Exosome functional compound and application thereof

Abstract

The invention relates to the technical field of exosome carrying, in particular to an exosome functional compound and application thereof.The exosome functional compound at least comprises exosomes and nucleic acid substances, the exosomes are derived from animals, plants and microorganisms, the nucleic acid substances are selected from DNA, RNA and fragments thereof, each (1-3) * 10 < 12 > exosomes contain 1-3 mg of nucleic acid substances, and each (1-3) * 10 < 12 > exosomes contain 1-3 mg of nucleic acid substances. Nucleic acid substances are wrapped in exosomes to obtain an exosome functional compound, then the exosome functional compound is mixed with a soluble matrix material and auxiliary materials, the soluble microneedle of the exosome functional compound is formed through an air exhaust process, effective substances can be comprehensively delivered to a corium layer, and the beautifying and anti-aging effects are achieved.

Description

Technical Field

[0001] The present invention relates to the field of exosome loading technology, and specifically to an exosome efficacy complex and application thereof. Background Art

[0002] The trend of population aging has led to a substantial increase in the demand for anti-aging products. Human skin is subject to the combined effects of endogenous and exogenous aging. Studies have shown that human skin begins to age at the age of 20, gradually producing wrinkles, dull complexion, spots, sagging, etc. Therefore, anti-aging cosmetics for the skin have always been a focus of concern for many people.

[0003] There are many raw materials for cosmetics, most of which are safe, stable, and easy to absorb. However, some bioactive substances are still difficult to apply due to stability reasons. For high molecular weight substances, transdermal absorption has always been a pain point in the industry due to the presence of the skin's stratum corneum. Medical beauty usually uses injections or rolling needles to break the skin and deliver effective substances into the skin to produce direct and rapid effects, but this type of method needs to be performed under the operation of professional medical beauty institutions and professional medical staff, and cannot be used at home or in other scenarios like ordinary cosmetics. High-pressure perfusion (needle-free injection) is a new method of drug administration, but it has a large impact and is difficult to achieve in delicate and sensitive areas such as the face and around the eyes. At the same time, it is expensive and not suitable for the field of daily consumer goods.

[0004] Soluble microneedles are a new method of treating or anti-aging by making active ingredients into micron-sized patches and applying them directly to the skin. For example, a Chinese patent application (authorization publication number CN114558242B) discloses a soluble microneedle and a method for manufacturing the same. The soluble microneedles are prepared by a vacuum process based on a viscous polymer solution. The microneedles are mainly used in the preparation of soluble microneedles containing small molecules, peptides, and protein substances, but the addition of higher biologically active substances still has certain limitations.

[0005] Extracellular vesicles (EVs) are membrane vesicles with a phospholipid bilayer structure and nanometer to micrometer size that are actively secreted by cells, including exosomes, microvesicles, apoptotic bodies, etc. Among them, exosomes are the most widely studied and applied. Exosomes can carry a variety of important information such as proteins, lipids, DNA and RNA. Exosomes can realize the transport of substances and information transmission between cells. They have the potential to be used as nanoscale drug delivery carriers. Moreover, they are derived from natural substances such as cells, and have unique advantages in improving drug efficacy and reducing side effects. For example, clinical trials NCT05191381 and NCT05216562 have proved that EVs from mesenchymal stem cells and dendritic cells have lower immunogenicity. At present, plant-derived exosomes are more suitable for the application of oral products. For the enhanced delivery of transdermal absorption, more matching exosome raw materials are needed. Summary of the invention

[0006] In order to solve the above problems, the present invention provides an exosome functional complex and its application. The nucleic acid substance is encapsulated into the exosome to obtain the exosome functional complex, which is then mixed with a soluble matrix material and auxiliary materials and then formed into a soluble microneedle of the exosome functional complex through a vacuum process, which can comprehensively deliver effective substances to the dermis and exert beauty and anti-aging effects.

[0007] On the one hand, the present invention provides an exosome efficacy complex, which at least includes exosomes and nucleic acid substances encapsulated in the exosomes, wherein the exosomes are derived from animals, plants and / or microorganisms, and the nucleic acid substances are selected from DNA, RNA and fragments thereof, each (1-3)×10 12 Each exosome contains 1-3 mg of nucleic acid material.

[0008] The exosomes are derived from Camelidae, preferably Bactrian camel, dromedary camel, llama, guanaco, alpaca and / or llama, more preferably alpaca.

[0009] Preferably, the exosomes are alpaca exosomes, and the diameter of the alpaca exosomes detected by NTA equipment is in the range of 40-200 nm, and the number of exosomes after purification by liquid chromatography is 5.5×10 10 particles / mL, and scanning electron microscopy images showed that the exosomes were round in shape and evenly distributed ( Figure 1 ).

[0010] The present invention uses alpaca umbilical cord stem cell exosomes to encapsulate nucleic acid substances, turning the body's skin cells into a protein manufacturing factory, guiding the skin cells to synthesize collagen, elastin and other substances. Compared with supplementing hydrolyzed collagen itself, it has more natural properties and a more lasting effect.

[0011] In some embodiments, the steps of preparing alpaca exosomes are as follows:

[0012] 1) taking an alpaca umbilical cord, crushing it and culturing it in Dulbecco's modified Eagle's medium, exchanging the medium after 3-7 days, using trypsin to separate the tissue to obtain cells, and then amplifying them to select alpaca umbilical cord stem cells of the 3rd to 7th generations;

[0013] 2) washing the alpaca umbilical cord stem cells obtained in step 1), continuing to culture them with Dulbecco's modified Eagle medium, collecting the culture medium and centrifuging and filtering it to obtain a stock solution containing exosomes;

[0014] 3) The stock solution obtained in step 2) is purified by column to obtain the alpaca exosomes of the invention.

[0015] In some embodiments, the step of preparing alpaca exosomes has one or more of the following characteristics:

[0016] 1) The Dulbecco's modified Eagle's medium in step 1) further contains low glucose, 10 wt % fetal bovine serum and 1 wt % penicillin and streptomycin;

[0017] 2) the concentration of trypsin in step 1) is 0.01%-0.5%, preferably 0.1%;

[0018] 3) In step 2), the Dulbecco's modified Eagle's medium is a serum-free low-glucose Dulbecco's modified Eagle's medium;

[0019] 4) The centrifugal speed in step 2) is 1000×g-10000×g, and the centrifugal time is 10-30 minutes, preferably 20 minutes;

[0020] 5) The filter used in the filtration in step 2) has a gap of 0.1-0.5 μm, preferably 0.22 μm;

[0021] 6) In step 3), the purification column was washed with NaOH and 30% isopropanol.

[0022] As a preferred technical solution, the nucleic acid substance is selected from at least one of plasmid, mRNA, miRNA, siRNA, tRNA, and tRFs. Preferably, it is mRNA, and more preferably, it is one or more of collagen mRNA, PD-1 nanobody mRNA, CTLA-4 nanobody mRNA, and PD-1 & CTLA-4 bispecific nanobody mRNA.

[0023] On the other hand, the present invention provides a method for preparing an exosome efficacy complex, wherein the nucleic acid substance is encapsulated into the exosome by any one of electroporation, extrusion, ultrasound, freeze-thaw cycle, membrane penetration, and dialysis, preferably electroporation.

[0024] Preferably, the method for preparing the exosome functional complex comprises at least the following steps: mixing exosomes and nucleic acid substances in an electroporation buffer, adding enzyme inhibitors to obtain a mixed solution, placing the mixed solution in an LV unit closed electroporation system for electroporation to encapsulate the nucleic acid substances into the exosomes, and then performing buffer replacement to obtain the exosome functional complex.

[0025] Preferably, the number of exosomes in the electroporation buffer is (1-3)×10 12 The concentration of nucleic acid substance is (1-3) mg / 20 mL.

[0026] In order to further improve the effect of exosomes, the present invention encapsulates nucleic acid substances into the prepared alpaca exosomes. The present invention uses electroporation to load exogenous nucleic acid substances into exosomes. Compared with the endogenous loading of overexpressed functional substances in cells, more types of anti-aging substances can be encapsulated into exosomes while achieving higher loading efficiency. In addition, nucleic acid substances (especially mRNA drugs) can be used for personalized cancer treatment, regenerative medicine, and various health problems such as allergies, autoimmune diseases and inflammatory diseases.

[0027] A third aspect of the present invention provides an application of an exosome functional complex, which is applied to the preparation of a product loaded with the exosome functional complex.

[0028] Preferably, the product has any one or more of the following characteristics:

[0029] 1) Anti-aging products;

[0030] 2) Products that improve sleep;

[0031] 3) Products that enhance immunity;

[0032] 4) Antioxidant products.

[0033] Preferably, the product is an external product or an internal product, the external product is selected from skin care products, cosmetics, and hair care products; the internal product is selected from solid beverages, liquid beverages, dairy products, seasoning powders, nutritional supplements, and internal health care products.

[0034] Preferably, the topical product is selected from emulsions, gels, creams, soluble microneedles, and facial masks, preferably soluble microneedles.

[0035] Preferably, the external product contains any one or more of the following excipients:

[0036] a. Antiseptic ingredients: the antiseptic ingredients are selected from one or more of methylparaben, ethylparaben, propylparaben, formaldehyde releasers, methylchloroisothiazolinone, methylisothiazolinone, phenoxyethanol, imidazolidinyl urea, isothiazolinone, phenol, benzoic acid, benzyl alcohol, potassium sorbate, bromopol, p-hydroxyacetophenone, chlorphenesin, triclosan, quaternary ammonium salt-15, dehydroacetic acid and its salts;

[0037] b. Emulsifying component: the emulsifying component is selected from one or more of polyethylene glycols, glycerides, sugar derivatives, anionic emulsifiers, cationic emulsifiers, and phospholipids;

[0038] c. Modification auxiliary materials: the modification auxiliary materials are selected from essences and / or pigments;

[0039] d Cryoprotectant: trehalose and / or polyvinyl pyrrolidone 40, wherein the concentration of trehalose is 10-70 mM, preferably 50 mM, and the weight percentage of polyvinyl pyrrolidone 40 is 1-10 wt%, preferably 5 wt%.

[0040] Preferably, the oral product contains any one or more of the following excipients acceptable to food science:

[0041] e. Flavoring agent: the flavoring agent is selected from one or more of oligofructose, lactose, stevioside, xylitol, honey, syrup, mint oil, instant tea powder, fruit juice powder, edible flavor, and citric acid;

[0042] f. Dosage form excipients: The dosage form excipients are selected from one or more of maltodextrin, calcium stearate, magnesium stearate, hydroxypropyl methylcellulose, microcrystalline cellulose, and silicon dioxide.

[0043] A soluble microneedle loaded with an exosome functional complex, wherein the raw materials for its preparation at least include: an exosome functional complex, a soluble matrix material, and an auxiliary material, wherein the mass ratio of the exosome functional complex, the soluble matrix material, and the auxiliary material is (10-40):(10-40):(0.1-1), preferably 20:20:0.3.

[0044] Preferably, the soluble matrix material comprises at least one of hyaluronic acid, polyamino acid and inulin, preferably a combination of hyaluronic acid, polyamino acid and inulin in a mass ratio of (15-20):20:15.

[0045] Preferably, the auxiliary materials include sucrose, collagen, hydrophilic colloid, and cyclodextrin in a mass ratio of (3-10):(3-10):(1-5):(1-5), preferably 5:5:3:2;

[0046] Preferably, the hydrophilic colloid is selected from one of xanthan gum, gellan gum, carrageenan, gelatin, sodium alginate and pectin, preferably gelatin.

[0047] Preferably, the soluble microneedle loaded with the exosome efficacy complex has one or two of the following characteristics:

[0048] 1) The weight percentage of hyaluronic acid in the soluble microneedle is 10-30wt%, preferably 15-20wt%;

[0049] 2) The circular diameter of the soluble microneedle is 100-500 μm and the length is 300-1000 μm.

[0050] Preferably, the preparation method of the soluble microneedle loaded with the exosome efficacy complex is: mixing the exosome efficacy complex, the soluble matrix material, sucrose, collagen, hydrophilic colloid, and cyclodextrin to obtain a viscous polymer solution, coating the viscous polymer solution with the viscous polymer solution, placing the microneedle polydimethylsiloxane (PDMS) mold on the surface of the viscous polymer solution in the previous step, and evacuating the cavity from the exhaust port. The negative pressure value of the vacuum pump is controlled to be 1-2Psi, the time is 180-220ms, the temperature is 15-25°C, and the humidity is 40-60%. The viscous polymer solution enters the cavity along the air flow to maintain a gap between the viscous polymer solution and the cavity; the viscous polymer solution in the cavity is cured for 20-40 minutes to obtain a conical soluble microneedle.

[0051] The present invention optimizes the exosome efficacy complex and has a high matching degree with the soluble matrix material, sucrose, collagen, hydrophilic colloid, and cyclodextrin formula, and forms soluble microneedles of the exosome efficacy complex through a vacuum process after mixing, thereby maintaining the stability of the exosome activity.

[0052] Beneficial Effects

[0053] 1. The present invention provides an exosome functional complex and its application. The exosome functional complex is obtained by encapsulating nucleic acid substances into exosomes, and then mixed with soluble matrix materials and auxiliary materials to form soluble microneedles of the exosome functional complex through a vacuum process, which maintains the stability of the exosome activity, can comprehensively deliver effective substances to the dermis and exert beauty and anti-aging effects.

[0054] 2. The present invention adopts electroporation to load exogenous nucleic acid substances into exosomes. Compared with the endogenous loading of overexpressed functional substances in cells, more types of anti-aging substances can be encapsulated into exosomes while achieving higher loading efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 This is a scanning electron micrograph of the obtained alpaca exosomes;

[0056] Figure 2 To verify the effect of exosome efficacy complexes that transfer collagen mRNA;

[0057] Figure 3 To verify the effect of exosome efficacy complex that transfers PD-1 and CTLA-4 bispecific nanoantibody mRNA. DETAILED DESCRIPTION

[0058] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0059] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are selected according to conventional methods and conditions, or according to the product specifications, and the reagents in each example are commercially available.

[0060] Although the numerical ranges and parameter approximations shown in the broad scope of the present invention, the numerical values ​​shown in the specific embodiments are recorded as accurately as possible. However, any numerical value is bound to contain a certain error, which is caused by the standard deviation in their respective measurements. In addition, all ranges disclosed herein should be understood to cover any and all sub-ranges contained therein. For example, the range of "1 to 3" recorded should be considered to include any and all sub-ranges between the minimum value 1 and the maximum value 3 (including the endpoints); that is, all sub-ranges starting with a minimum value of 1 or greater, such as 1 to 1.3, and sub-ranges ending with a maximum value of 3 or less, such as 2.5 to 3. In addition, any reference referred to as "incorporated herein" should be understood to be incorporated in its entirety.

[0061] One of the objectives of the present invention is to provide an exosome complex, which at least includes exosomes and nucleic acid substances encapsulated in the exosomes.

[0062] The term "exosome" refers to small membrane vesicles containing complex RNA and proteins, and currently specifically refers to disc-shaped vesicles with a diameter of 40-200nm. A variety of cells can secrete exosomes under normal and pathological conditions. They are mainly derived from multivesicular bodies formed by the invagination of intracellular lysosomal microparticles, and are released into the extracellular matrix after the multivesicular outer membrane fuses with the cell membrane.

[0063] In some embodiments, the nucleic acid material is selected from at least one of plasmid, mRNA, miRNA, siRNA, tRNA, and tRFs, preferably mRNA, and more preferably one or more of collagen mRNA, PD-1 nanobody mRNA, CTLA-4 nanobody mRNA, and PD-1 & CTLA-4 bispecific nanobody mRNA.

[0064] The term "collagen" is a biological macromolecule, the main component of animal connective tissue, and the most abundant and widely distributed functional protein in mammals, accounting for 25% to 30% of the total protein, and even up to 80% or more in some organisms. According to the distribution and functional characteristics in the body, collagen can be divided into interstitial collagen, basement membrane collagen and pericellular collagen. Interstitial collagen molecules account for the vast majority of the collagen in the whole body, including type I, II and III collagen molecules. Type I collagen is mainly distributed in tissues such as skin and tendons, accounting for about 80% to 90% of the total collagen content; type II collagen is produced by chondrocytes; type III collagen is mainly present in infant skin or vascular endothelium and intestines, and is the main component of reticular fibers in the skin. Basement membrane collagen usually refers to type IV collagen, which is mainly distributed in the basement membrane; pericellular collagen usually refers to type V collagen, which exists in large quantities in connective tissue. The collagen described in the present invention is mainly interstitial collagen, namely type I, II and III collagen molecules.

[0065] In some embodiments, the PD-1 nanobody mRNA encodes a PD-1 nanobody, such as described in CN202180088155.3. The entire text of CN202180088155.3 is incorporated herein by reference.

[0066] In some embodiments, the CTLA-4 nanobody mRNA encodes a CTLA-4 nanobody, such as described in CN202111152925.4. The entire text of CN202111152925.4 is incorporated herein by reference.

[0067] In some embodiments, the PD-1 & CTLA-4 bispecific nanobody mRNA encodes a PD-1 & CTLA-4 bispecific nanobody, such as described in CN202311358653.2. The full text of CN202311358653.2 is incorporated herein by reference.

[0068] Example 1

[0069] Provided is an exosome efficacy complex, including exosomes and nucleic acid substances, each 2×10 12 Each exosome contains 2 mg of nucleic acid material.

[0070] 1.1 Preparation of alpaca exosomes:

[0071] (1) When the alpaca gave birth, the umbilical cord was obtained, and after washing the umbilical cord with PBS, the umbilical cord blood vessels were removed. The remaining umbilical cord was cut into 1 mm pieces and transported to a culture plate containing low glucose, Dulbecco's modified Eagle medium (DMEM, Bioiea) containing 10wt% fetal bovine serum (FBS, Gibco BRL Co., USA) and 1wt% penicillin and streptomycin. The plate was kept at 37°C in a humidified atmosphere containing 5% CO2. After three days, the culture medium was replaced and large pieces of tissue were removed. Adherent cells were separated with 0.1% trypsin (Gibco BRL Co.USA) and cultured for expansion. The characteristics of alpaca umbilical cord stem cells were detected by flow cytometry, and cells with only three to seven generations were used for further expansion experiments.

[0072] (2) When the expanded alpaca umbilical cord stem cells reached 75% confluence, they were washed twice with phosphate buffered saline (PBS) and then cultured in serum-free low-glucose Dulbecco's modified Eagle medium (LG-DMEM) for 48 hours. The culture medium was collected and centrifuged at 1000×g for 20 minutes to remove cell debris, and then centrifuged at 2000×g for 20 minutes and 10000×g for 20 minutes. The supernatant was collected and filtered using a 0.22 μm pore filter (Millipore, USA). The stock solution (original sample) containing exosomes after filtration will be used for further purification.

[0073] (3) The original sample collected above was applied to a HiScale 16 / 20 column (Cytiva) filled with 20 mL Capto Core 700 (Cytiva). PBS (pH = 7.4) was used to complete the sample application, and the flow rate was set to 400 cm / h. The purified alpaca exosomes were eluted from the column during the washing of the purification column with NaOH and 30% isopropanol.

[0074] The alpaca exosomes were detected by NTA equipment with a diameter range of 40-200 nm, and the number of exosomes after liquid chromatography purification was 5.5×10 10 particles / mL, and scanning electron microscopy images showed that the exosomes were round in shape and evenly distributed ( Figure 1 ).

[0075] 1.2 Preparation of exosome complexes

[0076] The nucleic acid substance is collagen mRNA [National Library of Medicine, Homosapiens collagen type I alpha 1chain (COL1A1), mRNA. (NM_000088.3)]. The method comprises the following steps: mixing exosomes and nucleic acid substances in an electroporation buffer (Lonza), adding enzyme inhibitors to obtain a mixed solution, placing the mixed solution in an LV unit closed electroporation system for electroporation to encapsulate the nucleic acid substances into exosomes, and then performing buffer replacement to obtain an exosome efficacy complex.

[0077] The number of exosomes in the electroporation buffer was 2×10 12 The concentration of nucleic acid substance is 2mg / 20mL. The electroporation device is Lonza 4D electroporation device. The Lonza 4D electroporation device uses an electric field strength of 250V / cm -1 , 10 ms / pulse, 0.1 s interval, a total of 10 pulse electroporations. The exosome efficacy complex contains 50 mM trehalose and 5 wt % polyvinylpyrrolidone 40 (PVP40).

[0078] A larger scale preparation was performed using a Lonza 4D electroporation apparatus LV unit (Lonza). After purification, (1-3) × 10 12 Exosome particles and (1-3) mg of nucleic acid are mixed in 20 mL of electroporation buffer, and RNase inhibitors are added to prevent the degradation of nucleic acid. The mixed solution is placed in the LV unit closed electroporation system, and electroporation up to 20 ml can be performed. The electroporation element is connected to 2 liquid storage bags (inlet and outlet) and a peristaltic pump, and 1 ml of the above-mentioned mixed solution is injected into the kit per unit time. During the whole process, the outlet bag is kept on ice, and the process lasts for 10 minutes. The physicochemical properties of exosomes are analyzed by NanoSight, and the buffer is replaced. The composition of the preservation solution is adjusted to contain 50 mM trehalose and 5 wt% polyvinyl pyrrolidone 40 (PVP40), and then its endotoxin and sterility are tested, divided equally in freezing bottles, and stored at -80 ° C for future use.

[0079] 1.3 Preparation of soluble microneedles loaded with exosome-derived functional complexes

[0080] The exosome efficacy complex prepared according to 1.2 comprises 100 mg / mL, soluble matrix material 100 mg / mL, sucrose 0.5 mg / mL, collagen 0.5 mg / mL, hydrophilic colloid 0.3 mg / mL, and cyclodextrin 0.2 mg / mL.

[0081] The soluble matrix material is a combination of hyaluronic acid, polyamino acid and inulin in a mass ratio of 15:20:15. The hydrophilic colloid is gelatin. The concentration of hyaluronic acid in the final mixed solution can be 10%, 15%, 20%, 25%, 30%, preferably 15%-20%.

[0082] The preparation method of the soluble microneedle loaded with the exosome efficacy complex is as follows: the exosome efficacy complex, the soluble matrix material, sucrose, collagen, hydrophilic colloid, and cyclodextrin are mixed to obtain a viscous polymer solution, the viscous polymer solution is coated with the viscous polymer solution, and the microneedle polydimethylsiloxane (PDMS) mold is placed on the surface of the viscous polymer solution in the above step, and the cavity is evacuated from the exhaust port, and the negative pressure value of the vacuum pump is controlled to be 1.5Psi, the time is 200ms, the temperature is 20°C, and the humidity is 45%. The viscous polymer solution enters the cavity along the air flow, so that a gap is maintained between the viscous polymer solution and the cavity; the viscous polymer solution in the cavity is cured for 30 minutes to obtain a conical soluble microneedle, whose circular diameter is 300 microns and the length is 500 microns. By adjusting the solution ratio and pressure and temperature conditions, soluble microneedles with a needle tip length of 300-1000 microns can be obtained to achieve the effect of delivering effective substances to different skin parts.

[0083] Example 2

[0084] Provided are an exosome efficacy complex and a soluble microneedle loaded with the exosome efficacy complex, the specific implementation of which is the same as that of Example 1, except that the nucleic acid substance is replaced with PD-1 & CTLA-4 bispecific nanoantibody mRNA, and the mRNA sequence is shown in Chinese patent CN202311358653.2, SEQ ID NO: 74,

[0085] atggaagcccctgcccagctgctgttcctgctcctactgtggctgcccgacaccacaggcgaagtgcaactggtggaaagt

[0086] ggaggcggactggtgcagcctggcggctccctgagactgtcttgtgctgctagcggcagacctttcagcatctacgacatg

[0087] ggctggttcagacaggccccagataaggaaagagagagcgtggccgtgatcaacctggctagaggcaacacttactacg

[0088] ccgatagcgtgaaaggccgatttaccatcagcagagataacgccaagaataccgtgtacctgcagatgaacagcctgcgg

[0089] gccgaggataccgccgtgtacagctgcggcgtggatagaaggcagtacggcctcggcatccctcctctggccgaccact

[0090] ggggccaaggcacccaggtcaccgtgagcagcggcggaggcggaagcggaggcggcggcagcgggggcggcgg

[0091] cgaggtgcagctggtggaatctggcggaggcctggtccagcctggcggttccctccgcctgagctgcgccgcttctggct

[0092] tcagcagcgactactatgacatcggctggttccggcaggcccctggcaaggaacgggaaatggtgtcctgcatcagaagc

[0093] agcggcggctctacaaagtacgccgacagcgtgaagggcagattcaccatcagccgggacaacagcaagaacacagtg

[0094] tatttgcaaatgaatagccttagagccgaggatacagccgtctactactgcggcctggcccctatctcccctgtgcacgccgt

[0095] ttgtaatcaacactacttcggctattggggacagggcaccagagtgacagtgtccagcgagagcaaatacggccctccatg

[0096] tcctccttgccctgctcctgagttcctgggcggacctagcgtgttcctgttcccccccaagcctaaggacaccctgatgatct

[0097] ctcggacccctgaggtgacctgtgtggttgtggacgtgtctcaggaggaccccgaggtgcagttcaactggtacgtggac

[0098] ggcgtggaagttcacaacgccaaaacaaaaccccgggaggagcagtttaacagcacatacagagtggtgagcgtgctga

[0099] ccgtgctgcatcaggactggctgaacggcaaggagtacaagtgcaaggtgtccaacaagggactgccttcttctatcgag

[0100] aagaccattagcaaggccaagggccagccaagagagcctcaggtgtacaccctgcctccatctcaggaggaaatgacca

[0101] agaaccaggtgtcactgacatgcctggtcaagggcttttacccctccgatatcgccgtggaatgggagagcaacggacag

[0102] cccgagaacaactacaagacaaccccccccgtgctggacagcgacggctcttttttcctgtacagccggctgaccgtgga

[0103] caagagcagatggcaggagggcaatgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacacagaa

[0104] atctctgagcctgtccctgggcaaataa

[0105] Performance test

[0106] 1. The soluble microneedles loaded with the exosome efficacy complex provided in Example 1 were used to improve wrinkles on the skin of aging mice. The experiment was divided into six groups. Except for the control group, the other groups used model mice that had been treated with photoaging. The treatment method was that all mice (SPF male KM mice, 45 days old, with a body weight of 22-25g) used 4% sodium sulfide solution to remove the surface hair on the back, exposing skin of about 4cmx4cm in size, and depilating once every 5 days. The model group was subcutaneously injected with 5% D-galactose 10mg / kg in the back of the neck every day, and the UVB lamp was placed 40cm vertically above the mouse, with a radiation dose of 120mJ / cm each time. 2 , lasting 40 days.

[0107] Experimental groups: (1) normal mouse group without photoaging treatment, (2) normal saline group, (3) exosome group loaded with collagen mRNA delivered by soluble microneedles, (4) collagen solution (20% concentration), (5) exosomes loaded with collagen mRNA, and (6) exosome group.

[0108] The single dose of exosomes in mice was 2×10 10 The soluble microneedle patch was pressed into the back skin of the mouse for 1 hour until the microneedles were completely dissolved and there was no visible irritation on the skin at the patch site. The mice were treated with the microneedle patch twice in the first week and once in the second and third weeks, and the observation was carried out for a total of 28 days. The results showed that the delivery of collagen mRNA exosomes by soluble microneedles can significantly reduce the area and number of wrinkles and restore them to baseline levels (see Figure 2 ), and was significantly better than collagen solution and exosomes loaded with collagen mRNA.

[0109] 2. The soluble microneedles loaded with the exosome efficacy complex provided in Example 2 were subjected to in vitro cell experiments. PD-1 & CTLA-4 bispecific nanoantibody mRNA exosome soluble microneedles were added to the dendritic cell (DC cell) culture wells, and the ELISA method was used to detect the amount of nanoantibody secretion in the cell culture supernatant.

[0110] Branghans cells (DC cells) are found in the epidermis, and DC cells play an important role in anti-infection and immunity. In animal experiments and human experiments, the efficacy substances can be delivered into skin immune cells through soluble microneedles. This embodiment adopts an in vitro cell experimental method to co-culture the soluble microneedles of the exosome efficacy complex with dendritic cells to detect the function of the efficacy complex. The specific experimental process is as follows: 50 ml of human mononuclear cells (PBMC) are collected and separated by machine, and serum-free AIM V medium is added to the separated PBMC, transferred to a culture bottle and adhered to the wall for 2h or overnight at 37°C, and then the suspended cells and adhered cells are separated. The adhered cells are induced to differentiate into DC cells, suspended and divided into 24-well plates for culture, and the exosome efficacy complex is added after re-adherence, and the antibody secretion amount is detected by ELISA after 24 hours and 48 hours respectively.

[0111] Results Figure 3 In vitro cell experiments showed that soluble microneedles acted on DC cells, and DC secreted high levels of PD-1 & CTLA-4 bispecific antibodies, with the antibody secretion reaching 340ng / mL in 24 hours. The skin is composed of multiple cell types such as keratinocytes and fibroblasts. Soluble microneedles can be used to deliver nano-antibody mRNA exosomes, and can produce nano-antibody secretion, which plays an important role in the removal of senescent cells.

Claims

1. An exosome efficacy complex, characterized in that: At least including exosomes and nucleic acid substances encapsulated in the exosomes, wherein the exosomes are derived from animals, plants and / or microorganisms, and the nucleic acid substances are selected from DNA, RNA and fragments thereof, each (1-3)×10 12 Each exosome contains 1-3 mg of nucleic acid material.

2. The exosome efficacy complex according to claim 1, characterized in that: The exosomes are derived from Camelidae, preferably Bactrian camel, dromedary camel, llama, guanaco, alpaca and / or llama, more preferably alpaca.

3. The exosome efficacy complex according to claim 2, characterized in that: The steps for preparing the alpaca exosomes are as follows: 1) taking an alpaca umbilical cord, crushing it and culturing it in Dulbecco's modified Eagle's medium, exchanging the medium after 3-7 days, using trypsin to separate the tissue to obtain cells, and then amplifying them to select alpaca umbilical cord stem cells of the 3rd to 7th generations; 2) washing the alpaca umbilical cord stem cells obtained in step 1), continuing to culture them with Dulbecco's modified Eagle medium, collecting the culture medium and centrifuging and filtering it to obtain a stock solution containing exosomes; 3) Purifying the stock solution obtained in step 2) by column purification to obtain the alpaca exosomes.

4. The exosome efficacy complex according to claim 3, characterized in that: The steps for preparing alpaca exosomes have one or more of the following characteristics: 1) The Dulbecco's modified Eagle's medium in step 1) further contains low glucose, 10 wt % fetal bovine serum and 1 wt % penicillin and streptomycin; 2) the concentration of trypsin in step 1) is 0.01%-0.5%, preferably 0.1%; 3) In step 2), the Dulbecco's modified Eagle's medium is a serum-free low-glucose Dulbecco's modified Eagle's medium; 4) The centrifugal speed in step 2) is 1000×g-10000×g, and the centrifugal time is 10-30 minutes, preferably 20 minutes; 5) The filter used in the filtration in step 2) has a gap of 0.1-0.5 μm, preferably 0.22 μm; 6) In step 3), the purification column was washed with NaOH and 30% isopropanol.

5. The exosome efficacy complex according to any one of claims 1 to 4, characterized in that: The nucleic acid substance is selected from at least one of plasmid, mRNA, miRNA, siRNA, tRNA, and tRFs, preferably mRNA, and further preferably one or more of collagen mRNA, PD-1 nanoantibody mRNA, CTLA-4 nanoantibody mRNA, and PD-1 & CTLA-4 bispecific nanoantibody mRNA.

6. A method for preparing the exosome functional complex according to any one of claims 1 to 5, characterized in that: The nucleic acid material is encapsulated into the exosomes by any one of electroporation, extrusion, ultrasound, freeze-thaw cycle, membrane penetration, and dialysis, preferably electroporation.

7. Use of the exosome functional complex according to any one of claims 1 to 5, or the exosome functional complex prepared by the preparation method according to claim 6, in the preparation of the following products: 1) Anti-aging products; 2) Products that improve sleep; 3) Products that enhance immunity; 4) Antioxidant products.

8. The use according to claim 7, characterized in that: The product is an external product or an internal product. The external product is selected from skin care products, cosmetics, and hair care products; the internal product is selected from solid beverages, liquid beverages, dairy products, seasoning powders, nutritional products, and internal medical and health care products.

9. The use according to claim 8, characterized in that: The external product is selected from emulsions, gels, creams, soluble microneedles, and facial masks, preferably soluble microneedles.

10. The use according to claim 8 or 9, characterized in that: The external product contains any one or more of the following excipients: a. Antiseptic ingredients: the antiseptic ingredients are selected from one or more of methylparaben, ethylparaben, propylparaben, formaldehyde releasers, methylchloroisothiazolinone, methylisothiazolinone, phenoxyethanol, imidazolidinyl urea, isothiazolinone, phenol, benzoic acid, benzyl alcohol, potassium sorbate, bromopol, p-hydroxyacetophenone, chlorphenesin, triclosan, quaternary ammonium salt-15, dehydroacetic acid and its salts; b. Emulsifying component: the emulsifying component is selected from one or more of polyethylene glycols, glycerides, sugar derivatives, anionic emulsifiers, cationic emulsifiers, and phospholipids; c. Modification auxiliary materials: the modification auxiliary materials are selected from essences and / or pigments; d Cryoprotectant: trehalose and / or polyvinyl pyrrolidone 40, wherein the concentration of trehalose is 10-70 mM, preferably 50 mM, and the weight percentage of polyvinyl pyrrolidone 40 is 1-10 wt%, preferably 5 wt%.

11. The use according to claim 8, characterized in that: The oral product contains any one or more of the following excipients acceptable to food science: e. Flavoring agent: the flavoring agent is selected from one or more of oligofructose, lactose, stevioside, xylitol, honey, syrup, mint oil, instant tea powder, fruit juice powder, edible flavor, and citric acid; f. Dosage form excipients: The dosage form excipients are selected from one or more of maltodextrin, calcium stearate, magnesium stearate, hydroxypropyl methylcellulose, microcrystalline cellulose, and silicon dioxide.

12. A soluble microneedle loaded with the exosome efficacy complex according to any one of claims 1 to 5, characterized in that: The raw materials for its preparation include at least: exosome functional complex, soluble matrix material, and auxiliary materials. The mass ratio of the exosome functional complex, soluble matrix material, and auxiliary materials is (10-40):(10-40):(0.1-1), preferably 20:20:0.

3.

13. The soluble microneedle loaded with exosome efficacy complex according to claim 12, characterized in that: The soluble microneedles have one or more of the following characteristics: 1) The soluble matrix material comprises at least one of hyaluronic acid, polyamino acid and inulin, preferably a combination of hyaluronic acid, polyamino acid and inulin, and more preferably a combination of hyaluronic acid, polyamino acid and inulin in a mass ratio of (15-20):20:15; 2) The weight percentage of the hyaluronic acid is 10-30wt%, preferably 15-20wt%; 3) The auxiliary materials include sucrose, collagen, hydrophilic colloid, and cyclodextrin, and the mass ratio is (3-10):(3-10):(1-5):(1-5), preferably 5:5:3:2; 4) The circular diameter of the soluble microneedle is 100-500 μm and the length is 300-1000 μm.

Images