Methionine nutrition selection marker saccharomyces cerevisiae vector as well as construction method and application thereof

Abstract

The invention discloses a methionine nutrition selection marker saccharomyces cerevisiae vector as well as a construction method and application thereof, and relates to the field of genetic engineering and synthetic biology, a methionine MET17 promoter and a coding region sequence are obtained through gene artificial synthesis, a leucine promoter and a coding region sequence in a pAG415-GAL1-ccdB vector are replaced by homologous recombination, and thus the methionine nutrition selection marker saccharomyces cerevisiae vector is obtained. A pAG415-GAL1-MET-ccdB expression vector is constructed and obtained, a ccdB gene is replaced by a green fluorescent protein reporter gene GFP sequence to be integrated into the pAG415-GAL1-MET-ccdB vector, a pAG415-GAL1-GFP-MET vector is constructed and obtained, the obtained expression vector can be used for screening exogenous gene transformants in a methionine deficient culture medium, meanwhile, green fluorescent GFP tag protein carried in the vector has the advantages that the expression vector can be applied to screening of the methionine deficient culture medium, and the expression efficiency of the methionine deficient culture medium is improved. And more application space is provided for carrying out subcellular localization, immunoprecipitation and other downstream inheritance and molecular biology analysis on a target gene in wine brewing cells.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and synthetic biology, and in particular to a methionine (Met) nutritional screening marker saccharomyces cerevisiae vector and a construction method and application thereof. Background Art

[0002] Saccharomyces cerevisiae is one of the eukaryotic model organisms. It has the characteristics of rapid reproduction, simple molecular manipulation, and clear genetic background. It is widely used in basic research, genetic engineering, and synthetic biology. The yeast expression system is an important eukaryotic expression system in current production. It expresses foreign genes by transforming them into yeast cells through suitable vectors, and secretes heterologous proteins out of the cells through the yeast's own secretory pathway. The operation procedure is simple and safe, which provides great convenience for industrial production. It is widely used in synthetic biopharmaceuticals, health foods, fine chemicals and other high-value-added natural products. Selecting a suitable expression vector is the key to ensuring the effective expression of heterologous proteins in yeast cells.

[0003] At present, a type of expression vector commonly used in Saccharomyces cerevisiae is the centromere vector (CEN), which contains a replication start site and a yeast chromosome centromere sequence, can replicate autonomously in cells, has a low copy number and can exist stably. The low copy characteristics of this type of vector effectively avoid the overexpression of the target gene, making it suitable for gene function research and expression of cytotoxic proteins. However, the types of nutritional marker screening tags carried by the current Saccharomyces cerevisiae centromere vector are relatively limited, mainly including four screening types: uracil (Ura), leucine (Leu), histidine (His), and tryptophan (Trp). There is still a lack of expression vectors with a methionine (Met) screening marker, which limits the application of multi-gene expression in Saccharomyces cerevisiae.

[0004] Therefore, it is necessary to develop a vector with a methionine (Met) nutritional selection marker, which is of great significance and value for enriching the types of centromere expression vectors and conducting multi-gene pathway research in Saccharomyces cerevisiae. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a methionine nutritional screening marker Saccharomyces cerevisiae vector and a construction method and application thereof. By developing a centromere expression vector with a methionine (Met) nutritional screening marker, a variety of options are provided for expressing foreign genes using the Saccharomyces cerevisiae system, a molecular tool is provided for conducting multi-gene pathway research, and the vector can be used to screen transformed heterologous genes under methionine (Met) deficiency conditions, thereby enriching the types of centromere expression vectors and providing more options for conducting heterologous gene expression and multi-gene pathway research in Saccharomyces cerevisiae.

[0006] To achieve the above object, the present invention provides the following technical solutions: In a first aspect, the present invention provides a methionine nutritional selection marker Saccharomyces cerevisiae vector, the vector comprising: Methionine MET17 promoter: obtained by gene synthesis from the MET17 gene of Saccharomyces cerevisiae, used to initiate transcription of downstream genes; Methionine MET17 coding region: This coding region contains the complete open reading frame of the MET17 gene, encoding an enzyme necessary for methionine synthesis; pAG415-GAL1-MET-ccdB expression vector: constructed by replacing the leucine (LEU) promoter and coding region sequence in the pAG415-GAL1-ccdB vector using homologous recombination, and used to screen positive transformants of exogenous genes under methionine (Met)-deficient culture conditions; Green fluorescent protein reporter gene GFP sequence: contains the GFP gene encoding green fluorescent protein, which is used for fluorescent labeling and localization in yeast cells; pAG415-GAL1-GFP-MET vector: The GFP sequence was amplified by PCR and replaced with the ccdB gene and integrated into the pAG415-GAL1-MET-ccdB vector.

[0007] As a further embodiment of the present invention, the methionine MET17 promoter is defined as SEQ ID NO.1; the methionine MET17 coding region is defined as SEQ ID NO.2; the pAG415-GAL1-MET-ccdB expression vector is defined as SEQ ID NO.3; the green fluorescent protein reporter gene is defined as SEQ ID NO.4; and the pAG415-GAL1-GFP-MET vector is defined as SEQ ID NO.5.

[0008] As a further embodiment of the present invention, the original vector pAG415-GAL1-ccdB of the pAG415-GAL1-MET-ccdB expression vector comprises a ccdB lethal gene for negative screening, and the vector comprises a GAL1 promoter for galactose-induced expression.

[0009] As a further embodiment of the present invention, when constructing the pAG415-GAL1-MET-ccdB expression vector, the synthetic MET17 promoter and coding region were replaced with the LEU promoter and coding region in the pAG415-GAL1-ccdB vector using the In-Fusion PCR Cloning Kit, and verified by EcoRI digestion and Sanger sequencing.

[0010] As a further scheme of the present invention, when constructing the pAG415-GAL1-GFP-MET vector, pFA6a-GFP(S65T)-kanMX6 is used as a template, the GFP gene is obtained by PCR amplification, and the GFP gene is replaced at the position of the ccdB gene in the pAG415-GAL1-MET-ccdB vector to construct the pAG415-GAL1-GFP-MET vector, which is verified by AgeI restriction digestion and Sanger sequencing.

[0011] In a second aspect, the present invention also provides a method for constructing a methionine nutritional screening marker vector for Saccharomyces cerevisiae, the steps of which are as follows: a) synthesizing or amplifying the MET17 gene from an industrial strain and obtaining the complete sequence including the promoter and coding region by PCR amplification; b) Using In-Fusion homologous recombination technology, the MET17 gene was cloned into the pAG415-GAL1-ccdB vector to replace the original selectable marker gene; c) inserting the expression cassette of the target gene into the above vector to construct a recombinant vector; d) Use the green fluorescent protein (GFP) gene as a reporter gene to verify the expression of the target gene.

[0012] As a further embodiment of the present invention, when a complete sequence including a promoter and a coding region is obtained by PCR amplification, the promoter sequence and the coding region sequence of the methionine synthesis gene MET17 are obtained by gene synthesis technology, and the promoter and the coding region of the methionine synthesis gene MET17 are PCR amplified using a high-fidelity DNA polymerase to obtain the MET17 promoter and the coding region.

[0013] As a further embodiment of the present invention, the PCR amplification conditions are: Pre-denaturation at 95°C for 5 minutes; Denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 90 seconds were cycled 27 times; The final extension was at 72°C for 7 minutes.

[0014] As a further embodiment of the present invention, the homologous recombination step is performed using an In-Fusion PCR Cloning Kit.

[0015] As a further solution of the present invention, when constructing a vector using homologous recombination technology, the MET17 promoter and coding region are cloned into the pAG415-GAL1-ccdB vector, the ccdB gene therein is replaced, and the pAG415-GAL1-MET-ccdB expression vector is constructed.

[0016] As a further solution of the present invention, when constructing a recombinant vector, the target gene is amplified by PCR and cloned into the pAG415-GAL1-MET-ccdB vector using homologous recombination technology to replace the ccdB gene and construct the pAG415-GAL1-target gene-MET vector.

[0017] As a further embodiment of the present invention, the method for constructing the methionine nutritional screening marker Saccharomyces cerevisiae vector also includes transforming Saccharomyces cerevisiae and identifying positive transformants, using Saccharomyces cerevisiae competent cells to transform the pAG415-GAL1-target gene-MET recombinant vector, spreading the transformed cells on SD-Met defective plates, culturing at 30°C for 72 hours, and identifying positive transformants by colony PCR.

[0018] As a further embodiment of the present invention, the method for constructing the methionine nutritional selection marker Saccharomyces cerevisiae vector also includes inducing expression, selecting and identifying the correct positive transformants, using SD-Met liquid selection medium for overnight culture, washing the bacteria, inoculating the bacteria in SC-Met liquid medium, and adding 2% galactose and 1% raffinose to induce expression.

[0019] In a third aspect, the present invention also provides an application of using a methionine nutritional screening marker Saccharomyces cerevisiae vector to screen transformants, the application comprising: transforming the constructed methionine nutritional screening marker Saccharomyces cerevisiae vector into Saccharomyces cerevisiae BY4741 competent cells; coating on SD-Met defective culture medium plates, and culturing at 30°C for 72 hours; screening positive transformants and identifying the correctness by PCR; using Sc-Met culture medium for galactose-induced expression, adjusting the bacterial solution concentration for culturing; and observing the expression of green fluorescent protein using a fluorescence microscope.

[0020] As a further embodiment of the present invention, the galactose-induced expression step comprises: The initial culture reached an OD600 of 1.0; Resuspend twice in Sc-Met liquid medium to remove residual glucose; 2% galactose and 1% raffinose were added to the Sc-Met medium, the bacterial concentration was adjusted to OD600 of 0.4, and the culture was carried out overnight (30°C, 200 rpm, 24 hours).

[0021] Compared with the prior art, the methionine nutritional screening marker Saccharomyces cerevisiae vector of the present invention and its construction method and application have the following beneficial effects: 1. The present invention can clearly distinguish successfully transformed yeast cells from untransformed cells through the methionine nutritional screening marker, and has a high selectivity marker. Only after the yeast cells have successfully integrated the vector carrying the methionine synthesis gene can they grow in a medium lacking methionine, thereby achieving efficient screening.

[0022] 2. The present invention uses methionine nutritional markers to simplify the screening operation, eliminating the complicated steps of using antibiotics, and the target strain can be screened out by simple culture medium selection, which greatly improves the experimental efficiency; moreover, the methionine nutritional screening marker system does not require expensive antibiotics and resistance genes, reduces the material costs of experiments and production, and significantly saves costs, especially in large-scale applications.

[0023] 3. The methionine nutritional marker vector of the present invention has high genetic stability in Saccharomyces cerevisiae and can maintain stable expression of the target gene during long-term cultivation and use, which is very important for continuous production and long-term research. Compared with antibiotic resistance markers, the methionine nutritional screening marker of the present invention eliminates the hidden danger of resistance gene contamination, especially in the food, medicine and fermentation industries, ensuring the safety and purity of the product.

[0024] 4. The methionine nutritional screening marker system of the present invention is applicable to a variety of Saccharomyces cerevisiae strains, is not limited by strain specificity, and its wide applicability enables it to play a role in multiple experimental and industrial scenarios. It is also compatible with other genetic operations and can be used in combination with technologies such as gene knockout and gene overexpression, providing greater flexibility and facilitating complex genetic engineering modifications.

[0025] In summary, the present invention obtains the centromere Saccharomyces cerevisiae expression vector pAG415-GAL1-MET-ccdB with methionine (Met) nutritional marker by amplifying and replacing the methionine (Met) promoter and coding region nucleotide sequence, which can be used to screen transformed heterologous genes under methionine (Met) deficiency conditions. At the same time, the pAG415-GAL1-GFP-MET vector was created by fusing the green fluorescent protein reporter gene GFP, and the vector was used to transform Saccharomyces cerevisiae BY4741, and positive transformants were successfully obtained under methionine (Met) screening conditions. After galactose induction expression, the strong expression of green fluorescent protein was detected using a fluorescence microscope, indicating that the created vector can be used to screen exogenous gene transformants in methionine-deficient culture medium, and at the same time, the GFP tag protein carried by the vector can be used to carry out downstream molecular biological analysis experiments such as subcellular localization and immunoprecipitation of target genes in brewing cells. The methionine (Met) screening marker centromere vector created by the present invention provides a wider range of application possibilities for carrying out exogenous gene expression and multi-gene pathway research in Saccharomyces cerevisiae.

[0026] In order to more clearly illustrate the structural features and effects of the present invention, the present invention is described in detail below in conjunction with specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The diagrams are the recombinant vector maps of the present invention; (A) is a schematic diagram of the pAG415-GAL1-MET-ccdB recombinant vector map; (B) is a schematic diagram of the pAG415-GAL1-GFP-MET recombinant vector map.

[0028] Figure 2 The figures are enzyme digestion identification diagrams of the recombinant vectors of the present invention; (A) enzyme digestion identification diagram of pAG415-GAL1-MET-ccdB vector; wherein, lane 1: before digestion; lane 2: EcoRI digestion; lane 3: DL10000 marker; (B) enzyme digestion identification diagram of pAG415-GAL1-GFP-MET vector; wherein, lane 1: before digestion; lane 2: AgeI digestion; lane 3: DL10000 marker.

[0029] Figure 3 The figure shows the positive clones of Saccharomyces cerevisiae BY4741 transformed by the pAG415-GAL1-GFP-MET vector of the present invention.

[0030] Figure 4 The expression diagram of the reporter gene green fluorescent protein GFP in the Saccharomyces cerevisiae cells observed by fluorescence microscopy in the present invention; wherein, (AB) bright field (A) field of view and green fluorescent protein field of view (B) of yeast cells transformed with pAG415-GAL1-GFP-MET vector; (CD) bright field (C) field of view and green fluorescent protein field of view (D) of blank wild-type BY4741 yeast; parameters: excitation wavelength 488 nm, absorption wavelength 510 nm, observation using 100x oil objective. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0032] In order to solve the problem that the types of centromere expression vectors in existing Saccharomyces cerevisiae are limited and there is a lack of vectors with a methionine (Met) screening marker, the present invention provides a methionine nutritional screening marker Saccharomyces cerevisiae vector and a construction method and application thereof. By amplifying and replacing the methionine (Met) promoter and the nucleotide sequence of the coding region, a centromere Saccharomyces cerevisiae expression vector pAG415-GAL1-MET-ccdB with a methionine (Met) nutritional marker is obtained, which can be used to screen transformed heterologous genes under methionine (Met) deficiency conditions. At the same time, the pAG415-GAL1-GFP-MET vector was created by fusing the green fluorescent protein reporter gene GFP, and the vector was used to transform the brewer's yeast BY4741. Positive transformants were successfully obtained under methionine (Met) screening conditions, and after galactose induction expression, the strong expression of green fluorescent protein was detected using a fluorescence microscope, indicating that the created vector can be used to screen exogenous gene transformants in methionine-deficient culture medium. At the same time, the GFP tag protein carried by the vector can be used to carry out downstream molecular biological analysis experiments such as subcellular localization and immunoprecipitation of target genes in brewer's cells. The methionine (Met) screening marker centromere vector created by the present invention provides a wider range of application possibilities for conducting exogenous gene expression and multi-gene pathway research in brewer's yeast.

[0033] See also Figures 1 to 4 As shown, the present invention provides a methionine nutritional screening marker Saccharomyces cerevisiae vector, which includes: a methionine MET17 promoter: obtained from the MET17 gene of Saccharomyces cerevisiae by artificial gene synthesis, and used to start the transcription of downstream genes; a methionine MET17 coding region: the coding region contains a complete open reading frame of the MET17 gene, encoding an enzyme necessary for methionine synthesis; a pAG415-GAL1-MET-ccdB expression vector: constructed by replacing the leucine (LEU) promoter and coding region sequence in the pAG415-GAL1-ccdB vector using homologous recombination, and used to screen positive transformants of exogenous genes under methionine (Met)-deficient culture conditions; a green fluorescent protein reporter gene GFP sequence: containing a GFP gene encoding a green fluorescent protein, and used for fluorescent labeling and positioning in yeast cells; a pAG415-GAL1-GFP-MET vector: constructed by amplifying the GFP sequence by PCR and replacing the ccdB gene and integrating it into the pAG415-GAL1-MET-ccdB vector.

[0034] In this embodiment, the methionine MET17 promoter is defined as SEQ ID NO.1; the methionine MET17 coding region is defined as SEQ ID NO.2; the pAG415-GAL1-MET-ccdB expression vector is defined as SEQ ID NO.3; the green fluorescent protein reporter gene is defined as SEQ ID NO.4; and the pAG415-GAL1-GFP-MET vector is defined as SEQ ID NO.5.

[0035] The present invention obtains the methionine MET17 promoter (SEQ ID NO.1) and coding region (SEQ ID NO.2) sequences by artificial gene synthesis. Subsequently, the leucine (LEU) promoter and coding region sequences in the pAG415-GAL1-ccdB vector are replaced by homologous recombination to construct the pAG415-GAL1-MET-ccdB expression vector (SEQ ID NO.3), which can be used to screen positive transformants of exogenous genes under methionine (Met)-deficient culture conditions. Subsequently, the green fluorescent protein reporter gene GFP sequence (SEQ ID NO.4) was integrated into the pAG415-GAL1-MET-ccdB vector instead of the ccdB gene to further construct the pAG415-GAL1-GFP-MET vector (SEQ ID NO.5). The vector was transformed into Saccharomyces cerevisiae BY4741, subjected to methionine (Met) deficiency screening and galactose-induced expression, and the yeast positive transformed cells were detected to emit bright green fluorescence using a fluorescence microscope, indicating that the expression vector obtained by the present invention can be used to screen exogenous gene transformants in a methionine-deficient culture medium. At the same time, the green fluorescent GFP tag protein carried in the vector provides more application space for downstream genetic and molecular biological analysis such as subcellular localization and immunoprecipitation of the target gene in brewer's cells.

[0036] In this example, the original vector pAG415-GAL1-ccdB of the pAG415-GAL1-MET-ccdB expression vector contains the ccdB lethal gene for negative screening, and the vector includes the GAL1 promoter for galactose-induced expression; when the pAG415-GAL1-MET-ccdB expression vector is constructed, In-Fusion PCR Cloning is used. Kit was used to replace the LEU promoter and coding region in the pAG415-GAL1-ccdB vector with the synthesized MET17 promoter and coding region, which were verified by EcoRI digestion and Sanger sequencing. When constructing the pAG415-GAL1-GFP-MET vector, pFA6a-GFP(S65T)-kanMX6 was used as a template, and the GFP gene was obtained by PCR amplification. The GFP gene was replaced at the ccdB gene position in the pAG415-GAL1-MET-ccdB vector to construct the pAG415-GAL1-GFP-MET vector, which was verified by AgeI digestion and Sanger sequencing.

[0037] The embodiment of the present invention also provides a method for constructing a methionine nutritional screening marker Saccharomyces cerevisiae vector. The materials prepared before the preparation method is implemented include: Saccharomyces cerevisiae BY4741 (MATahis3Δ1 leu2 met15Δura3-52) is a strain maintained in our laboratory.

[0038] YPD medium: peptone (20 g / L), yeast extract powder (10 g / L), 0.2% adenine, glucose (20 g / L).

[0039] SD-Met-nutrient-deficient medium: YNB (yeast nitrogen base, without amino acids) 6.7 g / L, DOSuplement-Met 0.78 g / L, glucose 20 g / L. If it is a solid medium, add 20 g / L agar powder.

[0040] SC-Met-nutrient-deficient induction medium: YNB (yeast nitrogen base, without amino acids) 6.7 g / L, DOSuplement-Met 0.78 g / L, galactose 20 g / L, raffinose 10 g / L.

[0041] The method for constructing the methionine nutritional selection marker Saccharomyces cerevisiae vector of this embodiment comprises the following steps: (1) Artificial synthesis of MET17 gene and construction of pAG415-GAL1-MET-ccdB yeast expression vector: The nucleotide sequences of the methionine MET17 promoter (SEQ ID NO.1) and the coding region (SEQ ID NO.2) were obtained by artificial gene synthesis (Beijing Liuhe BGI).

[0042] The synthesized MET17 promoter and coding region nucleotide sequence were used as templates, and high-fidelity DNA polymerase (P505-d1, Novazon) was used to obtain MET17Pro::MET17 products by PCR amplification. The PCR amplification conditions were as follows: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 90s, 27 cycles; and finally 72℃ extension for 7min. The commercial In-Fusion PCR Cloning Kit (638956, Clontech) was used to clone into pAG415-GAL1-ccdB by homologous recombination to replace the original leucine (LEU) promoter and coding region sequence, and the pAG415-GAL1-MET-ccdB expression vector (SEQ ID NO.3, Figure 1 A). Identification by EcoRI digestion ( Figure 2 A) Sanger sequencing analysis was performed to verify the correctness of the sequence. The obtained target vector can be used to screen positive transformants of exogenous genes under methionine (Met)-deficient culture conditions.

[0043] (2) Construction of pAG415-GAL1-GFP-MET recombinant vector and transformation of Saccharomyces cerevisiae BY4741: Using the vector pFA6a-GFP(S65T)-kanMX6 stored in the laboratory as a template, a high-fidelity DNA polymerase (P505-d1, Norwegian) was used to obtain the green fluorescent protein reporter gene GFP (SEQ ID NO. 4) by PCR amplification. The PCR amplification conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 40 s, 28 cycles; and finally 72°C extension for 7 min. Using the In-Fusion PCR Cloning Kit (638956, Clontech), GFP was cloned into the vector pAG415-GAL1-MET-ccdB obtained in step (1) and the ccdB gene was replaced to obtain the pAG415-GAL1-GFP-MET destination vector (SEQ ID NO. 4, Figure 1 B), enzyme digestion identification by AgeI ( Figure 2 B) Sanger sequencing analysis was performed simultaneously to verify the correctness of the sequence.

[0044] Among them, the pAG415-GAL1-GFP-MET recombinant vector was transformed by using Saccharomyces cerevisiae BY4741 competent cells. For specific methods, please refer to the BY4741 Chemical Competent Cell product manual (YC1060, Weidi). The transformed cells were coated on SD-Met defective plates, and obvious yeast colony growth was observed after culturing at 30°C for 72 hours ( Figure 3 Yeast positive transformants were identified by colony PCR. The PCR amplification conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 45 s, 34 cycles; and finally 72°C extension for 7 min.

[0045] (3) Galactose-induced expression in Saccharomyces cerevisiae cells: Select the correctly identified pAG415-GAL1-GFP-MET positive yeast transformation strain and culture it overnight in SD-Met liquid selection medium (30°C, 200rpm). When the bacterial solution concentration OD600 reaches 1.0, collect the bacteria by centrifugation (5000g, 5min, room temperature). Then carefully resuspend and wash the bacteria with Sc-Met liquid medium, and centrifuge again (5000g, 5min, room temperature). Repeat this operation twice to remove the residual glucose in the bacteria as much as possible to avoid inhibiting the induction effect of galactose. Subsequently, the bacteria were resuspended and inoculated in Sc-Met liquid medium, and 2% galactose and 1% raffinose were added to induce expression. Note that the bacterial solution concentration after inoculation was adjusted to 0.4, and cultured overnight in a shaker (30°C, 200rpm), and observed and detected after 24h.

[0046] (4) Detect the expression of reporter gene green fluorescent protein GFP by fluorescence microscopy: Pipette 10 uL of the yeast solution induced by galactose in step (3), spread it evenly on the slide, and carefully cover it with a coverslip for fluorescence microscopy observation. During the operation, pay attention to shielding from light to prevent fluorescence quenching. Then, use an upright fluorescence microscope (BX51, Olympus) for observation, with the parameters: excitation wavelength 488 nm, absorption wavelength 510 nm. The untransformed blank yeast BY4741 was used as a control. The results are shown in Figure 2. Figure 4 As shown, brewer's yeast cells transformed with pAG415-GAL1-GFP-MET emit strong fluorescence, while blank yeast has almost no fluorescence, indicating the effectiveness of the constructed vector pAG415-GAL1-GFP-MET, proving that the vector can be used to screen exogenous gene transformants in methionine-deficient culture medium. At the same time, the green fluorescent GFP tag protein carried in the vector provides application possibilities for downstream molecular biology analysis such as subcellular localization and immunoprecipitation of target genes in brewer's cells.

[0047] An embodiment of the present invention also provides an application of using a methionine nutritional screening marker Saccharomyces cerevisiae vector to screen transformants, the application comprising: transforming the constructed methionine nutritional screening marker Saccharomyces cerevisiae vector into Saccharomyces cerevisiae BY4741 competent cells; coating on SD-Met defective culture medium plates, and culturing at 30°C for 72 hours; screening positive transformants and identifying the correctness through PCR; using Sc-Met culture medium for galactose-induced expression, adjusting the bacterial solution concentration for culturing; and observing the expression of green fluorescent protein using a fluorescence microscope.

[0048] The galactose-induced expression step includes: the initial culture reaches an OD600 of 1.0; resuspending twice using Sc-Met liquid culture medium to remove residual glucose; adding 2% galactose and 1% raffinose to the Sc-Met culture medium, adjusting the bacterial liquid concentration to OD600 of 0.4, and culturing overnight (30°C, 200rpm, 24 hours).

[0049] In summary, the methionine nutritional screening marker Saccharomyces cerevisiae vector of the present invention and its construction method and application can clearly distinguish successfully transformed yeast cells from untransformed cells through the methionine nutritional screening marker, and has a high selectivity marker. Only after the yeast cells successfully integrate the vector with the methionine synthesis gene can they grow in a culture medium lacking methionine, thereby realizing efficient screening; the present invention uses the methionine nutritional marker to simplify the screening operation, avoids the complicated step of using antibiotics, and can screen out the target strain through simple culture medium selection, which greatly improves the experimental efficiency; moreover, the methionine nutritional screening marker system does not require expensive antibiotics and resistance genes, reduces the material cost of experiments and production, and significantly saves costs in large-scale applications; the methionine nutritional marker vector of the present invention has high genetic stability in Saccharomyces cerevisiae, and can maintain stable expression of the target gene during long-term culture and use, which is very important for continuous production and long-term research. Compared with antibiotic resistance markers, the methionine nutritional screening marker of the present invention eliminates the hidden danger of resistance gene contamination, especially in the food, medicine and fermentation industries, ensuring the safety and purity of products; the methionine nutritional screening marker system of the present invention is applicable to a variety of Saccharomyces cerevisiae strains, is not limited by strain specificity, and its wide applicability enables it to play a role in multiple experimental and industrial scenarios. It can also be compatible with other genetic operations and can be used in combination with technologies such as gene knockout and gene overexpression, providing greater flexibility and facilitating complex genetic engineering transformation.

[0050] It should be noted that, in the present invention, SEQ ID NO: (1) MET17 promoter sequence is: ttattttttgctttttctcttgaggtcacatgatcgcaaaatggcaaatggcacgtgaagctgtcgatattggggaactgtggtggttggcaaatgactaattaagttagtcaaggcgccatcctcatgaaaactgtgtaacataataaccgaagtgtcgaaaaggtggcaccttgtccaattgaacacgctcgatgaaaaaaataagatatatataaggttaagtaaagcgtctgttagaaaggaagtttttcctttttcttgctctcttgtcttttcatctactatttccttcgtgtaatacagggtcgtcagatacatagatacaattctattacccccatccataca。

[0051] SEQ ID NO: (2) The MET17 sequence is as follows:

[0052] SEQ ID NO: (3) pAG415-GAL1-MET-ccdB vector sequence is:

[0053] SEQ ID NO: (4) The GFP sequence is as follows: ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCACTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAG.

[0054] SEQ ID NO: (5) The pAG415-GAL1-GFP-MET vector sequence is as follows:

[0055] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge scope of ordinary technicians in this field without departing from the purpose of the present invention.

Claims

1. A methionine nutritional selection marker Saccharomyces cerevisiae vector, characterized in that: The methionine nutritional screening marker cerevisiae vector comprises: Methionine MET17 promoter: obtained by gene synthesis from the MET17 gene of Saccharomyces cerevisiae, used to initiate transcription of downstream genes; Methionine MET17 coding region: This coding region contains the complete open reading frame of the MET17 gene, encoding an enzyme necessary for methionine synthesis; pAG415-GAL1-MET-ccdB expression vector: constructed by replacing the leucine promoter and coding region sequence in the pAG415-GAL1-ccdB vector using homologous recombination, and used to screen positive transformants of exogenous genes under methionine-deficient culture conditions; Green fluorescent protein reporter gene GFP sequence: contains the GFP gene encoding green fluorescent protein, which is used for fluorescent labeling and localization in yeast cells; pAG415-GAL1-GFP-MET vector: The GFP sequence was amplified by PCR and replaced with the ccdB gene and integrated into the pAG415-GAL1-MET-ccdB vector.

2. The methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 1, characterized in that: The methionine MET17 promoter is defined as SEQ ID NO.1; the methionine MET17 coding region is defined as SEQ ID NO.2; the pAG415-GAL1-MET-ccdB expression vector is defined as SEQ ID NO.3; the green fluorescent protein reporter gene is defined as SEQ ID NO.4; and the pAG415-GAL1-GFP-MET vector is defined as SEQ ID NO.

5.

3. The methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 2, characterized in that: The original vector pAG415-GAL1-ccdB of the pAG415-GAL1-MET-ccdB expression vector contains the ccdB lethal gene for negative selection, and the vector includes the GAL1 promoter for galactose-inducible expression.

4. The methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 3, characterized in that: When constructing the pAG415-GAL1-MET-ccdB expression vector, the synthetic MET17 promoter and coding region were replaced with the LEU promoter and coding region in the pAG415-GAL1-ccdB vector using the In-Fusion PCR Cloning Kit, and the expression was verified by EcoRI digestion and Sanger sequencing.

5. The methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 4, characterized in that: When constructing the pAG415-GAL1-GFP-MET vector, pFA6a-GFP(S65T)-kanMX6 was used as a template, and the GFP gene was obtained by PCR amplification. The GFP gene was replaced at the position of the ccdB gene in the pAG415-GAL1-MET-ccdB vector to construct the pAG415-GAL1-GFP-MET vector, which was verified by AgeI digestion and Sanger sequencing.

6. A method for constructing a methionine nutritional screening marker Saccharomyces cerevisiae vector according to any one of claims 1 to 5, characterized in that: Here are the steps: a) synthesizing or amplifying the MET17 gene from an industrial strain and obtaining the complete sequence including the promoter and coding region by PCR amplification; b) Using In-Fusion homologous recombination technology, the MET17 gene was cloned into the pAG415-GAL1-ccdB vector to replace the original selectable marker gene; c) inserting the expression cassette of the target gene into the above vector to construct a recombinant vector; d) Use green fluorescent protein gene as a reporter gene to verify the expression of the target gene.

7. The method for constructing a methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 6, characterized in that: When a complete sequence including a promoter and a coding region is obtained by PCR amplification, the promoter sequence and the coding region sequence of the methionine synthesis gene MET17 are obtained by gene synthesis technology, and the promoter and the coding region of the methionine synthesis gene MET17 are PCR amplified using a high-fidelity DNA polymerase to obtain the MET17 promoter and the coding region.

8. The method for constructing the methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 7, characterized in that: When constructing a vector using homologous recombination technology, the MET17 promoter and coding region are cloned into the pAG415-GAL1-ccdB vector, replacing the ccdB gene therein, and constructing the pAG415-GAL1-MET-ccdB expression vector; when constructing a recombinant vector, the target gene is amplified by PCR and cloned into the pAG415-GAL1-MET-ccdB vector using homologous recombination technology, replacing the ccdB gene, and constructing the pAG415-GAL1-target gene-MET vector.

9. The method for constructing a methionine nutritional screening marker Saccharomyces cerevisiae vector according to claim 8, characterized in that: The method for constructing the methionine nutritional screening marker Saccharomyces cerevisiae vector also includes transforming Saccharomyces cerevisiae and identifying positive transformants, using Saccharomyces cerevisiae competent cells to transform the pAG415-GAL1-target gene-MET recombinant vector, coating the transformed cells on SD-Met defective plates, culturing at 30° C. for 72 hours, and identifying positive transformants by colony PCR.

10. A use of the methionine nutritional selection marker Saccharomyces cerevisiae vector according to any one of claims 1 to 5 to achieve induction expression of a target gene in Saccharomyces cerevisiae, characterized in that: The application includes: transforming the constructed methionine nutritional selection marker Saccharomyces cerevisiae vector into Saccharomyces cerevisiae BY4741 competent cells; spreading on SD-Met defective culture medium plates and culturing at 30°C for 72 hours; screening positive transformants and identifying the correctness through PCR; using Sc-Met culture medium for galactose-induced expression and adjusting the bacterial liquid concentration for cultivation; and using a fluorescence microscope to observe the expression of green fluorescent protein.

Images