Real-time fluorescent PCR (polymerase chain reaction) primer probe composition, kit and method for detecting rodent K virus

Abstract

The invention relates to the technical field of virus detection, in particular to a real-time fluorescent PCR (polymerase chain reaction) primer probe composition, a kit and a method for detecting a rodent K virus. The primer probe composition comprises a primer and a TaqMan probe, the nucleotide sequence of a forward primer of the primer pair is as shown in SEQ ID NO.1, and the nucleotide sequence of a reverse primer of the primer pair is as shown in SEQ ID NO.2; the nucleotide sequence of the TaqMan probe is as shown in SEQ ID NO. 3. The primer probe composition is high in specificity and sensitivity, the detection method is simple, convenient and rapid, the detection time is short, the detection method is suitable for detection of a large number of sample experiment rodent K viruses, and an effective technical means is provided for rapid detection of the rodent K viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and in particular to a real-time fluorescent PCR primer-probe composition, a kit and a method for detecting rodent K virus. Background Art

[0002] Laboratory animals are the foundation and support of life science research, and their microbiological quality can seriously affect the welfare of animals and the validity and reproducibility of research data. Therefore, it is important for breeding and experimental facilities to establish a laboratory animal health monitoring (HM) program.

[0003] Mouse papillomavirus K virus ( mouse polyomavirus K virus ) was first discovered by Kilham in 1952 and assigned to papillomavirus in 1963 ( Papovavirus ) family, murine polyomavirus type II. The genome of K virus is a supercoiled, double-stranded, closed circular DNA molecule, and the pathogen is transmitted by ingestion of contaminated feces. To date, K virus and polyomavirus are the only confirmed mouse members of the genus Polyoma of papillomavirus. The biological and biochemical characteristics of K virus are mainly limited by the lack of cell culture systems for its propagation. When inoculated into newborn mice, it can cause fatal pneumonia. MptV (K Virus [Murine Pneumotropic Virus]) infection in newborn mice causes pneumonia 6-15 days after infection. Animals show sudden dyspnea and usually die. After 18 days of age, there are no clinical symptoms of infection. Gross lesions in the lungs can be seen in infected newborn mice. Histology shows interstitial pneumonia accompanied by hemorrhage, edema, atelectasis, etc.; histopathological examination shows intranuclear inclusions in various tissues, but tissues other than the lungs are difficult to observe. Interstitial pneumonia in 6-15 day old mice or immunodeficient mice can be suspected of MptV infection. Unlike PyV (polyomavirus), MptV induces low titer antibody production and can be detected by ELISA, IFA, or MFIATM. Although K virus differs from polyomavirus and other well-characterized papillomaviruses in that it cannot induce tumors, it has been shown to transform mouse cells in culture. Therefore, it is recommended to include murine papillomavirus K virus in the list of highly infectious pathogens for laboratory mice. In the study of PCR detection for the identification of murine polyomavirus in biological samples, PCR assays were designed and optimized to improve the specificity and sensitivity of mouse polyomavirus and K virus detection. Universal PCR assays were compared with mouse bioassays to diagnose infected cell samples. Results showed that the PCR assays were highly specific, and the mouse polyomavirus PCR assay was the most sensitive assay, detecting as few as 2000 copies. The sensitivity of the K virus PCR assay was approximately eight times lower, and the universal PCR assay had the lowest sensitivity.

[0004] Therefore, it is of great significance to develop a primer-probe combination and detection method for detecting rodent K virus with higher sensitivity, shorter experimental time, and suitable for a large number of samples. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a real-time fluorescent PCR primer-probe composition and method for detecting rodent K virus. The primer-probe composition has strong specificity and high sensitivity. The detection method is simple and fast with a short detection time, and is suitable for detecting rodent K virus in a large number of sample experiments.

[0006] To achieve the above object, the first aspect of the present invention provides a real-time fluorescent PCR primer-probe composition for detecting rodent K virus, comprising a primer pair and a TaqMan probe, wherein the nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the TaqMan probe is shown in SEQ ID NO.3, wherein the nucleotide sequence is as follows: Forward primer: KV-F: 5′- CAGCTGCTGCTAAGGTTG-3′ (SEQ ID NO. 1); Reverse primer: KV-R: 5′-TGAGTGCGCAATCCTCCTAT-3′ (SEQ ID NO. 2); TaqMan Probes: KV-P:X-5'-AGGACCGGTAAATAGCCA-3' (SEQ ID NO. 3)-Y.

[0007] Further, the TaqMan probe includes a 5'-end modified fluorescent group X and a 3'-end modified quenching group Y, wherein the 5'-end modified fluorescent group X is any one of FAM, VIC, ROX, HEX, and CY5, but is not limited to the above; the 3'-end modified quenching group Y is any one of BHQ1, BHQ2, BHQ3, MGB, and TAMARA, but is not limited to the above.

[0008] Conventional PCR is the process of amplifying and detecting specific DNA sequences or genes using PCR (polymerase chain reaction) technology. PCR is a method for amplifying DNA fragments in vitro, and its basic principle is based on DNA replication and the enzymatic activity of DNA polymerase. It has certain disadvantages, such as relatively low sensitivity; long experiment time; only qualitative, not accurate quantitative, etc. Real-time fluorescent polymerase chain reaction (Real-Time PCR) is based on conventional PCR, adding specific fluorescent probes to the reaction system, using fluorescent signal accumulation to detect the entire PCR process in real time, and indirectly reflecting the amount of target genes amplified by PCR by detecting the fluorescent emission signal in each cycle. Finally, the unknown template is qualitatively or quantitatively analyzed through the amplification curve. Compared with conventional PCR, RT-PCR has higher sensitivity, can detect lower concentrations of DNA templates, and can detect fluorescent signals in real time during DNA amplification, thereby accurately measuring the number of starting templates and shortening the inspection time.

[0009] The present invention designs and synthesizes a pair of specific primers and a specific probe based on the K virus genome DNA, wherein a reporter fluorescent group and a quencher fluorescent group are respectively labeled at both ends of the probe, and the fluorescent signal generated by the interaction between the two genes is received by a detection instrument, thereby detecting the nucleic acid template by detecting the fluorescent signal.

[0010] Furthermore, the experimental rodent is any one of mice, rats, hamsters, guinea pigs, or other rodents.

[0011] In a second aspect, the present invention provides a kit containing the above-mentioned real-time fluorescent PCR primer-probe combination for detecting rodent K virus.

[0012] Specifically, the following substances are also included: PCR premix 2×AceQ qPCR Probe Master Mix, negative control and positive control; the negative control is ddH2O; the positive control is KV-400g plasmid, and its effective nucleotide sequence is shown in SEQ ID NO.4.

[0013] KV-400g plasmid is a positive recombinant plasmid obtained by cloning the amplified product of K virus using the above primers into a vector and transforming DH5α competent cells. It can be used as a positive control reference sequence after enzyme digestion identification and sequencing. Its effective nucleotide sequence is as follows: GTTAGCCGCTAGGTTTGATAAATTATTTGAAAGATTGGAAGTAATATTGAGTGCGCAATCCCTATACAATTAGCATGTTTATGGCAGGCATTGTTTGGTTTGAAAATCTTTTTCCAGGCCAGTCATTTAAAGACCTCCTTTTGGAACTCCTTGAATGTATGGTTTCAAACATCCCTAAGAGAAGATATTGGCTATTTACC GGTCCTGTTAATACTGGTAAAACAACCTTAGCAGCAGCTGTCCTAGATCTTTGTGGAGGTAAAGCATTAAATATAAATATGCCATTTGATAAACTAAATTTTGAGCTGGGAGTTGCAATAGATCAATTCATGGTTGTGTTTGAAGATGTTAAAGGACAGAAAAGTGAAAATAAAGATTTGCCACCCGGGCAAGGAATA (SEQ ID NO.4).

[0014] The third aspect of the present invention also provides a use of the above-mentioned kit in K virus detection for non-disease diagnosis purposes.

[0015] In a fourth aspect, the present invention provides a method for detecting rodent K virus for non-disease diagnosis purposes, comprising the steps of: (a) Extracting DNA from samples to be tested; (b) using the extracted sample DNA as a template, performing RT-PCR amplification reaction using the above kit to obtain an amplification product; (c) Perform curve analysis on the amplification curve to determine whether the sample to be tested contains K virus.

[0016] The sample DNA of the present invention may be sourced from organ tissues, cecal contents or feces, blood, swabs, or cell cultures of mice, rats, hamsters, or guinea pigs.

[0017] Furthermore, the above result judgment method is: if the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤35, it is judged to be positive; if the Ct value of the sample to be tested is between 35 and 40, the real-time fluorescence PCR test should be re-performed. After re-testing, if the Ct value is ≥40, the sample is judged to be negative. If the Ct value after re-testing is still between 35 and 40, the sample is judged to be suspected positive and further sequence determination is required.

[0018] Specifically, result analysis and condition setting: Read the test results directly, and adjust the baseline and threshold setting principles according to the noise of the instrument, with the threshold line just exceeding the highest point of the normal negative sample amplification curve; Quality control standards: The blank control has no Ct value and no fluorescence amplification curve, which is always a horizontal line; The negative control has no Ct value and no fluorescence amplification curve, which is always a horizontal line; If the positive control Ct value is ≤35 and there is an obvious fluorescence amplification curve, it means that the reaction system is running normally. Otherwise, the test is invalid and real-time fluorescence PCR amplification needs to be repeated.

[0019] Result judgment: If there is no fluorescence amplification curve in the sample to be tested, the virus nucleic acid of sample K is judged to be negative; If the sample to be tested has a fluorescence amplification curve and the Ct value is ≤35, the virus nucleic acid of sample K is judged to be positive; If the Ct value of the sample to be tested is between 35 and 40, the real-time fluorescence PCR test should be performed again; after re-testing, if the Ct value is ≥40, the virus nucleic acid of sample K is judged to be negative; if the Ct value after re-testing is still between 35 and 40, the virus nucleic acid of sample K is judged to be suspected positive and further sequence determination is required.

[0020] Furthermore, the system of the RT-PCR amplification reaction is: 2×AceQ qPCR Probe Master Mix10μL Forward primer (10 µmol / L) 0.8 μL Reverse primer (10 µmol / L) 0.8 μL TaqMan probe (10 µmol / L) 0.8 μL Sample DNA / negative control / positive control 2 μL ddH2O 5.6μL Total volume 20 μL.

[0021] Furthermore, the RT-PCR reaction procedure is: 37°C for 2 min; 95°C for 10 min; 95°C for 15 s, 60°C for 30 s, 40 cycles, and collecting fluorescence signals at 60°C. In this technical solution, the reaction is first performed at 37°C for 2 min, which can effectively remove pollutants in the system and improve purity.

[0022] The beneficial effects of the present invention are as follows: the present invention has a short detection cycle and is easy to operate; it has strong specificity and reduces background fluorescence and false positives; it introduces an anti-pollution system to eliminate the influence of amplification product contamination on qPCR reactions.

[0023] The present invention designs a primer-probe combination according to the conservative sequence of the K virus genome, which specifically binds only to the K virus and has no cross-reaction with other common viruses such as mouse pneumonia virus, rat parvovirus, rotavirus, reovirus type 3, mouse norovirus, mouse parvovirus, polyomavirus, and pathogenic bacteria such as Staphylococcus aureus, Escherichia coli, Pasteurella multocida, and Pseudomonas aeruginosa. The specificity is strong and the reliability of low-abundance gene quantification is high. In addition, the primers designed by the present invention have high specificity requirements and can avoid nonspecific amplification or the generation of primer dimers.

[0024] The present invention detects the standard product of 1.58-1.58×10 8 K virus can be detected efficiently within a wide copy number range with good accuracy and higher sensitivity.

[0025] The detection method of the present invention is simple and quick, greatly shortens the detection time, and can be applied to the detection of K virus in a large number of samples such as mice, rats, hamsters, guinea pigs and other experimental rodents, providing an effective technical means for the rapid detection of K virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The amplification patterns of the plasmid KV-400g synthesized by the real-time fluorescence quantitative PCR reaction system in Example 3 of the present invention at different dilution multiples; Figure 2 The amplification patterns of different pathogens and viruses by the real-time fluorescence quantitative PCR reaction system in Example 4 of the present invention; Figure 3 The amplification patterns of different samples and comparisons of the real-time fluorescence quantitative PCR reaction system in Example 5 of the present invention are shown.

[0027] The present invention is further described below in conjunction with the accompanying drawings and embodiments. DETAILED DESCRIPTION

[0028] In order to better illustrate the technical scheme of the present invention, the scheme of the present invention will be explained below in conjunction with embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If specific techniques or conditions are not indicated in the embodiments, they are carried out according to the techniques described in the literature or reference books in this area or according to the product instructions. If the manufacturer is not indicated in the reagents or instruments used, they are all conventional products.

[0029] The above-mentioned technical features of the present invention and the technical features specifically described below (such as implementation cases) can be combined with each other to form a new or preferred technical solution.

[0030] Example 1: Design of primers and probes The entire genome sequence of K virus was searched on the NCBI website for comparison. Primers and probes were designed using Primer Premier 5 software based on the conserved sequence of the K virus genome. The nucleotide sequence is as follows: Forward primer: KV-F: 5′- CAGCTGCTGCTAAGGTTG-3′ (SEQ ID NO. 1); Reverse primer: KV-R: 5′-TGAGTGCGCAATCCTCCTAT-3′ (SEQ ID NO. 2); TaqMan Probes: KV-P: FAM-5'-AGGACCGGTAAATAGCCA-3' (SEQ ID NO. 3)-BHQ1.

[0031] The primers used in the present invention were commissioned to be synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0032] Example 2: A kit for detecting rodent K virus Kit for detecting experimental rodent K virus, including: (1) PCR premix 2×AceQ qPCR Probe Master Mix (2) Using the primers in Example 1: forward primer SEQ ID NO: 1, reverse primer SEQ ID NO. 2; TaqMan probe SEQ ID NO. 3; (3) Negative control: ddH2O; (4) Positive control: KV-400g plasmid, which is obtained by cloning the amplified product of K virus using the above primers into a vector and transforming DH5α competent cells. The positive recombinant plasmid is obtained after enzyme digestion identification and sequencing. Its effective nucleotide sequence (SEQ ID NO: 4) is as follows: GTTAGCCGCTAGGTTTGATAAATTATTTGAAAGATTGGAAGTAATATTGAGTGCGCAATCCTCTACATCAATTAGCATGTTTATGGCAGGCATTGTTTGGTTTGAAAATCTTTTTCCAGGCCAGTCATTTAAAGACCTCCTTTTGGAACTCCTTGAATGTATGGTTTCAAACATCCCTAAGAGAAGATATTGGCTATTTA CCGGTCCTGTTAATACTGGTAAAACAACCTTAGCAGCAGCTGTCCTAGATCTTTGTGGAGGTAAAGCATTAAATATAAATATGCCATTTGATAAACTAAATTTTGAGCTGGGAGTTGCAATAGATCAATTCATGGTTGTGTTTGAAGATGTTAAAGGACAGAAAAGTGAAAATAAAGATTTGCCACCCGGGCAAGGAATA.

[0033] Specifically, the reaction system includes: 2×AceQ qPCR Probe Master Mix10 μL Forward primer (10 µmol / L) 0.8 μL Reverse primer (10 µmol / L) 0.8 μL TaqMan probe (10 µmol / L) 0.8 μL Negative control / positive control / (sample) 2 μL ddH2O5.6 μL Total volume 20 μL.

[0034] The RT-PCR reaction parameters are shown in Table 1: Table 1

[0035] Result analysis and condition setting: Read the test results directly, and adjust the baseline and threshold setting principles according to the noise conditions of the instrument, with the threshold line just exceeding the highest point of the amplification curve of the normal negative sample.

[0036] Quality control standards: The blank control has no Ct value and no fluorescence amplification curve, and is always a horizontal line.

[0037] The negative control has no Ct value and no fluorescence amplification curve, and is always a horizontal line.

[0038] If the positive control Ct value is ≤35 and there is an obvious fluorescence amplification curve, it means that the reaction system is running normally. Otherwise, the test is invalid and real-time fluorescence PCR amplification needs to be repeated.

[0039] Result judgment: If there is no fluorescence amplification curve for the sample to be tested, the sample pathogen nucleic acid is judged to be negative.

[0040] If the sample to be tested has a fluorescence amplification curve and the Ct value is ≤35, the sample is judged to be positive for pathogen nucleic acid.

[0041] If the Ct value of the sample to be tested is between 35 and 40, the real-time fluorescence PCR test should be repeated. After retesting, if the Ct value is ≥40, the sample pathogen nucleic acid is judged to be negative. If the Ct value after retesting is still between 35 and 40, the sample pathogen nucleic acid is judged to be suspected positive and further sequence determination is required.

[0042] Example 3: Sensitivity experiment Using the plasmid KV-400g synthesized from the K virus gene as a template, a series of gradient dilutions were performed and real-time fluorescence PCR detection was performed. The conditions were the same as those in Example 2.

[0043] Determine the concentration of the extracted plasmid and calculate the number of copies per μL of plasmid. Dilute the plasmid to a concentration of 1.58 × 10 8 , 1.58×10 7 , 1.58×10 6 , 1.58×10 5 , 1.58×10 4 , 1.58×10 3 , 1.58×10 2 , 15.8 copies / μL, as shown in Table 2.

[0044] Table 2

[0045] Real-time fluorescence quantitative PCR detection results Figure 1 shown.

[0046] from Figure 1 It can be seen from the results that the real-time fluorescence quantitative PCR technology provided by the present invention has good accuracy, and each concentration detection system can achieve accurate detection of the corresponding K virus with high sensitivity.

[0047] Example 4: Specificity Experiment Staphylococcus aureus, Escherichia coli, Pasteurella multocida, Pseudomonas aeruginosa, mouse pneumonia virus PVM, rat parvovirus H-1, rotavirus RRV, reovirus type 3 REO-3, mouse norovirus MNV, mouse parvovirus MPV, polyomavirus POLY, and K virus were detected using the kit, reaction system and parameters in Example 2. The results are shown in Table 3, where the real-time fluorescence quantitative PCR detection results are shown in Table 3. Figure 2 shown.

[0048] Table 3

[0049] from Figure 2 It can be seen from the results in Table 3 that the kit and method of the present invention have no cross reaction to the above pathogens and viruses and have strong specificity.

[0050] Example 5: Application of K virus kit (1) Collect 6 samples of mouse feces, take 1.0-2.0 g of the sample to be tested into a sterile 5 mL centrifuge tube, add 5 times the volume of sterile PBS, use a homogenizer to fully homogenize for 1-2 min, centrifuge at 8000g for 5 min, and transfer the supernatant into another sterile 5 mL centrifuge tube. Number them M01, M02, M03, M04, M05, and M06 for later use.

[0051] (2) Use the FastPure Viral DNA / RNA Mini Kit to extract viral nucleic acid from the above samples and number them for future use.

[0052] (3) According to the number of samples and controls n, prepare the reaction solution at n+5%n, mix thoroughly and then dispense. The kit of Example 2 is used for detection, and the reaction system is as follows: 2×AceQ qPCR Probe Master Mix10 μL Forward primer (10 µmol / L) 0.8 μL Reverse primer (10 µmol / L) 0.8 μL TaqMan probe (10 µmol / L) 0.8 μL Negative control / positive control / (sample) 2 μL ddH2O5.6 μL Total volume 20 μL.

[0053] (4) Add 2 µL of template (including positive control, negative control and nucleic acid products extracted from the sample) to the above reaction tubes to make the total volume of each tube reach 20 µL. After tightly capping the tube, shake and mix, and centrifuge at 500 r / min for 30 seconds.

[0054] The reaction was carried out according to the RT-PCR reaction parameters as shown in Table 4: Table 4

[0055] (5) The results are shown in Table 5, where the real-time fluorescence quantitative PCR test results are shown in Figure 3 shown.

[0056] Table 5

[0057] From Table 5 and Figure 3 It can be seen from the results that the kit of the present invention was used to detect 6 samples, and none of the results showed K virus infection, indicating that the kit of the present invention can be used for clinical sample detection.

[0058] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A real-time fluorescent PCR primer-probe combination for detecting rodent K virus, characterized in that: It comprises a primer pair and a TaqMan probe, wherein the nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.2; the nucleotide sequence of the TaqMan probe is shown as SEQ ID NO.

3.

2. A real-time fluorescent PCR primer-probe composition for detecting rodent K virus according to claim 1, characterized in that: The TaqMan probe comprises a 5'-end modified fluorescent group X and a 3'-end modified quenching group Y, wherein the 5'-end modified fluorescent group X is any one of FAM, VIC, ROX, HEX, and CY5, and the 3'-end modified quenching group Y is any one of BHQ1, BHQ2, BHQ3, MGB, and TAMARA.

3. A real-time fluorescent PCR primer-probe composition for detecting rodent K virus according to claim 1, characterized in that: The rodent is any one of a mouse, a rat, a hamster, and a guinea pig.

4. A kit comprising the real-time fluorescent PCR primer-probe combination for detecting rodent K virus according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that Also includes the following substances: PCR premix 2×AceQqPCR Probe Master Mix, negative control and positive control; the negative control is ddH2O; the positive control is KV-400g plasmid, and its effective nucleotide sequence is shown in SEQ ID NO.

4.

6. Use of the kit as claimed in claim 4 or 5 in the detection of K virus for non-disease diagnosis purposes.

7. A method for detecting rodent K virus for non-disease diagnosis purposes, characterized in that: The steps include: (a) Extracting DNA from samples to be tested; (b) using the extracted sample DNA as a template, performing RT-PCR amplification reaction using the kit described in claim 4 or 5 to obtain an amplified product; (c) Perform curve analysis on the amplification curve to determine whether the sample to be tested contains K virus.

8. The method according to claim 7, characterized in that The judgment method is: if the sample to be tested has a fluorescence amplification curve and the Ct value should be ≤35, it is judged to be positive; if the Ct value of the sample to be tested is between 35 and 40, the real-time fluorescence PCR test should be performed again. After re-testing, if the Ct value is ≥40, the sample is judged to be negative. If the Ct value after re-testing is still between 35 and 40, the sample is judged to be suspected positive and further sequence determination is required.

9. The method according to claim 7, characterized in that: The system of the RT-PCR amplification reaction is: 2×AceQqPCR Probe Master Mix 10 μL; Forward primer (10 µmol / L) 0.8 μL; Reverse primer (10 µmol / L) 0.8 μL; TaqMan probe (10 µmol / L) 0.8 μL; Sample DNA / negative control / positive control 2 μL; ddH2O 5.6μL; Total volume 20 μL.

10. The method according to any one of claims 7 to 9, characterized in that: The program of RT-PCR reaction was: 37°C for 2 min; 95°C for 10 min; 95°C for 15 s, 60°C for 30 s, 40 cycles, and collecting fluorescence signals at 60°C.

Images