Construction of episomal expression plasmid: arsR or arsB The gene fragment is connected to the linearized vector pKO403-amyB-ter obtained in step (1) to obtain recombinant plasmids pKO403-amyB-arsR-ter and pKO403-amyB-arsB-ter; wherein, arsR The nucleotide sequence of the gene fragment is shown in SEQ ID NO.

1. arsB The nucleotide sequence of the gene fragment is shown in SEQ ID NO.2; (3) Construction of recombinant bacteria: The recombinant plasmid pKO403-amyB-arsR-ter or pKO403-amyB-arsB-ter was electroporated into competent cells of Bifidobacterium lactis, and recombinant Bifidobacterium lactis was obtained through chloramphenicol resistance screening and transformant verification.

2. The method according to claim 1, characterized in that: The Bifidobacterium lactis described in step (3) is Bifidobacterium lactis Bifidobacteirum animalis subsp. Lactis HN019.

3. The method according to claim 1, characterized in that: The concentration of chloramphenicol in the chloramphenicol resistance screening described in step (3) is 20 μg / mL.

4. A recombinant strain of Bifidobacterium lactis expressing an arsenic transcription factor-related gene, characterized in that: It is prepared by the method according to any one of claims 1 to 3.

5. Use of the recombinant Bifidobacterium lactis expressing the arsenic transcription factor-related gene according to claim 4 in removing or reducing the arsenic content in the environment.

6. Use of the recombinant Bifidobacterium lactis expressing the arsenic transcription factor-related gene as claimed in claim 4 in As(III) conversion.

7. The use according to claim 6, characterized in that: The specific steps are as follows: (I) inoculating the recombinant Bifidobacterium lactis according to claim 4 into a liquid seed culture medium for culturing to obtain a seed liquid; (II) The seed solution is inoculated into a fermentation medium containing As(III) and co-cultivated to convert the As(III) in the fermentation medium.

8. The use according to claim 7, characterized in that: The concentration of As(III) in the fermentation medium containing As(III) in step (II) is 5 to 15 mg / L; The formula of the fermentation medium in step (II) is: MRS broth medium + 1 g / L cysteine ​​+ 30 g / L glucose.

9. The use according to claim 7, characterized in that: The culture conditions in step (I) are as follows: anaerobic static culture at 37±1°C until OD 600 Value is about 1.8 to 2.0; The inoculation amount of the seed solution in step (II) accounts for 1% to 5% of the volume of the fermentation system.

10. The use according to claim 7, characterized in that: The co-culture time in step (II) is 0 to 132 h, excluding 0.

Images