Method for breeding new red-pulp seedless grape variety based on molecular marker

Abstract

The invention discloses a method for breeding a new red-pulp seedless grape variety based on molecular markers, and belongs to the field of biological breeding. The molecular marker obviously related to red pulp and seedless characters of grapes is excavated through a whole genome analysis method, the molecular marker has broad spectrum, and red pulp and seedless character phenotypes of grapes can be accurately identified in the early stage of hybrid seedlings by amplifying electrophoretic band types of gene segments of the molecular marker, so that the method is simple and convenient to operate. Compared with traditional breeding and cultivation breeding, the method saves at least five years of breeding period, obviously shortens breeding period, saves a large amount of land and management investment, improves breeding efficiency, and provides support for efficient molecular assisted breeding of new red-pulp seedless grape varieties.

Description

Technical Field

[0001] The invention relates to the field of biological breeding, and in particular to a method for breeding new varieties of red-fleshed and seedless grapes based on molecular markers. Background Art

[0002] my country is a major producer and consumer of table grapes. Since 2010, my country's grape production has been ranked first in the world, and 80% of the grapes produced are table grapes. China's table grape production accounts for about half of the world's total.

[0003] Variety is one of the key factors that determine fruit quality, and the use of excellent varieties is the premise of producing high-quality fruits. At present, 70% of the varieties used in my country's grape production are imported from abroad. These varieties have poor adaptability to my country's climatic conditions. The selection and promotion of high-quality new grape varieties with independent intellectual property rights are urgently needed in production.

[0004] Seedless grapes, which are convenient to eat, have always been favored by people, and seedless grapes are also the breeding target of breeders. At present, seedless grapes account for 90% of fresh-table grapes in the United States. The cultivation of seedless grapes in Chile has developed rapidly, and the planting variety structure has gradually transitioned from seeded varieties to seedless varieties. At present, the area of ​​seedless varieties has exceeded 50%. It can be said that seedless grapes are an inevitable trend in the development of the fresh-table grape industry. At present, the selection and breeding of new seedless grape varieties in my country is still mainly based on traditional hybridization. In the process of obtaining hybrid seedlings, although the use of embryo rescue technology can increase the probability of seedless strains in hybrid populations, the late selection of populations still needs to wait until the hybrid strains are stable after planting, which takes at least 5 years, with low efficiency and high cost. Although seedless molecular markers have been published, they are mostly in the aspects of marker development and verification research. There is no report on single markers related to seedlessness that are truly used in offspring screening and breeding of strains.

[0005] The fruit quality and nutritional value of a variety are also key factors in determining its economic value. In addition to directly affecting consumers' preference for grapes, fruit anthocyanins also have a good effect on human health. Cultivating new varieties of high-quality (high anthocyanin content) seedless grapes is an urgent need for the development of my country's grape industry and is also the goal of breeding functional varieties. Therefore, my country urgently needs to accelerate the breeding of new varieties of high-quality (high anthocyanin content) seedless grapes with independent intellectual property rights. However, there are currently no reports on molecular markers for red meat, nor have molecular markers combining seedless traits with high-quality traits been applied to actual breeding. Using genomic technology to carry out multi-trait molecular marker-assisted breeding is an inevitable trend in the development of my country's grape germplasm innovation and a necessary means to provide germplasm innovation capabilities. Summary of the invention

[0006] The purpose of the present invention is to provide a method for breeding new varieties of red flesh and seedless grapes based on molecular markers to solve the problems existing in the above-mentioned prior art. Based on genome data mining, molecular markers significantly associated with broad-spectrum red flesh and seedless traits are obtained, and a method for breeding new varieties of red flesh and seedless grapes is constructed. The new varieties of red flesh and seedless grapes that meet the breeding goals can be accurately and efficiently screened out in the early stage of hybrid seedlings, thereby improving breeding efficiency and reducing breeding costs.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides a molecular marker for identifying a new red-fleshed and seedless grape variety, comprising a molecular marker R1 for identifying that grape flesh is red-fleshed and a molecular marker S1 for identifying that grape flesh is seedless, wherein the molecular marker R1 is located in an upstream promoter region of a key grape gene VvMYBA1, wherein the molecular marker R1 comprises ≥2 copies of a MYBA1 promoter, wherein the promoter sequence is shown in SEQ ID NO: 2, wherein the nucleotide sequence of the molecular marker S1 is shown in SEQ ID NO: 3, wherein a 70 bp deletion exists in the sequence starting from the 121st position, and the deletion fragment is shown in SEQ ID NO: 4.

[0009] The present invention also provides a method for breeding new varieties of red-fleshed and seedless grapes, comprising the step of breeding new varieties of red-fleshed and seedless grapes by using the molecular markers.

[0010] Preferably, the method comprises the following steps:

[0011] DNA is extracted from young tissues of hybrid grape seedlings, and the molecular marker S1 is amplified using the primer pair shown in SEQ ID NO: 5-6, and the molecular marker R1 is amplified using the primer pair shown in SEQ ID NO: 7-8. According to the band type of the amplified product, a new grape variety with red flesh and no seeds is selected.

[0012] Preferably, the parents of the hybrid seedlings include at least one red meat variety parent and one seedless variety parent.

[0013] Preferably, the amplification reaction system comprises: 25 μL of 2×Rapid Taq Master Mix, 2 μL of upstream primer, 2 μL of downstream primer, 0.1-1 μg of DNA template, and ddH2O supplemented to a total volume of 50 μL.

[0014] Preferably, the reaction procedure of the amplification is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, the annealing temperature is reduced by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; storage at 4°C.

[0015] Preferably, when the molecular marker R1 has double bands of 638 bp and (638+408n) bp, it is a red-fleshed grape, and when it has a single band of 638 bp, it is a white-fleshed grape, wherein n is a natural number ≥ 1; when the molecular marker S1 has a single band of 284 bp, it is a seeded grape, and when it has a band of 214 bp, it is a seedless grape.

[0016] Preferably, the hybrid seedling variety retaining the molecular marker R1 with double bands of 638 bp and (638+408n) bp, and the molecular marker S1 with a band of 214 bp, is a new red-fleshed seedless grape hybrid variety.

[0017] The present invention also provides a primer pair for identifying red meat and seedless new varieties, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 5-8, wherein the primer pair shown in SEQ ID NO: 5-6 is used to amplify the molecular marker S1, and the primer pair shown in SEQ ID NO: 7-8 is used to amplify the molecular marker R1.

[0018] The present invention also provides the application of the molecular marker or the primer pair in the breeding of new grape varieties.

[0019] The present invention discloses the following technical effects:

[0020] The present invention mines molecular markers (i.e., molecular marker R1 and molecular marker S1) significantly associated with grape red flesh and seedless traits through a whole genome analysis method, and develops a method suitable for breeding new varieties of red flesh and seedless grapes based on the molecular markers. The method uses agar gel electrophoresis detection, which is convenient and fast, with stable results and is not affected by the environment. It has the characteristics of quickly and accurately screening grape plants with red flesh and seedless traits. The identification and screening of hybrid offspring can be carried out at the hybrid seedling stage, which reduces the breeding cycle, saves a lot of land and management input, and improves breeding efficiency.

[0021] Compared with the conventional breeding methods in the prior art, the present invention provides a broad-spectrum single seedless marker combined with a red meat marker, which can simultaneously carry out early seedless and red meat identification and screening of hybrid offspring, saving at least 5 years of breeding cycle compared with conventional breeding and cultivation breeding. The molecular markers and breeding methods provided by the present invention can be used for early screening of red meat and seedless hybrids of grapes, providing support for efficient molecular-assisted breeding of new red meat and seedless grape varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The identification bands for the red meat strains of the population offspring (the red meat strains have two bands); the bands from left to right are Marker, 'No. 19' (red meat), 'No. 35' (red meat), 'No. 38' (red meat), 'No. 69' (red meat), 'No. 82' (red meat), 'No. 85' (red meat) and 'No. 136' (white meat);

[0024] Figure 2 The bands for identifying the seedless lines of the progeny of the population (the seedless lines are located farther away); the bands from left to right are 'No. 19' (with seed), 'No. 35' (without seed), 'No. 38' (without seed), 'No. 69' (without seed), 'No. 82' (with seed), 'No. 85' (without seed), 'No. 136' (with seed) and Marker;

[0025] Figure 3 This is a picture showing the appearance of the '69' seedless red flesh grape after being cut open. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1 A molecular marker for identifying new varieties of red-fleshed and seedless grapes

[0032] The present invention uses the whole genome sequencing data of the red-fleshed grape 'Yan 73' and the seedless grape 'No Seed White', and compares the whole genome with the Eurasian grape 'Cabernet Sauvignon', 'Pinot Noir', 'Chardonnay' and Eurasian wild species, and combines gene expression and linkage to obtain a broad spectrum of red meat and seedless trait molecular markers:

[0033] Characteristics of the red flesh molecular marker (REDFLESH, denoted as R1): This molecular marker is located in the upstream promoter region of the key gene VvMYBA1 regulated by grape anthocyanins, and the nucleotide sequence is shown in SEQ ID NO: 1. This molecular marker is a copy number variation (CNV) molecular marker that is closely linked to the flesh color trait. The promoter variation copy number of this molecular marker affects the expression of VvMYBA1. When the promoter copy number is ≥2, VvMYBA1 is expressed in the flesh, making the flesh red. At the same time, there is a natural segment with a copy number of 1 on the grape genome, which can be used as a control, so it is used as a marker for identifying flesh color.

[0034] Seedless molecular marker (SEEDLESS, denoted as S1) characteristics: GWAS was used to conduct a genome-wide analysis of the seedless trait, and multiple SNP sites of MADS8 were discovered. Through linkage analysis and in-depth mining of resequencing data, a 70bp deletion InDel highly linked to these SNPs was found. The sequence of the InDel molecular marker is shown in SEQ ID NO: 3. A 70bp sequence is deleted starting from position 121 of the sequence. The deletion sequence is as follows (SEQ ID NO: 4). It has been verified that the InDel is closely related to the seedless trait of grapes, so it can be used as a marker to identify seedless grapes.

[0035] Sequence shown in SEQ ID NO: 1:

[0036]

[0037]

[0038] The underlined portion in the sequence is the 408 bp sequence of the MYBA1 promoter mutation (SEQ ID NO: 2), 408×3 bp.

[0039] SEQ ID NO: 3 is as follows:

[0040] TTCAGGATAGGGAGGTCTGAACTCAGTTGAAGGAATAGTAAAAGAAGACAAAGCAACTATTAGAGCTTAAGAAGAGTCCCATTTTAGTATTAGTGACTTCATACTACAAAGAAAACTTAG GGAAAAAAAAAACTCAATTAGAAA AAAGTCTTTTTGACAAGATTAGGATTACTGATATGGGTCTTAGCAT GTAAGCAATCATGTTCATGCATTCCAATTCTTTCTATTCTTGTTTTCCTTTTTTCCTTTTTTTCACCTAATATTTGTTGAGATGAAAAGTGGCT.

[0041] The underlined sequence is the missing 70 bp sequence (SEQ ID NO: 4).

[0042] Example 2 A method for breeding new varieties of red flesh and seedless grapes

[0043] 1. Hybrid combination configuration

[0044] Select suitable parents and configure hybrid combinations. When breeding seedless and red-fleshed new and superior varieties, the two parents must include one red-fleshed parent and one seedless parent. The red-fleshed parent can be the female parent or the male parent. If the seedless parent is used as the female parent, embryo culture should be carried out after flowering, and embryo rescue should be carried out to obtain hybrid seedlings; the male parent variety should bloom at the same time as or earlier than the female parent.

[0045] 2. Obtaining hybrid seedlings

[0046] When using seedless varieties as the female parent, after hybridization to obtain mature hybrid seeds, they are treated with a variable temperature of 20 / 30℃ to induce the growth of hybrid seedlings. When using seedless varieties as the female parent, hybrid seedlings are obtained through embryo rescue.

[0047] 3. Sampling and DNA extraction

[0048] Young leaves, tender stems and other tender tissues of hybrid seedlings were collected, and DNA was extracted using a modified CTAB plant genomic DNA rapid extraction kit. The extracted DNA concentration was diluted to about 200 ng / μL and stored at -20°C.

[0049] 4. PCR amplification

[0050] 4.1 PCR detection primers

[0051] Primers were designed based on the seedless molecular marker S1 and the red meat molecular marker R1 provided by the present invention:

[0052] Non-nuclear molecular marker S1:

[0053] F(SEQ ID NO:5):5'-TTCAGGATAGGGAGGTCTGAA-3';

[0054] R (SEQ ID NO: 6): 5'-AGCCACTTTTCATCTCAACAAA-3'.

[0055] Red meat molecular marker R1:

[0056] F(SEQ ID NO:7):5'-CAGTGAGGGTAACAAAGTCA-3';

[0057] R (SEQ ID NO: 8): 5'-AAGGGTTGTGTCATAAGAG-3'.

[0058] The above primers were used for detection.

[0059] 4.2 PCR reaction system (50 μL)

[0060] All operations were performed on ice, and the total PCR amplification reaction system was 50 μL, as shown below:

[0061] Table 1 Reaction system

[0062]

[0063] 4.3 PCR amplification procedure

[0064] To improve the specificity of the amplified product, Touchdown-PCR was used to amplify the target fragment. The specific procedure was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s (0.5°C lowered for each cycle), and extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; and storage at 4°C.

[0065] 4.5 Agarose gel electrophoresis

[0066] Add 1.5g agarose powder and 100mL 1×TAE buffer (1.5% agarose gel) to a conical flask, shake well and heat in a microwave to dissolve. When the solution becomes transparent, add 10μL nucleic acid dye. Pour the solution into the gel tank, insert the gel comb, remove the comb after solidification, and place the gel into the electrophoresis tank. Add 5-10μL PCR product to each well, set a constant voltage of 140V, and run the electrophoresis for 15-30 minutes. After the electrophoresis is completed, observe and take pictures in a UV gel imager.

[0067] 4.6 Result Verification

[0068] The sequence of the red meat marker amplification product is shown in SEQ ID NO: 1, and the sequence of the seedless marker amplification product is shown in SEQ ID NO: 3. The electrophoresis bands are clear and uniform, indicating that there are no problems with the purity and concentration of the DNA. If there are two bands of the red meat marker (638bp and (638+408n) bp, n is a natural number ≥ 1), it proves that the variety is red meat. If there is only one band (638bp), it is a white meat variety. The seedless marker is a 70bp deletion, so compared with the seeded variety, the seedless band migrates farther, and the migration position is closer to the lower part of the agarose gel relative to the seeded grape. By comparing the bands, the specific situation of the seedless variety can be determined.

[0069] Example 3

[0070] The method for breeding new grape varieties in Example 2 was applied and verified by taking the offspring of the hybrid population of 'Yan 73' (red flesh variety) × 'Zixiang Wuhe' (seedless variety) as an example.

[0071] According to the method of Example 2, four red-fleshed and seedless grape lines that meet the breeding goal were screened from the offspring of the hybrid population of 'Yan 73' (red-fleshed variety) × 'Zixiang Wuhe' (seedless variety), namely 'No. 35', 'No. 38', 'No. 69' and 'No. 85'. The electrophoresis results are shown in Figure 1 and Figure 2 The results showed that all red-fleshed grapes showed double bands (638bp and 638bp and (638+408n)bp), while the position of seedless grapes was farther away from that of seeded grapes, with a single band at 284bp for seeded grapes and a single band at 214bp for seedless grapes. Among them, 'No. 69' showed excellent comprehensive traits (see Figure 3 ) was selected as the variety, applied for and obtained the acceptance of new plant variety rights in 2022, and is currently entering the substantive examination stage.

[0072] At present, using seeded varieties as female parents and seedless varieties as male parents, the lowest percentage of seedless strains in hybrid offspring is only 10%-15%, and most of them are seeded strains (Reynolds, 2014). Even if seedless female parents are used for hybridization with seedless male parents, the probability of seedless strains in hybrid offspring will be greatly increased, but at least 25% are seeded strains. Even for seedless strains, their seed abortion does not always meet the breeding goals of seedless new varieties (Ramming, 1990). In addition, using traditional screening methods, all hybrids need to be planted in the field, and after juvenile domestication, the plants can be determined whether the strains are seedless after they bear fruit, which takes at least 5-6 years. Therefore, if seedless markers can be used for hybrid offspring screening in the early stage, firstly, it can accelerate the breeding process and reduce the breeding cycle by at least 5 years; secondly, it can reduce the land, management and other resources occupied by a large number of hybrid seedlings after planting, and reduce breeding costs. The combination of seedless trait markers and other quality markers can highlight the advantages of modern biological breeding technology and improve breeding efficiency. The results of the above examples show that the molecular markers provided by the present invention and the breeding method developed based on the molecular markers can determine the seedless and flesh color traits of the offspring strains in the second year after hybridization, and screen the target trait strains in a targeted manner, which significantly shortens the breeding period. This is an important discovery and progress for grape breeding, and has very important practical significance and value.

[0073] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker for identifying new varieties of red-fleshed and seedless grapes, characterized in that: The invention comprises a molecular marker R1 for identifying grape flesh as red flesh and a molecular marker S1 for identifying grape flesh as seedless, wherein the molecular marker R1 is located in the upstream promoter region of the grape key gene VvMYBA1, and the molecular marker R1 contains ≥2 copies of the MYBA1 promoter, and the promoter sequence is shown in SEQ ID NO:

2. The nucleotide sequence of the molecular marker S1 is shown in SEQ ID NO: 3, and there is a 70 bp deletion in the sequence starting from the 121st position, and the deletion fragment is shown in SEQ ID NO:

4.

2. A method for breeding a new variety of red-fleshed, seedless grapes, characterized in that: The method comprises the step of breeding new varieties of red-fleshed and seedless grapes by using the molecular markers described in claim 1.

3. The method according to claim 2, characterized in that The method comprises the following steps: DNA is extracted from young tissues of hybrid grape seedlings, and the molecular marker S1 is amplified using the primer pair shown in SEQ ID NO: 5-6, and the molecular marker R1 is amplified using the primer pair shown in SEQ ID NO: 7-8. According to the band type of the amplified product, a new grape variety with red flesh and no seeds is selected.

4. The method according to claim 3, characterized in that The parents of the hybrid seedlings include at least one red meat variety parent and one seedless variety parent.

5. The method according to claim 3, characterized in that The amplification reaction system includes: 2×Rapid TaqMaster Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA template 0.1-1 μg, and ddH2O supplemented to a total volume of 50 μL.

6. The method according to claim 3, characterized in that The amplification reaction procedure is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, annealing temperature decreased by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; storage at 4°C.

7. The method according to claim 3, characterized in that When the molecular marker R1 has double bands of 638 bp and (638+408n) bp, it is a red-fleshed grape, and when it has a single band of 638 bp, it is a white-fleshed grape, wherein n is a natural number ≥ 1; when the molecular marker S1 has a single band of 284 bp, it is a seeded grape, and when it has a band of 214 bp, it is a seedless grape.

8. The method according to claim 7, characterized in that The hybrid seedling variety that retains the molecular marker R1 with double bands of 638 bp and (638+408n) bp and the molecular marker S1 with a band of 214 bp is a new red flesh seedless grape hybrid variety.

9. A primer pair for identifying new red meat and seedless varieties, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NOs: 5-8, wherein the primer pair shown in SEQ ID NOs: 5-6 is used to amplify the molecular marker S1 in claim 1, and the primer pair shown in SEQ ID NOs: 7-8 is used to amplify the molecular marker R1 in claim 1.

10. Use of the molecular marker according to claim 1 or the primer pair according to claim 9 in breeding new grape varieties.

Images