Method for identifying compound for inhibiting synthesis of vomitoxin from wheat stem rot pathogen

Abstract

The invention belongs to the technical field of agricultural microorganisms, and particularly relates to a method for identifying a compound for inhibiting synthesis of vomitoxin from wheat stem rot pathogen. The method comprises the following steps: cloning an open expression cassette of a key catalytic enzyme gene FpgTri4 in a process of biologically synthesizing vomitoxin by pathogenic bacteria, constructing recombinant expression plasmids from the open expression cassette, and transduction the recombinant expression plasmids into a Fusarium pseudograminearum strain to induce expression to generate toxosome; and the inhibitor with inhibition on the generation of vomitoxin can inhibit the generation of toxosome in the recombinant strain, so that the related inhibitor can be screened by using the method. The method disclosed by the invention is rapid, simple and easy to implement, can be used for high-throughput screening, explores compounds capable of preventing diseases and controlling toxicity, and has important significance on scientific prevention and treatment of wheat stem rot.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural microorganisms. Specifically, the present invention relates to a method for identifying a compound that inhibits the synthesis of vomitoxin of wheat stem rot fungus. Background Art

[0002] In recent years, wheat crown rot (Fusarium crown rot, FCR) is a fungal disease that seriously harms wheat growth, which can easily cause large-scale wheat yield reduction and seriously threaten food security. Fusarium pseudograminearum ) is the main pathogen that causes wheat stem rot. After infecting wheat, the pathogen not only causes necrosis of wheat stem base and root tissue cells, but also synthesizes a variety of fungal toxins in wheat, such as deoxynivalenol (DON) and its acetylated derivatives 3-ADON, 15-ADON and fusarium enoyl alcohol (NIV). Among them, DON is the most toxic and harmful. The toxin significantly inhibits the biosynthesis of plant and animal proteins, has strong cytotoxicity and embryotoxicity, and can cause human esophageal cancer, kidney disease, miscarriage in pregnant women, etc. In severe cases, it can even directly cause death. DON has stable chemical properties, is easily soluble in water, and is generally difficult to degrade naturally. Even if high temperatures exceeding 150°C are used during food processing, only a small amount of degradation occurs. DON has been identified by the Food and Agriculture Organization of the United Nations (FAO) and the World Health Organization (WHO) as one of the "most dangerous naturally occurring food contaminants."

[0003] At present, there is no wheat variety that is immune or highly resistant to wheat stem rot in agricultural production. The use of fungicides is still the main measure to prevent and control the disease. Although some fungicides can inhibit the growth of pseudograminearum Fusarium to a certain extent, they stimulate the pathogen to synthesize a large amount of vomitoxin, which brings great challenges to the prevention and control of wheat stem rot. CN202010237745.5 discloses mixing bergamot volatile oil, camellia oil and lactoferrin solution, and mixing to obtain a nanoemulsion of Guang bergamot volatile oil, which can be used in feed to inhibit the production of vomitoxin by Fusarium graminearum in feed. However, the method of rapid screening of compounds that have an inhibitory effect on the production of toxins by wheat stem rot fungi, and the discovery of compounds that can both prevent diseases and control toxins, still requires further research. Summary of the invention

[0004] Technical Solution

[0005] The inventors have discovered a method for rapidly identifying compounds that inhibit the synthesis of vomitoxin of wheat stem rot fungi through extensive research. The method is simple and easy to implement, provides a basis for the discovery and development of related inhibitory compounds, and is of great significance for the scientific prevention and control of wheat stem rot.

[0006] Specifically, the present invention provides a method for identifying a compound that inhibits the synthesis of vomitoxin by wheat stem rot fungus, the method comprising: (1) adding the inhibitor to a vomitoxin induction culture system, wherein the vomitoxin induction culture system contains a strain containing a recombinant expression plasmid for synthesizing vomitoxin catalytic enzyme and a vomitoxin induction medium; and (2) detecting the inhibitor's ability to inhibit the strain's production of vomitoxin.

[0007] In one embodiment, the vomitoxin catalyzing enzyme is FpgTri4; In one embodiment, the recombinant expression plasmid is FpgTri4-RFP, which is formed by connecting the FpgTri4 gene fragment and the linearized neo-pYF11-RFP.

[0008] In one embodiment, the FpgTri4 gene fragment is prepared by PCR amplification from the genomic DNA of wheat stem rot pathogen using primers, wherein the forward primer FpgTri4-RFP-F is shown in SEQ ID NO.1; the reverse primer FpgTri4-RFP-R is shown in SEQ ID NO.2.

[0009] In one embodiment, the strain is Fusarium graminearum.

[0010] In one embodiment, the vomitoxin induction medium is TBI medium; the preparation of TBI medium is sucrose 30 g, putrescine hydrochloride 1.5 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, KCl 0.5 g, FeSO4·7H2O 10 mg, trace element solution 200 μL, deionized water to 1 L, pH 4.5.

[0011] In one aspect of the present invention, the present invention also discloses a compound reagent for identifying a compound that inhibits the synthesis of vomitoxin by wheat stem rot fungus, the reagent comprising a strain of a recombinant expression plasmid that synthesizes vomitoxin catalytic enzyme and a vomitoxin induction medium.

[0012] In one embodiment, the recombinant expression plasmid contains a FpgTri4 gene fragment; preferably, the FpgTri4 gene fragment contains a FpgTri4 open expression frame. Beneficial Effects

[0013] The present invention clones the FpgTri4 open expression frame and constructs a recombinant expression plasmid, which is transduced into the pseudograminearum Fusarium strain to induce expression and produce toxin bodies, and the inhibitor that inhibits the production of vomitoxin can inhibit the generation of toxin bodies in the recombinant strain. Therefore, the method can be used to screen related inhibitors. The method of the present invention is fast, simple and easy to implement, can be used for high-throughput screening, and can discover compounds that can both prevent diseases and control toxins, which is of great significance for the scientific prevention and control of wheat stem base rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :The cell structure of wheat stem rot pathogen during toxin production; Figure 2 : The inhibitory effects of carbendazim, tebuconazole, cyproconazole, triflupyridam and fludioxonil on the toxin production of wheat stem rot pathogen.

[0015] Figure 3 : Relative fluorescence intensity of FpgTri4-RFP after treatment with carbendazim, tebuconazole, cyproconazole, trifluopyramide and fludioxonil. DETAILED DESCRIPTION

[0016] The present invention is further described below in conjunction with specific embodiments. Example 1 1. Materials and Methods 1.1 Test compounds and wheat stem rot pathogen

[0017] The purity of the test compound should be greater than 90% of the original drug. The original drug was dissolved in dimethyl sulfoxide (DMSO) or 0.1 mol / L hydrochloric acid, and stored in a medicine bottle after volume adjustment. The bottle was sealed with a sealing film and stored in a refrigerator at 4°C. Dilute to various concentrations before use. The wheat stem rot pathogen was the pseudograminearum Fusarium strain Fpg12 donated by Associate Researcher Zhang Hao from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. 1.2 Test culture medium

[0018] The components of PDA medium were 200 g peeled potato, 20 g glucose, 15 g agar powder, and deionized water diluted to 1 L, with natural pH; the components of YEPD medium were 20 g glucose, 3 g yeast extract, 10 g peptone, and deionized water diluted to 1 L, with pH 7.0; the components of TBI medium were 30 g sucrose, 1.5 g putrescine hydrochloride, 1 g KH2PO4, 0.5 g MgSO4·7H2O, 0.5 g KCl, 10 mg FeSO4·7H2O, 200 μL trace element solution, and deionized water diluted to 1 L, with pH 4.5. 1.3 Construction of expression strain Fpg12:Tri4-RFP

[0019] The complete gene sequence of FpgTri4 (accession number: FPSE_12162), a key catalytic enzyme in the biosynthesis of vomitoxin by Fusarium graminearum, was retrieved from the fungal genome database (http: / / fungi.ensembl.org / index.html). 5'- ACTCACTATAGGGCGAATTGGGTACTCAAATTGGTT AAGGCGCTCCAAGATTCGTAG-3' (FpgTri4-RFP-F, SEQ ID NO. 1) and 5'- CATGAACTCCTTGATGACGTCCTCGGAGGAGGCCAT CAAAGCCTTGAGAACCTTGAC-3' (FpgTri4-RFP-R, SEQ ID NO.2), PCR amplified the full-length DNA fragment from the promoter region of the gene FpgTri4 to the open reading frame; then the purified full-length DNA fragment and the linearized vector neo-pYF11-RFP were co-transformed into XK-125 yeast cells using a yeast transformation kit to construct the recombinant plasmid FpgTri4-RFP. The recombinant plasmid FpgTri4-RFP was extracted from the positive yeast and transformed into Escherichia coli DH5α for propagation. The recombinant plasmid was extracted in large quantities from Escherichia coli, transformed into the pseudograminearum Fusarium strain Fpg12 by polyethylene glycol-mediated protoplasts, and the expression strain Fpg12∷Tri4-RFP was screened on PDA medium containing 100 μg / mL G418. 1.4 Induction of DON in wheat stem rot pathogen

[0020] The wheat stem rot pathogen expression strain Fpg12:Tri4-RFP was cultured on PDA medium for 3 days, and 5 bacterial cakes with a diameter of 0.5 cm were punched at the edge of the colony with a sterilized stainless steel puncher, inoculated into 200 mL YEPD medium, and cultured in a shaker at 25°C, 180 r / min, and a photoperiod of 12 L:12 D for 24 h. A bacterial ball was drawn from the YEPD culture medium into a 2 mL sterile centrifuge tube, and a 5 mm diameter steel ball and 1 mL TBI medium were added, and the tube was placed in a multi-sample tissue grinder at 65 Hz for 1 min of oscillation; 100 μL of mycelial homogenate was inoculated into a 50 mL triangular flask containing 30 mL TBI medium, and the compound was added to make its final concentration the EC value for inhibiting the growth of wheat stem rot pathogen. 50 At the same time, a blank control group was set up and cultured in a shaker at 25℃, 180 r / min in the dark for 36 h. 1.5 Observation of the toxin-producing structure of wheat stem rot pathogen

[0021] The mycelium induced to produce toxins in 1.4 was aspirated, and the intensity of the red fluorescence signal was observed using a laser confocal microscope with an objective lens of 60×1.40 Oil DIC N2 and an excitation wavelength of 561 nm, and images were collected. 2. Results and Analysis

[0022] 2.1 Toxin production structure of wheat stem rot pathogen The wheat stem rot pathogen expressing strain Fpg12:Tri4-RFP was cultured in non-toxigenic medium YEPD and inducing toxigenic medium TBI for 36 days. Laser confocal microscopy revealed that no red fluorescence signal was observed in the hyphae under YEPD conditions, while in TBI the hyphae emitted strong red fluorescence, and the red fluorescent protein Tri4-RFP appeared as small vesicles, namely "toxigenic bodies" (see Figure 1 ). The results indicate that during the toxin production process of wheat stem rot pathogen, a special vesicle-like toxin-producing structure (toxin-producing body) is formed, and the key catalytic enzyme Tri4 for the biosynthesis of vomitoxin is concentrated in the toxin-producing body. The higher the protein expression of the catalytic enzyme Tri4, the stronger the red fluorescence signal, the more toxin-producing bodies are formed, and the more vomitoxin is produced by wheat stem rot pathogen.

[0023] 2.2 Inhibitory effects of different compounds on toxin production by wheat stem rot pathogen By observing the intensity of red fluorescence and the number of toxin-producing bodies in the expression strain Fpg12∷Tri4-RFP, representative compounds from five common fungicides were selected, namely, the benzimidazole fungicide carbendazim, the triazole fungicide tebuconazole, the cyanoacrylate fungicide cyproconazole, the succinate dehydrogenase inhibitor trifluopyramide, and the histidine kinase signaling pathway activator fludioxonil, to detect their inhibitory effects on the toxin production of wheat stem rot pathogens. The results showed that compared with the control group, the red fluorescence intensity in the bacteria treated with carbendazim increased significantly, and the number of toxin bodies increased significantly; the red fluorescence intensity and the number of toxin bodies in the bacteria treated with tebuconazole also increased; the red fluorescence intensity in the bacteria treated with cyproconazole, trifluopyramide and fludioxonil became significantly weaker, and the formation of toxin bodies was blocked, and normal toxin bodies could not be formed (see Figure 2-Figure 3 ). The results showed that carbendazim and tebuconazole would stimulate the production of toxins by wheat stem rot pathogen, while cyproconazole, triflupyridamole and fludioxonil had excellent inhibitory effects on the production of toxins by wheat stem rot pathogen.

[0024] In summary, the present invention constructs a recombinant plasmid FpgTri4-RFP of the key catalytic enzyme gene for the biosynthesis of vomitoxin and transduces it into the strain of Pseudofusorium graminearum, confirming that the expression state of FpgTri4-RFP can be used to indicate the production of vomitoxin of Pseudofusorium graminearum, and different types of compounds have different abilities to inhibit the production of vomitoxin of Pseudofusorium graminearum. The method of the present invention can be used to quickly screen and identify inhibitors that inhibit the biosynthesis of vomitoxin by Pseudofusorium graminearum. The method of the present invention is simple and easy to operate, has a short screening time, can be used for high-throughput screening, and is of great significance for the scientific prevention and control of wheat stem base rot.

[0025] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the scope of protection determined by the claims submitted for the present invention.

Claims

1. A method for identifying a compound that inhibits the synthesis of vomitoxin by wheat stem rot fungus, characterized in that: The method comprises: (1) adding an inhibitor to a vomitoxin induction culture system, wherein the vomitoxin induction culture system contains a strain of a recombinant expression plasmid for synthesizing vomitoxin catalytic enzyme and a vomitoxin induction culture medium; (2) Detect the inhibitor’s ability to inhibit the strain’s production of vomitoxin.

2. The method according to claim 1, characterized in that The deoxynivalenol catalyzing enzyme is FpgTri4.

3. The method according to claim 1, characterized in that The recombinant expression plasmid is FpgTri4-RFP, which is formed by connecting the FpgTri4 gene fragment and the linearized neo-pYF11-RFP plasmid.

4. The method according to claim 3, characterized in that The FpgTri4 gene fragment is prepared by PCR amplification from the genomic DNA of Fusarium graminearum using primers, wherein the forward primer FpgTri4-RFP-F is shown in SEQ ID NO.1; and the reverse primer FpgTri4-RFP-R is shown in SEQ ID NO.

2.

5. The method according to claim 1, characterized in that The strain is Pseudomonas graminearum.

6. The method according to claim 1, characterized in that The deoxynivalenol induction medium is TBI medium; the preparation of TBI medium is sucrose 30 g, putrescine hydrochloride 1.5 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, KCl 0.5 g, FeSO4·7H2O 10 mg, trace element solution 200 μL, deionized water to 1 L, pH 4.

5.

7. A compound reagent for identifying the inhibition of the synthesis of vomitoxin of wheat stem rot fungus, characterized in that: The reagents include a strain containing a recombinant expression plasmid for synthesizing vomitoxin catalytic enzyme and a vomitoxin induction medium.

8. The reagent according to claim 7, characterized in that The recombinant expression plasmid contains the FpgTri4 gene fragment; preferably, the FpgTri4 gene fragment contains the FpgTri4 open expression frame.

Images