Application of KLF9 gene in heat stress resistance of chicken skeletal muscle
By interfering with or overexpressing the KLF9 gene, the problem of heat stress in chickens is solved, and methods are provided to detect and regulate KLF9 expression, which improves the heat resistance and immunity of chickens, simplifies the breeding process, and solves heat stress in chickens. Negative effects on health and productivity.
Patent Information
- Application Number
- CN202411724089.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-28
- Publication Date
- 2025-01-17
AI Technical Summary
Chickens are prone to heat stress in high-temperature environments, which affect their health, productivity and egg quality. It is difficult for the existing technology to effectively improve the chicken's heat resistance.
By interfering or overexpressing the KLF9 gene in chicken skeletal muscle tissue, KLF9 gene interference fragments, primer pairs and interference vectors are provided, and detection kits are constructed to detect and regulate the expression of KLF9 genes to improve the anti-thermal stress ability of chickens .
Provides a method to quickly judge the heat resistance level of chickens, simplifies the breeding process, and can quickly breed chickens with high heat resistance, improve the antioxidant ability and immunity of chickens, and reduce economic losses caused by heat stress. .
Smart Images
Figure CN119320829A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of bioengineering, and particularly relates to application of KLF9 gene in chicken skeletal muscle resistance to heat stress. Background Art
[0002] Chickens are warm-blooded animals, and the body temperature of adult individuals is maintained between 41-42°C. When the ambient temperature exceeds this temperature range, it may disrupt the dynamic balance of heat production and heat dissipation in the chicken's body, causing heat stress and affecting the health and production performance of poultry.
[0003] As the global climate warms, high temperatures in summer pose an increasingly serious threat to poultry farming. Heat stress is one of the main environmental stressors currently affecting poultry productivity and welfare in global intensive and intensified systems, and has a great negative impact on animal health, productivity and product quality. There is an inseparable role between poultry's body temperature, heat resistance and economy, and the three have a strong negative correlation.
[0004] Heat stress is a common problem in laying hens in summer in most parts of my country. Heat stress not only reduces the egg production rate of laying hens, reduces egg weight, increases the breakage rate, reduces the fertilization rate and hatching rate of breeding eggs, slows down growth and deteriorates meat quality, but also leads to a decrease in resistance and immunity and even mass death, causing huge economic losses. Therefore, the cultivation of heat stress-resistant strains or varieties is imminent. Summary of the invention
[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of the KLF9 gene in the breeding of chickens to resist heat stress.
[0006] The technical problem that the present invention also solves is to provide an application of interfering with or over-expressing the expression level of the KLF9 gene in chicken skeletal muscle tissue in the breeding of chickens resistant to heat stress.
[0007] The technical problem that the present invention also solves is to provide a reagent or a kit for detecting the expression amount of the KLF9 gene in the skeletal muscle tissue of chickens for use in breeding chickens to resist heat stress. The technical problem that the present invention also solves is to provide a KLF9 gene interference fragment, a primer pair based on the KLF9 gene interference fragment, an interference vector containing the interference fragment and a construction method thereof.
[0008] The technical problem that the present invention needs to solve is to provide a detection kit.
[0009] The technical problem that the present invention also aims to solve is to provide the target sequence of the KLF9 gene interference fragment, the primer pair based on the KLF9 gene interference fragment, and the application of the interference vector in chicken heat stress resistance breeding.
[0010] The final technical problem to be solved by the present invention is to provide a method for breeding chickens resistant to heat stress.
[0011] Technical solution: In order to solve the above technical problems, the first aspect of the present invention provides the application of KLF9 gene in breeding chickens for heat stress resistance, and the nucleotide sequence of the KLF9 gene is shown in SEQ ID NO.1.
[0012] The second aspect of the present invention provides the use of interfering with or overexpressing the expression level of the KLF9 gene in chicken skeletal muscle tissue in breeding chickens for heat stress resistance.
[0013] The third aspect of the present invention provides the use of a reagent or a kit for detecting the expression amount of the KLF9 gene in the skeletal muscle tissue of chickens in breeding chickens for heat stress resistance.
[0014] The fourth aspect of the present invention provides an interference fragment of the KLF9 gene, the nucleotide sequence of the interference fragment of the KLF9 gene is shown as SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.
[0015] The fifth aspect of the present invention provides primer pairs based on the KLF9 gene interference fragment, the primer pair for the interference fragment with the nucleotide sequence of SEQ ID NO.2 is SEQ ID NO.5 and SEQ ID NO.6; the primer pair for the interference fragment with the nucleotide sequence of SEQ ID NO.3 is SEQ ID NO.7 and SEQ ID NO.8; the primer pair for the interference fragment with the nucleotide sequence of SEQ ID NO.4 is SEQ ID NO.9 and SEQ ID NO.10.
[0016] The sixth aspect of the present invention provides an interference vector, which contains the interference fragment of the KLF9 gene.
[0017] The seventh aspect of the present invention provides a method for constructing the interference vector, comprising the following steps: annealing the primer pairs of the interference fragment of the KLF9 gene respectively to obtain the annealing products, and connecting the annealing products to the vector.
[0018] The eighth aspect of the present invention provides a detection kit, which includes specific primers SEQ ID NO.12 and SEQ ID NO.13.
[0019] The ninth aspect of the present invention provides the use of the KLF9 gene interference fragment, the primer pair based on the KLF9 gene interference fragment, and the interference vector in the breeding of chickens resistant to heat stress.
[0020] A tenth aspect of the present invention provides a method for breeding heat stress-resistant chickens, the breeding method comprising upregulating or overexpressing the expression level of the KLF9 gene.
[0021] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the gene KLF9 provided by the present invention can be used as a marker for detecting the heat stress resistance level of chickens. By detecting the expression of the gene in the skeletal muscle of chickens in breeding, its expression level can be quickly determined, and chickens with a half-sibling relationship with the detected individual can be selected, which can accelerate the rapid breeding of target traits in the chicken breeding process. The primer pair and kit provided by the present invention can be used to detect the expression of KLF9 in the skeletal muscle tissue of chickens, and the detection method is simple and fast. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is the statistical result of differentially expressed genes.
[0023] Figure 2 This is the interaction network diagram of the common differentially expressed genes.
[0024] Figure 3 This is a statistical chart of KLF9 gene sequencing expression.
[0025] Figure 4 This is an information diagram of the interference carrier map.
[0026] Figure 5 This is a diagram for detecting KLF9 interference efficiency.
[0027] Figure 6 This is the result diagram of antioxidant index detection. DETAILED DESCRIPTION
[0028] The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.
[0029] Example 1 Transcriptome sequencing reveals potential breeding-related genes for heat stress resistance in chickens
[0030] 1. Collection of sequencing samples
[0031] The study selected 10 healthy Tianjin monkey chickens and 10 Jingfen No. 6 laying hens, and each breed of hens was randomly divided into two groups, with 5 replicates in each group. One group of Tianjin monkey chicken hens and Jingfen No. 6 laying hens was raised at normal temperature (20℃ for 3 hours) as the Tianjin monkey chicken hen control group (TMN) and the Jingfen No. 6 laying hen control group (JFN), and the other group was subjected to high temperature stress stimulation (42℃ for 3 hours) as the Tianjin monkey chicken hen experimental group (TMT) and the Jingfen No. 6 laying hen experimental group (JFT). After 3 hours of the experiment, all the experimental chickens were quickly killed and the breast muscle tissue was collected for transcriptome sequencing analysis.
[0032] 2. Screening of key differentially expressed genes
[0033] With FDR (False Discovery Rate) < 0.05 and FC (Fold change) ≥ 2 as screening conditions, 157 and 1435 differentially expressed genes (DEGs) were obtained in the comparison groups JFN and JFT and TMN and TMT, respectively ( Figure 1 A). Compared with the JFN group, 41 genes were up-regulated and 116 genes were down-regulated in the heat stress group JFT; 40 up-regulated genes and 1395 down-regulated genes were found in the heat stress group TMT of Tianjin monkey hens. 24 common differentially expressed genes were found between the two comparison groups ( Figure 1 B), The differential expression heat map illustrates the up- and down-regulated relationships of differentially expressed genes in different groups. Heat stress leads to an increase in down-regulated genes in pectoral muscle ( Figure 1 C and D).
[0034] The study further predicted the protein-protein interaction (PPI) relationship of 24 common differentially expressed genes, and the results showed that ( Figure 2 ) Only 13 genes had interactions, including three transcription factors KLF9, NFIL3 and NSD2, among which transcription factor KLF9 had the highest connectivity, and the sequencing results showed ( Figure 3 ) The expression level of KLF9 in Tianjin Monkey Chicken and Jingfen No. 6 laying hens showed a downward trend under heat stress.
[0035] 3. Key gene KLF9 function experiment
[0036] The study deeply constructed a KLF9 interference vector and screened effective interference vectors in the chicken cell line DF-1. On this basis, the effects of the screened effective interference vectors on the total antioxidant capacity (T-AOC) and superoxide dismutase (SOD) activity of the cells were detected.
[0037] 3.1 Construction and screening of KLF9 interference vector
[0038] According to the sequence information of the transcript of KLF9 (ENSGALT00010036044.1) in the Ensembl database, as shown in SEQ ID NO.1 (1712bp), the interference sequences of three targets (SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4) were designed. The primer annealing sequences of each interference fragment are shown in Table 1, which are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively. The interference vector selected in the experiment is pCDNA3.1-U6-shRNA-CMV-EGFP, and its map information is shown in Figure 4 As shown, its sequence information is shown in SEQ ID NO.11.
[0039] SEQ ID NO.1:
[0040]
[0041]
[0042] Target 1: CATTCGGACTGGCGTACATAT SEQ ID NO.2 Target 2: AGAAGACCTGCGAAACTAACT SEQ ID NO.3 Target 3: CATAAGTAATTCTCAGATATA SEQ ID NO.4 Table 1 Sequence information of annealing primers for each target
[0043]
[0044] SEQ ID NO.11:
[0045]
[0046]
[0047] PAGE-purified primers were synthesized for the above three target primer sequence information, and the primers were diluted to 100 μM to construct a 20 μL annealing reaction system (Table 2). The annealing program is shown in Table 3. After annealing, the double-stranded fragments with sticky ends were connected to the linear interference vector of pCDNA3.1-U6-shRNA-CMV-EGFP after double digestion with EcoR I and Bam HI. The reaction conditions were 16°C overnight, and the reaction system was shown in Table 4. After the connection was completed, the product of the overnight reaction was transformed using Stbl3 competent cells. After successful transformation, different volumes of transformed competent cells were added to LB agar medium containing antibiotics, and the cells were evenly spread, inverted, and cultured at 37°C overnight. After that, the three interference vectors were successfully constructed by picking bacteria, shaking bacteria, PCR agarose gel electrophoresis of bacterial liquid, and sequencing identification.
[0048] Table 2 Annealing reaction system
[0049]
[0050]
[0051] Table 3 Annealing schedule
[0052]
[0053] Table 4 Interference fragment and vector ligation reaction system
[0054]
[0055] The cultured DF-1 (Punosai, CL-0279) cells were subcultured in 6-well plates one day in advance for transfection and placed in an incubator after subculture. The cell status was observed before transfection. Cells were used for transfection when the cell density reached 70-80% confluence and there was no contamination. Lipofectamine was used. TM 3000 kit (Invitrogen, L3000015) was used to prepare transfection premix A and B, wherein the content of each substance added to A was as follows: Opti-MEM, 350 μL; Lipofectamine TM , 3.75μL; B added the following substances: Opti-MEM, 350μL; plasmid vector, 2500ng; P3000 TM , 3.75μL. After fully mixing the above A and B premixes, add the B premix to A and incubate at room temperature for 15 minutes. After the incubation, slowly add it to the prepared DF-1 cells and culture them in a cell culture incubator; after transfection for 16 hours, replace the culture medium containing 10% fetal bovine serum for culture. After 24 hours, collect the cells to be tested and extract the total RNA of the cells after transfection with the three interference vectors.
[0056] 3.2 Real-time fluorescence quantitative PCR detection kit
[0057] The kit of the present invention comprises specific primers of sequences SEQ ID NO.12 and SEQ ID NO.13 and qRT-PCR quantitative premix reagent, and enzyme-free double distilled water and universal internal reference GAPHD primers can be prepared by oneself.
[0058] The total RNA extracted after the cells were transfected with the three interference vectors in step 3.1 was reverse transcribed to obtain cDNA. According to the sequence of the KLF9 transcript in the Ensembl database (accession number ENSGALT00010036044.1), specific primers SEQ ID NO.12 and SEQ ID NO.13 were designed, and the internal reference GAPDH primer was a universal primer. The sizes of the KLF9 and GAPDH primer amplification products were 159 bp and 132 bp, respectively, and the primer sequences were as follows:
[0059] KLF9:
[0060] F:5'-TAAGAAGTTCTCCCGCTCCG-3'SEQ ID NO.12
[0061] R:5'-TTGATCATGCTGGGGTGGAA-3'SEQ ID NO.13
[0062] GAPDH:
[0063] F:5'-GAACATCATCCCAGCGTCCA-3'
[0064] R:5'-CGGCAGGTCAGGTCAACAAC-3'
[0065] This experiment used real-time fluorescence quantitative PCR (qRT-PCR) for amplification. The amplification reaction system was 30.8 μL, including 10.0 μL of qRT-PCR quantitative premix reagent; 0.4 μL of SEQ ID NO.12; 0.4 μL of SEQ ID NO.13; 2 μL of template cDNA; and 18.0 μL of enzyme-free double distilled water. Fluorescence quantitative reaction program: pre-denaturation, 95°C 30 sec; cycle stage, 95°C 10 sec, 60°C 30 sec, 45 cycles; melting curve, 95°C 15 sec, 60°C 60 sec, 95°C 15 sec.
[0066] Figure 5The results of real-time fluorescence quantitative PCR showed that the KLF9 gene was significantly or extremely significantly downregulated in the three experimental groups, among which the interference efficiency of interference group 2 (SEQ ID NO.3) was the highest, reaching 92.61%, which was the effective interference fragment determined in this study.
[0067] 3.2 Antioxidant index detection
[0068] The interference vector screened in the above interference group 2 was transfected into DF-1 cells again, and a control group was set up. Each group had 5 biological replicates. During transfection, 2500 ng of the vector plasmid and P3000 were added in advance. TM Reagent 5 μL, Lipofectamine TM 7.5 μL of 3000 reagent was mixed and incubated at room temperature for 15 min before use for transfection. After 16 h of transfection, new culture medium was replaced and culture was continued. After 48 h, the total antioxidant capacity (T-AOC) and SOD (superoxide dismutase) activity of the cells were collected for detection.
[0069] The results show that Figure 6 ), the total antioxidant capacity (T-AOC) of cells was significantly reduced after KLF9 interference (P<0.05). This finding suggests that KLF9 plays an indispensable role in maintaining normal antioxidant levels in cells. The total antioxidant capacity is an important indicator to measure the overall effectiveness of the cellular antioxidant defense system, which reflects the ability of cells to scavenge free radicals and resist oxidative stress. Therefore, the absence or downregulation of KLF9 expression may weaken this important defense mechanism of cells.
[0070] The experiment also showed that SOD (superoxide dismutase) activity showed a very significant downward trend after KLF9 interference (P<0.01). SOD is a key antioxidant enzyme that is responsible for converting superoxide radicals into hydrogen peroxide and oxygen, thereby protecting cells from oxidative damage. The reduction in SOD activity after KLF9 interference further confirms the core position of KLF9 in the antioxidant defense system.
[0071] In summary, according to the above transcriptome sequencing and functional experiments, the high expression of KLF9 in chicken skeletal muscle (breast muscle) indicates that the individual has a higher resistance to heat stress. The kit provided by the present invention can be used to detect the relative expression of KLF9 in chicken skeletal muscle. The kit contains specific primer sequences SEQ ID NO.12 and SEQ ID NO.13 and qRT-PCR quantitative premix reagents, and enzyme-free double distilled water and universal internal reference GAPHD primers can be prepared by yourself. The detection method of this experimental invention is simple and fast, and the detection of KLF9 provided can be used as a marker for the level of heat stress resistance in chicken skeletal muscle, thereby providing scientific guidance for the selection and cultivation of heat stress resistant strains.
Claims
1. KLF9 Application of genes in chicken heat stress resistance breeding, the KLF9 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. Interference or overexpression KLF9 Application of gene expression in breeding chickens for heat stress resistance.
3. Detection KLF9 Application of a reagent or kit for measuring the expression level of a gene in breeding chickens to resist heat stress.
4. KLF9 The interference fragment of a gene is characterized in that Said KLF9 The nucleotide sequence of the interference fragment of the gene is shown as SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.
4.
5. Based on KLF9 A primer pair for a gene interference fragment, characterized in that: The primer pair for the interference fragment with the nucleotide sequence of SEQ ID NO.2 is SEQ ID NO.5 and SEQ ID NO.6; the primer pair for the interference fragment with the nucleotide sequence of SEQ ID NO.3 is SEQ ID NO.7 and SEQ ID NO.8; the primer pair for the interference fragment with the nucleotide sequence of SEQ ID NO.4 is SEQ ID NO.9 and SEQ ID NO.
10.
6. An interference vector comprising the KLF9 Interference fragment of the gene.
7. The method for constructing the interference vector according to claim 6, characterized in that: The steps include: KLF9 The primer pairs of the gene interference fragment are annealed respectively to obtain the annealing products, and the annealing products are connected to the vector to obtain the product.
8. A detection kit, characterized in that: The detection kit comprises specific primers SEQ ID NO.12 and SEQ ID NO.
13.
9. The method according to claim 4 KLF9 Gene interference fragment, based on claim 5 KLF9 Use of a primer pair of a gene interference fragment and the interference vector described in claim 6 in breeding chickens to resist heat stress.
10. A method for breeding chickens resistant to heat stress, characterized in that: The cultivation method includes upregulating or overexpressing KLF9 The expression level of the gene.