3D protein mutated O-type foot-and-mouth disease recombinant virus strain as well as construction and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a 3D protein mutated O-type foot-and-mouth disease recombinant virus strain as well as construction and application thereof. The 403th methionine of the O-type foot and mouth disease virus 3D protein is mutated into alanine, the recombinant virus strain rFMDV-M403A with the mutated O-type foot and mouth disease virus 3D protein is successfully constructed and saved by using a reverse genetic technology, and amino acid of the recombinant virus strain can be stably mutated in a passage process; the growth speed of the mutant strain is slower than that of a wild strain, and the virus titer is remarkably reduced; in an individual experiment, neonatal mouse infection shows that the mutant strain can improve the survival rate of neonatal mice, and the virus load and tissue lesion in the liver are remarkably reduced. The attenuated foot-and-mouth disease recombinant virus strain provided by the invention provides important significance for deep understanding of a foot-and-mouth disease virus pathogenic mechanism and a prevention and control strategy, and also provides an important theoretical basis for further development of a foot-and-mouth disease genetic engineering vaccine.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to an O-type foot-and-mouth disease recombinant virus strain with a 3D protein mutation and a construction and application thereof. Background Art

[0002] Foot-and-mouth disease (FMD) is an acute, febrile, highly contagious disease that seriously endangers the health of even-toed ungulates. It is caused by foot-and-mouth disease virus (FMDV). FMDV is composed of a single-stranded positive-strand RNA and a capsid wrapped around it. The virus shell is a symmetrical icosahedron. The virus has seven serotypes, namely A, O, C, SAT1, SAT2, SAT3 and Asia1, and there is no cross-protection reaction between the types. Type O foot-and-mouth disease virus is one of the most common and widely prevalent serotypes.

[0003] The FMDV genome encodes 4 structural proteins and 8 non-structural proteins, among which the 3D protein is a non-structural protein encoded by FMDV, which plays a key role in the replication of foot-and-mouth disease virus. It has RNA polymerase activity and can catalyze the synthesis of viral RNA. It is essential for the replication of the viral genome and the production of progeny virus particles. The 3D protein also assists the structural proteins of the virus to assemble correctly to form complete virus particles. If the function of the 3D protein is inhibited or missing, it may cause abnormal assembly of virus particles and affect the infectivity of the virus. The 3D protein plays a key role in the replication and pathogenicity of FMDV, and is of great significance for the diagnosis and prevention and control of foot-and-mouth disease. The construction of the O-type foot-and-mouth disease virus 3D mutant strain and the analysis of its biological characteristics are of great significance for a deep understanding of the pathogenic mechanism of FMDV and the formulation of prevention and control strategies.

[0004] The rise and development of FMDV reverse genetic manipulation technology has provided a convenient and powerful weapon for the research of FMD vaccines. Using this technology, people can replace, delete and modify viral genes according to their needs to save the expected recombinant virus, and have achieved great success. Study the impact of changes in the viral genome on viral function, further study the structure, function and molecular immune mechanism of the viral genome, and thus develop a new foot-and-mouth disease vaccine. Summary of the invention

[0005] In response to the above technical problems, the present invention takes the 3D protein of O-type FMDV as the research object, mutates the key sites of the 3D protein, amplifies the fragment, replaces the fragment into the O-type FMDV rescue system, and then directly transforms the competent cells to obtain the recombinant plasmid, and successfully constructs the recombinant virus strain rFMDV-M403A of the O-type FMDV 3D protein. The recombinant virus strain rFMDV-M403A has a decreased virus titer, a later time for the appearance of CPE in the cells, and can stabilize the mutation; it also greatly improves the survival rate of suckling mice, and significantly reduces the viral load and tissue lesions in the liver. The reduced pathogenicity provides the possibility for the development of a new attenuated vaccine. At the same time, the mutant strain has a certain immunogenicity and is expected to become a vaccine candidate strain. Specifically including the following contents:

[0006] In a first aspect, the present invention provides an application in preparing an attenuated foot-and-mouth disease virus recombinant strain by mutating the methionine at position 403 of the foot-and-mouth disease virus 3D protein to alanine.

[0007] Preferably, the foot-and-mouth disease virus is an O-type foot-and-mouth disease virus strain.

[0008] Preferably, the O-type foot-and-mouth disease virus strain is O / BY / CHA / 2010 strain.

[0009] In a second aspect, the present invention provides a recombinant foot-and-mouth disease virus strain, wherein the recombinant foot-and-mouth disease virus strain is a strain in which the methionine at position 403 of the 3D protein in the parent foot-and-mouth disease virus is mutated to alanine.

[0010] Preferably, the parent foot-and-mouth disease virus is an O-type foot-and-mouth disease virus strain.

[0011] Preferably, the parent foot-and-mouth disease virus is strain O / BY / CHA / 2010.

[0012] In a third aspect, the present invention provides the use of the foot-and-mouth disease recombinant virus strain described in the second aspect in the preparation of a foot-and-mouth disease vaccine.

[0013] Preferably, the foot-and-mouth disease vaccine is an attenuated vaccine.

[0014] In a fourth aspect, the present invention provides a method for preparing the recombinant foot-and-mouth disease virus strain described in the second aspect, the method comprising: mutating the methionine at position 403 of the parent foot-and-mouth disease virus 3D protein to alanine by genetic engineering means.

[0015] Preferably, the method comprises the following steps:

[0016] (1) Using the recombinant plasmid of the parental foot-and-mouth disease virus strain O / BY / CHA / 2010 as a template, the methionine 403 of the parental foot-and-mouth disease virus 3D protein was mutated to alanine by site-directed mutagenesis PCR to construct the full-length plasmid FMDV-M403A;

[0017] (2) The full-length plasmid FMDV-M403A was transfected into BHK-21 cells, and the virus was rescued to obtain the recombinant foot-and-mouth disease virus strain.

[0018] Preferably, the specific method for rescuing the virus is:

[0019] (1) 2.5 μg of the full-length plasmid FMDV-M403A was mixed with 5 μL of Lipo3000 and transfected into a monolayer of BHK-21 cells growing to 60%-90%;

[0020] (2) After transfection, place the cells in a 37°C, 5% CO2 incubator and continue culturing for 48 to 72 hours.

[0021] (3) When the cells showed 80% to 90% CPE, the samples were harvested, and after repeated freezing and thawing at -80°C for 2 to 3 times, they were continuously cultured on BHK-21 cells for 10 generations.

[0022] The beneficial effects of the present invention are as follows: the present invention mutates the 403rd methionine of the 3D protein of the O-type foot-and-mouth disease virus to alanine, and successfully constructs and rescues a mutant strain rFMDV-M403A of the 3D of the O-type foot-and-mouth disease virus by reverse genetic technology, wherein the amino acids of the recombinant virus can stably mutate during passage, and the growth rate of the mutant strain is slower than that of the wild strain, and the virus titer is significantly reduced; in individual experiments, infection of suckling mice shows that the mutant strain can increase the survival rate of suckling mice, and significantly reduce the viral load and tissue lesions in the liver. The present invention provides an attenuated recombinant strain of foot-and-mouth disease virus, which is of great significance for in-depth understanding of the pathogenic mechanism and prevention and control strategies of foot-and-mouth disease virus, and also provides an important theoretical basis for further developing genetic engineering vaccines for foot-and-mouth disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Strategy for constructing full-length cDNA infectious clones with mutations at the M403 site in the 3D protein of O-type FMDV;

[0024] Figure 2 Construction of FMDV infectious clone pcDNA3.1;

[0025] Figure 3 CPE analysis of the recombinant virus strain rFMDV-M403A and the parental strain rFMDV-WT on BHK-21 cells;

[0026] Figure 4Some identification results of the recombinant virus strain rFMDV-M403A strain and the parental strain rFMDV-WT;

[0027] Figure 5 Growth curve determination of recombinant virus strain rFMDV-M403A and parental strain rFMDV-WT;

[0028] Figure 6 Statistics of the survival rates of the recombinant virus strain rFMDV-M403A and the parental strain rFMDV-WT in suckling mice;

[0029] Figure 7 The viral load of the recombinant virus strain rFMDV-M403A and the parental strain rFMDV-WT was measured in the liver of suckling mice;

[0030] Figure 8 Differences in liver damage caused by the recombinant virus strain rFMDV-M403A and the parental strain rFMDV-WT in suckling mice. DETAILED DESCRIPTION

[0031] In order to make the technical means, creative features, objectives and effects of the present invention easy to understand, the present invention is further described below in conjunction with specific implementation methods. However, the protection scope of the present invention is not limited to the following embodiments.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0033] FMDV (O / BY / CHA / 2010) was stored by the National Reference Laboratory for Foot-and-Mouth Disease. pcDNA3.1 vector and BHK-21 cells were stored by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0034] Escherichia coli DH5α was purchased from Shenzhen Kangti Life Science Co., Ltd., restriction endonucleases (NotI, BamHI) were purchased from Thermo Fisher Scientific, USA, and DNA Marker was purchased from Beijing Qingke Biotechnology Co., Ltd. Gel recovery kit was purchased from Omega England Biolabs, USA. T4 DNA ligase was purchased from New England Biolabs. Plasmid mini-extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Lipo3000 liposome transfection reagent (L3000015) was purchased from Invitrogen. Trizol reagent and PrimeSTAR Max high-fidelity DNA polymerase were purchased from Baori Medical Biotechnology (Beijing) Co., Ltd. Reverse transcriptase was purchased from NoviZan Biotechnology Co., Ltd. DMEM cell culture medium was purchased from Invitrogen (Shanghai) Trading Co., Ltd. Fetal bovine serum (FBS) was purchased from Biological Industries (BI). 0.05% EDTA trypsin was purchased from Gibco. Tissue grinding beads (zirconia) were purchased from Wuhan Saiwei Biotechnology Co., Ltd. The probe-based one-step RT-PCR quantitative detection kit was purchased from Shanghai Biosai Biotechnology Co., Ltd.

[0035] All data involved in statistical analysis were repeated at least 3 times. The data were expressed as "mean ± standard deviation" and the statistical differences between the mean values ​​were analyzed by t-test, *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0036] Example 1 Construction of rFMDV-M403A recombinant virus strain

[0037] The present invention designs a complete 3D protein in which the methionine at position 403 of the 3D protein of FMDV is mutated to alanine, and entrusts Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize it together with the unmutated 3D protein. Construction strategy is as follows Figure 1 The specific method is as follows:

[0038] 1. Construction of full-length plasmid containing mutant amino acids

[0039] According to the full-length cDNA sequence of O-type foot-and-mouth disease virus, the target gene fragment containing one amino acid (3D M403A) mutation containing NotⅠ and BamHI restriction sites was designed and synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. After digestion with NotⅠ and BamHI endonucleases, the target fragment of about 3172 bp was recovered by gel and connected to the pcDNA3.1(+) vector to obtain the full-length plasmid FMDV-M403A containing the mutated amino acid. Figure 2As shown, the recombinant plasmid was identified by double digestion with BamHI and NotⅠ, and the target bands (3172bp and 2192bp) that were consistent with the expected size were cut out. The plasmids that were correctly identified by enzyme digestion were sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the full-length plasmid containing the mutant amino acid was successfully constructed.

[0040] 2. Rescue of recombinant virus strains

[0041] 2.5 μg of the correctly sequenced full-length plasmid FMDV-M403A and rFMDV-WT were mixed with 5 μL Lipo3000 and transfected into 60%-90% monolayer BHK-21 cells (see the kit instructions for detailed transfection steps), and normal cells were set as controls. After transfection, the cells were placed in a 37°C 5% CO2 constant temperature incubator for 48h to 72h, and the cytopathic effects (CPE) were observed daily. When about 80% to 90% of the cells showed significant CPE, the samples were harvested, and after repeated freezing and thawing at -80°C for 2 to 3 times, they were continuously propagated on BHK-21 cells for 10 generations, and the viruses were stored at -80°C for standby use.

[0042] The results are as follows Figure 3 As shown, monolayer BHK-21 cells were used for transfection when they grew to 60%-90% in a 6-well plate. Plasmids rFMDV-M403A and rFMDV-WT were transfected into BHK-21 cells and continued to be cultured in an incubator for 48 hours. The cells showed significant CPE, which was manifested as rounding and shedding of cells, and single or grape-like distribution. However, the cells inoculated with rFMDV-M403A plasmid showed CPE later, while the control cells had intact morphology and clear outlines. The virus was collected, frozen and thawed three times, and continued to be passaged on BHK-21 cells until the time of CPE was shortened and the lesions were more typical. This shows that the recombinant virus strain rFMDV-M403A with methionine mutated to alanine at position 403 of the 3D protein was successfully rescued.

[0043] 3. Identification of recombinant virus strains

[0044] RT-PCR identification: The supernatant of the recombinant virus strain with obvious CPE was repeatedly frozen and thawed, and then total RNA was extracted with trizol. After reverse transcription with reverse transcriptase, the target fragment was amplified with primers FMDV-MA-mutant-F: cctgaagctcatggagaagag and FMDV-MA-mutant-R: gcaggtaaagtgatctgtagc. After recovery, it was sent to Qingke Biotechnology Co., Ltd. for sequencing to identify the correctness of the recombinant virus strain.

[0045] In order to verify that the genome sequence of the recombinant virus strain is correct, the recombinant virus strain rFM DV-M403A of the tenth and twelfth generations was collected, and total RNA was extracted from the transfected BHK-21 cells using trizol, and specific primers were designed to amplify the gene fragment containing the 403rd amino acid by RT-PCR. The sequencing results are shown in Figure 4 As shown, the methionine at position 403 of the 3D protein of the rescued recombinant virus strain rFMDV-M403A was successfully mutated into alanine and could be stably inherited.

[0046] Example 3 Analysis of biological characteristics of the recombinant foot-and-mouth disease virus strain rFMDV-M403A

[0047] 1. Virus Passaging and Mutation Stability Testing

[0048] The correct recombinant virus strain was identified and continuously propagated on BHK-21 cells at a 5% inoculation rate to the 10th generation. The time of CPE appearance in each generation was observed and recorded. The total RNA of the 6th, 8th and 10th generation viruses was extracted by trizol extraction method, and the fragment gene was amplified by RT-PCR using primers FMDV-MA-mutant-F / FMDV-MA-mutant-R to ensure that the amino acid of the recombinant virus strain could stably mutate during the passage process. The results are as follows Figure 4 As shown, the methionine at position 403 of the 3D protein of the rescued recombinant virus strain rFMDV-M403A was successfully mutated into alanine and could be stably inherited.

[0049] 2. One-step growth curve

[0050] The monolayer BHK-21 cells were inoculated with 0.1 times the volume of the 10th generation rFMDV-M403A and rFMDV-WT virus solutions, respectively. After adsorption for 1 hour, the virus solution was discarded and replaced with fresh culture medium. Samples were taken at different time points for the determination of virus titer. The one-step virus growth curve was drawn based on the determined virus titer results.

[0051] Growth curve determination Figure 5 As shown, the replication kinetics of the recombinant virus strain rFMDV-M403A is similar to that of rFMDV-WT, but the growth rate of the recombinant virus strain rFMDV-M403A is slower than that of the wild strain, and the titer is significantly lower than that of the parent virus rFMDV-WT, but it can still effectively proliferate in the cell culture system. This indicates that the mutation of methionine to alanine at position 403 of the 3D protein of FMDV weakens the virus's ability to replicate in BHK-21 cells.

[0052] 3. Infection of suckling mice

[0053] Survival rate experiment of suckling mice: After the recombinant virus stably propagated on BHK-21 cells was diluted 1000 times with PBS buffer, it was subcutaneously injected into 2-4 day old suckling mice through the back of the neck. Ten suckling mice were injected with the recombinant virus strain rFMDV-M403A and the parent strain rFMDV-WT, and the inoculation volume was 50μL per mouse. A blank control group was set up at the same time. Observe for 8 consecutive days. Record the death of suckling mice, and draw a survival rate chart based on the lethality.

[0054] Detection of viral replication in the liver: The same recombinant virus that was stably propagated on BHK-21 cells was diluted 1000 times and injected subcutaneously into 2-4 day-old suckling mice through the back of the neck. Seven mice were injected with the recombinant virus strain rFMDV-M403A and the parental virus rFMDV-WT, with an inoculation volume of 50 μL per mouse. The mice were observed for 7 consecutive days, and the livers of mice that died midway were collected. When the mice were in a good condition on the seventh day, they were all euthanized and the livers were collected for viral load and viral pathology analysis. Tissue RNA was extracted after grinding, and the amount of viral RNA in the liver was quantified by RT-qPCR, and then handed over to Wuhan Saiweier Biotechnology Co., Ltd. for tissue pathology staining analysis.

[0055] The recombinant virus strain rFMDV-M403A and the parental strain rFMDV-WT were inoculated into suckling mice. One day after inoculation, some suckling mice inoculated with the parental rFMDV-WT showed symptoms such as difficulty breathing and stiff limbs; after 3 days, the suckling mice that showed symptoms died one after another; after 4 days, all the suckling mice died. The suckling mice inoculated with the recombinant virus strain rFMDV-M403A showed normal performance and all survived during the observation period. The survival rates of the two were as follows: Figure 6 shown.

[0056] The livers of dead and surviving suckling mice were collected for viral load determination and histopathological analysis. Figure 7 As shown in Figure 2, the viral load in the liver of suckling mice inoculated with the recombinant virus strain rFMDV-M403A was significantly reduced compared with that of suckling mice inoculated with rFMDV-WT. Figure 8 As shown, histopathological analysis revealed that large areas of necrosis and congestion were present in the liver of suckling mice infected with rFMDV-WT, whereas the extent of liver damage was less in suckling mice inoculated with the recombinant virus strain rFMDV-M403A.

[0057] The above results show that on the basis of the parental foot-and-mouth disease virus (taking O / BY / CHA / 2010 as an example), the 403rd methionine of the 3D protein was successfully mutated to alanine, and the recombinant virus strain rFMDV-M403A was constructed with significantly weaker virulence than the parental strain, which can be used as a vaccine candidate strain, providing a new idea for the preparation of foot-and-mouth disease vaccine. The O-type foot-and-mouth disease virus 3D mutant strain constructed in this study has unique biological characteristics, providing new ideas and research directions for the prevention and control of foot-and-mouth disease. Future research can focus on optimizing the performance of mutant strains, developing new vaccines, and deeply understanding the pathogenic mechanism of foot-and-mouth disease virus, making greater contributions to ensuring the healthy development of animal husbandry.

[0058] The above-mentioned embodiments are only embodiments of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that for ordinary technicians in this field, other improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. The invention relates to a method for preparing an attenuated foot-and-mouth disease virus recombinant strain by mutating the 403rd methionine of the foot-and-mouth disease virus 3D protein to alanine.

2. The use according to claim 1, characterized in that The foot-and-mouth disease virus is an O-type foot-and-mouth disease virus strain.

3. The use according to claim 2, characterized in that The O-type foot-and-mouth disease virus strain is O / BY / CHA / 2010 strain.

4. A recombinant foot-and-mouth disease virus strain, characterized in that: The foot-and-mouth disease recombinant virus strain is obtained by mutating the 403rd methionine of the 3D protein in the parent foot-and-mouth disease virus into alanine.

5. The foot-and-mouth disease recombinant virus strain according to claim 4, characterized in that The parent foot-and-mouth disease virus is an O-type foot-and-mouth disease virus strain.

6. The foot-and-mouth disease recombinant virus strain according to claim 5, characterized in that The parent foot-and-mouth disease virus is strain O / BY / CHA / 2010.

7. Use of the foot-and-mouth disease recombinant virus strain as claimed in any one of claims 4 to 6 in the preparation of a foot-and-mouth disease vaccine.

8. The use according to claim 7, characterized in that The foot-and-mouth disease vaccine is an attenuated vaccine.

9. The method for preparing a recombinant foot-and-mouth disease virus strain according to any one of claims 4 to 6, characterized in that: The method comprises: using genetic engineering means to mutate the 403rd methionine of the parent foot-and-mouth disease virus 3D protein into alanine.

10. The method according to claim 9, characterized in that The method comprises the following steps: (1) Using the recombinant plasmid of the parental foot-and-mouth disease virus strain O / BY / CHA / 2010 as a template, the methionine 403 of the parental foot-and-mouth disease virus 3D protein was mutated to alanine by site-directed mutagenesis PCR to construct the full-length plasmid FMDV-M403A; (2) The full-length plasmid FMDV-M403A was transfected into BHK-21 cells, and the virus was rescued to obtain the recombinant foot-and-mouth disease virus strain.

Images